ID: 999595855

View in Genome Browser
Species Human (GRCh38)
Location 5:153203381-153203403
Sequence CTGTGAACTAGGACCTAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999595853_999595855 -4 Left 999595853 5:153203362-153203384 CCTTCACAAGAGGCTCTGACTGT No data
Right 999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG No data
999595852_999595855 3 Left 999595852 5:153203355-153203377 CCACACACCTTCACAAGAGGCTC No data
Right 999595855 5:153203381-153203403 CTGTGAACTAGGACCTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999595855 Original CRISPR CTGTGAACTAGGACCTAACA TGG Intergenic
No off target data available for this crispr