ID: 999592328

View in Genome Browser
Species Human (GRCh38)
Location 5:153161795-153161817
Sequence GGGGCTTTATCTTAGCTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592328_999592334 20 Left 999592328 5:153161795-153161817 CCATTTAGCTAAGATAAAGCCCC No data
Right 999592334 5:153161838-153161860 TTTTTTTCTGCAGAGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592328 Original CRISPR GGGGCTTTATCTTAGCTAAA TGG (reversed) Intergenic