ID: 999592707 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 5:153166437-153166459 |
Sequence | TCCTCTCCAGAATAGATGTT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
999592707_999592709 | 4 | Left | 999592707 | 5:153166437-153166459 | CCCAACATCTATTCTGGAGAGGA | No data | ||
Right | 999592709 | 5:153166464-153166486 | ACCCTTGAGTGAGTTTAGACTGG | No data | ||||
999592707_999592713 | 17 | Left | 999592707 | 5:153166437-153166459 | CCCAACATCTATTCTGGAGAGGA | No data | ||
Right | 999592713 | 5:153166477-153166499 | TTTAGACTGGATGACACTGGAGG | No data | ||||
999592707_999592712 | 14 | Left | 999592707 | 5:153166437-153166459 | CCCAACATCTATTCTGGAGAGGA | No data | ||
Right | 999592712 | 5:153166474-153166496 | GAGTTTAGACTGGATGACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
999592707 | Original CRISPR | TCCTCTCCAGAATAGATGTT GGG (reversed) | Intergenic | ||