ID: 999565360

View in Genome Browser
Species Human (GRCh38)
Location 5:152854182-152854204
Sequence ATCTAGTTCTTAGGGAAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999565357_999565360 0 Left 999565357 5:152854159-152854181 CCACGTACTTACTGATGTGCAAA No data
Right 999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG No data
999565355_999565360 9 Left 999565355 5:152854150-152854172 CCTTGTCTCCCACGTACTTACTG No data
Right 999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG No data
999565356_999565360 1 Left 999565356 5:152854158-152854180 CCCACGTACTTACTGATGTGCAA No data
Right 999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999565360 Original CRISPR ATCTAGTTCTTAGGGAAACA TGG Intergenic
No off target data available for this crispr