ID: 999592886

View in Genome Browser
Species Human (GRCh38)
Location 5:153168103-153168125
Sequence TACAGCACTTTGAGAACCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999592883_999592886 -4 Left 999592883 5:153168084-153168106 CCGATCCTGCTGGTCCAAATACA No data
Right 999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG No data
999592884_999592886 -9 Left 999592884 5:153168089-153168111 CCTGCTGGTCCAAATACAGCACT No data
Right 999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG No data
999592881_999592886 6 Left 999592881 5:153168074-153168096 CCAAGCAATGCCGATCCTGCTGG No data
Right 999592886 5:153168103-153168125 TACAGCACTTTGAGAACCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999592886 Original CRISPR TACAGCACTTTGAGAACCAG TGG Intergenic
No off target data available for this crispr