ID: 999592709

View in Genome Browser
Species Human (GRCh38)
Location 5:153166464-153166486
Sequence ACCCTTGAGTGAGTTTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592708_999592709 3 Left 999592708 5:153166438-153166460 CCAACATCTATTCTGGAGAGGAT No data
Right 999592709 5:153166464-153166486 ACCCTTGAGTGAGTTTAGACTGG No data
999592704_999592709 19 Left 999592704 5:153166422-153166444 CCAAGCAGGTTTTTGCCCAACAT No data
Right 999592709 5:153166464-153166486 ACCCTTGAGTGAGTTTAGACTGG No data
999592707_999592709 4 Left 999592707 5:153166437-153166459 CCCAACATCTATTCTGGAGAGGA No data
Right 999592709 5:153166464-153166486 ACCCTTGAGTGAGTTTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592709 Original CRISPR ACCCTTGAGTGAGTTTAGAC TGG Intergenic
No off target data available for this crispr