ID: 999594338

View in Genome Browser
Species Human (GRCh38)
Location 5:153185443-153185465
Sequence TTCAAACTTTAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999594338_999594346 28 Left 999594338 5:153185443-153185465 CCTTCCACCTTCTAAAGTTTGAA No data
Right 999594346 5:153185494-153185516 CCAAGTCCAGCCCATAATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999594338 Original CRISPR TTCAAACTTTAGAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr