ID: 999592334

View in Genome Browser
Species Human (GRCh38)
Location 5:153161838-153161860
Sequence TTTTTTTCTGCAGAGCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592329_999592334 1 Left 999592329 5:153161814-153161836 CCCCACTTATTCATCTCCCAGTT No data
Right 999592334 5:153161838-153161860 TTTTTTTCTGCAGAGCATGAAGG No data
999592330_999592334 0 Left 999592330 5:153161815-153161837 CCCACTTATTCATCTCCCAGTTT No data
Right 999592334 5:153161838-153161860 TTTTTTTCTGCAGAGCATGAAGG No data
999592328_999592334 20 Left 999592328 5:153161795-153161817 CCATTTAGCTAAGATAAAGCCCC No data
Right 999592334 5:153161838-153161860 TTTTTTTCTGCAGAGCATGAAGG No data
999592331_999592334 -1 Left 999592331 5:153161816-153161838 CCACTTATTCATCTCCCAGTTTT No data
Right 999592334 5:153161838-153161860 TTTTTTTCTGCAGAGCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592334 Original CRISPR TTTTTTTCTGCAGAGCATGA AGG Intergenic