ID: 999565499

View in Genome Browser
Species Human (GRCh38)
Location 5:152855875-152855897
Sequence CAGAGCCGGGACTTTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999565499_999565506 16 Left 999565499 5:152855875-152855897 CCAATGCCAAAGTCCCGGCTCTG No data
Right 999565506 5:152855914-152855936 TGGGCTGAAGCTAGCTTCTTTGG No data
999565499_999565505 -3 Left 999565499 5:152855875-152855897 CCAATGCCAAAGTCCCGGCTCTG No data
Right 999565505 5:152855895-152855917 CTGTGGTTTATTTTTATGTTGGG No data
999565499_999565504 -4 Left 999565499 5:152855875-152855897 CCAATGCCAAAGTCCCGGCTCTG No data
Right 999565504 5:152855894-152855916 TCTGTGGTTTATTTTTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999565499 Original CRISPR CAGAGCCGGGACTTTGGCAT TGG (reversed) Intergenic
No off target data available for this crispr