ID: 999561322

View in Genome Browser
Species Human (GRCh38)
Location 5:152806596-152806618
Sequence ACTGTGGCTGCTCTTTGTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999561322_999561327 4 Left 999561322 5:152806596-152806618 CCACAACAAAGAGCAGCCACAGT No data
Right 999561327 5:152806623-152806645 ATCCAGGTTGGCTTATTCTTGGG No data
999561322_999561326 3 Left 999561322 5:152806596-152806618 CCACAACAAAGAGCAGCCACAGT No data
Right 999561326 5:152806622-152806644 CATCCAGGTTGGCTTATTCTTGG No data
999561322_999561324 -8 Left 999561322 5:152806596-152806618 CCACAACAAAGAGCAGCCACAGT No data
Right 999561324 5:152806611-152806633 GCCACAGTAAACATCCAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999561322 Original CRISPR ACTGTGGCTGCTCTTTGTTG TGG (reversed) Intergenic
No off target data available for this crispr