ID: 999559448

View in Genome Browser
Species Human (GRCh38)
Location 5:152785117-152785139
Sequence AGGGAGAGTGCACTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999559440_999559448 29 Left 999559440 5:152785065-152785087 CCATTTCTCAGCAGTAACCACGT No data
Right 999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG No data
999559439_999559448 30 Left 999559439 5:152785064-152785086 CCCATTTCTCAGCAGTAACCACG No data
Right 999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG No data
999559442_999559448 12 Left 999559442 5:152785082-152785104 CCACGTGGTACAGAGAGAGAAAG No data
Right 999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999559448 Original CRISPR AGGGAGAGTGCACTGACTGT GGG Intergenic
No off target data available for this crispr