ID: 999595104

View in Genome Browser
Species Human (GRCh38)
Location 5:153194485-153194507
Sequence TTGGTATGGAGGGAGATCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999595104_999595111 18 Left 999595104 5:153194485-153194507 CCTCTGATCTCCCTCCATACCAA No data
Right 999595111 5:153194526-153194548 ATCAGATATTTTAATACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999595104 Original CRISPR TTGGTATGGAGGGAGATCAG AGG (reversed) Intergenic
No off target data available for this crispr