ID: 999583251

View in Genome Browser
Species Human (GRCh38)
Location 5:153062827-153062849
Sequence CTGCTTTTCTTAAGCAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999583251_999583255 14 Left 999583251 5:153062827-153062849 CCATTTTTGCTTAAGAAAAGCAG No data
Right 999583255 5:153062864-153062886 CTCTCATCCCTGCTTAATTAGGG No data
999583251_999583257 16 Left 999583251 5:153062827-153062849 CCATTTTTGCTTAAGAAAAGCAG No data
Right 999583257 5:153062866-153062888 CTCATCCCTGCTTAATTAGGGGG No data
999583251_999583254 13 Left 999583251 5:153062827-153062849 CCATTTTTGCTTAAGAAAAGCAG No data
Right 999583254 5:153062863-153062885 GCTCTCATCCCTGCTTAATTAGG No data
999583251_999583256 15 Left 999583251 5:153062827-153062849 CCATTTTTGCTTAAGAAAAGCAG No data
Right 999583256 5:153062865-153062887 TCTCATCCCTGCTTAATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999583251 Original CRISPR CTGCTTTTCTTAAGCAAAAA TGG (reversed) Intergenic
No off target data available for this crispr