ID: 999553901

View in Genome Browser
Species Human (GRCh38)
Location 5:152720488-152720510
Sequence AACGTGTCTCCTCATGAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999553901_999553911 11 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553911 5:152720522-152720544 CTGTGGCAGCCTTGGGGGTAAGG No data
999553901_999553906 3 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553906 5:152720514-152720536 CTGCCTCACTGTGGCAGCCTTGG No data
999553901_999553908 5 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553908 5:152720516-152720538 GCCTCACTGTGGCAGCCTTGGGG No data
999553901_999553910 6 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553910 5:152720517-152720539 CCTCACTGTGGCAGCCTTGGGGG No data
999553901_999553907 4 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553907 5:152720515-152720537 TGCCTCACTGTGGCAGCCTTGGG No data
999553901_999553904 -6 Left 999553901 5:152720488-152720510 CCCCTCTCATGAGGAGACACGTT No data
Right 999553904 5:152720505-152720527 CACGTTCCGCTGCCTCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999553901 Original CRISPR AACGTGTCTCCTCATGAGAG GGG (reversed) Intergenic
No off target data available for this crispr