ID: 999589291

View in Genome Browser
Species Human (GRCh38)
Location 5:153126263-153126285
Sequence ACTTAAGTATTTGCCTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999589290_999589291 -3 Left 999589290 5:153126243-153126265 CCTATTCGCAGGAAATACATACT No data
Right 999589291 5:153126263-153126285 ACTTAAGTATTTGCCTGTAAAGG No data
999589289_999589291 -2 Left 999589289 5:153126242-153126264 CCCTATTCGCAGGAAATACATAC No data
Right 999589291 5:153126263-153126285 ACTTAAGTATTTGCCTGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999589291 Original CRISPR ACTTAAGTATTTGCCTGTAA AGG Intergenic
No off target data available for this crispr