ID: 999592707

View in Genome Browser
Species Human (GRCh38)
Location 5:153166437-153166459
Sequence TCCTCTCCAGAATAGATGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592707_999592709 4 Left 999592707 5:153166437-153166459 CCCAACATCTATTCTGGAGAGGA No data
Right 999592709 5:153166464-153166486 ACCCTTGAGTGAGTTTAGACTGG No data
999592707_999592713 17 Left 999592707 5:153166437-153166459 CCCAACATCTATTCTGGAGAGGA No data
Right 999592713 5:153166477-153166499 TTTAGACTGGATGACACTGGAGG No data
999592707_999592712 14 Left 999592707 5:153166437-153166459 CCCAACATCTATTCTGGAGAGGA No data
Right 999592712 5:153166474-153166496 GAGTTTAGACTGGATGACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592707 Original CRISPR TCCTCTCCAGAATAGATGTT GGG (reversed) Intergenic