ID: 999579349

View in Genome Browser
Species Human (GRCh38)
Location 5:153018620-153018642
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999579344_999579349 30 Left 999579344 5:153018567-153018589 CCAAAAAAAATTTAGGCAAGAAA No data
Right 999579349 5:153018620-153018642 TAAAAGTAAAATTGTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr