ID: 999592713

View in Genome Browser
Species Human (GRCh38)
Location 5:153166477-153166499
Sequence TTTAGACTGGATGACACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592708_999592713 16 Left 999592708 5:153166438-153166460 CCAACATCTATTCTGGAGAGGAT No data
Right 999592713 5:153166477-153166499 TTTAGACTGGATGACACTGGAGG No data
999592707_999592713 17 Left 999592707 5:153166437-153166459 CCCAACATCTATTCTGGAGAGGA No data
Right 999592713 5:153166477-153166499 TTTAGACTGGATGACACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592713 Original CRISPR TTTAGACTGGATGACACTGG AGG Intergenic
No off target data available for this crispr