ID: 999592046

View in Genome Browser
Species Human (GRCh38)
Location 5:153158838-153158860
Sequence CAGGAAAAGGAAAAGCAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592046_999592051 0 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592051 5:153158861-153158883 ACTCACTGTTTCTGTCCTGTTGG No data
999592046_999592054 3 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592054 5:153158864-153158886 CACTGTTTCTGTCCTGTTGGGGG No data
999592046_999592058 30 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592058 5:153158891-153158913 GCAAGGGTGAAGTGCTGCCATGG No data
999592046_999592055 13 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592055 5:153158874-153158896 GTCCTGTTGGGGGCTGAGCAAGG No data
999592046_999592056 14 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592056 5:153158875-153158897 TCCTGTTGGGGGCTGAGCAAGGG No data
999592046_999592052 1 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592052 5:153158862-153158884 CTCACTGTTTCTGTCCTGTTGGG No data
999592046_999592053 2 Left 999592046 5:153158838-153158860 CCCGCCTGCTTTTCCTTTTCCTG No data
Right 999592053 5:153158863-153158885 TCACTGTTTCTGTCCTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592046 Original CRISPR CAGGAAAAGGAAAAGCAGGC GGG (reversed) Intergenic
No off target data available for this crispr