ID: 999559439

View in Genome Browser
Species Human (GRCh38)
Location 5:152785064-152785086
Sequence CGTGGTTACTGCTGAGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999559439_999559448 30 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG No data
999559439_999559447 29 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559447 5:152785116-152785138 GAGGGAGAGTGCACTGACTGTGG No data
999559439_999559445 10 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559445 5:152785097-152785119 AGAGAAAGTGTATGCTTGGGAGG No data
999559439_999559446 11 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559446 5:152785098-152785120 GAGAAAGTGTATGCTTGGGAGGG No data
999559439_999559444 7 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559444 5:152785094-152785116 GAGAGAGAAAGTGTATGCTTGGG No data
999559439_999559443 6 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559443 5:152785093-152785115 AGAGAGAGAAAGTGTATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999559439 Original CRISPR CGTGGTTACTGCTGAGAAAT GGG (reversed) Intergenic
No off target data available for this crispr