ID: 999580340

View in Genome Browser
Species Human (GRCh38)
Location 5:153031439-153031461
Sequence GTGAATAAAGGGATGGAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999580340_999580345 21 Left 999580340 5:153031439-153031461 CCTATCTCCATCCCTTTATTCAC No data
Right 999580345 5:153031483-153031505 AGATCTTTGAATGACAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999580340 Original CRISPR GTGAATAAAGGGATGGAGAT AGG (reversed) Intergenic
No off target data available for this crispr