ID: 999592249

View in Genome Browser
Species Human (GRCh38)
Location 5:153160822-153160844
Sequence CAGTATAGACAGAAATTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592244_999592249 20 Left 999592244 5:153160779-153160801 CCCACTTCCTTTAGACGGTTGAA No data
Right 999592249 5:153160822-153160844 CAGTATAGACAGAAATTGGTGGG No data
999592245_999592249 19 Left 999592245 5:153160780-153160802 CCACTTCCTTTAGACGGTTGAAA No data
Right 999592249 5:153160822-153160844 CAGTATAGACAGAAATTGGTGGG No data
999592246_999592249 13 Left 999592246 5:153160786-153160808 CCTTTAGACGGTTGAAAATAAGT No data
Right 999592249 5:153160822-153160844 CAGTATAGACAGAAATTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592249 Original CRISPR CAGTATAGACAGAAATTGGT GGG Intergenic
No off target data available for this crispr