ID: 999597781

View in Genome Browser
Species Human (GRCh38)
Location 5:153224172-153224194
Sequence AGAACCATACTTTTACGTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999597781_999597784 5 Left 999597781 5:153224172-153224194 CCTTGACGTAAAAGTATGGTTCT No data
Right 999597784 5:153224200-153224222 CCAGCGGAATCAGCATCATGTGG No data
999597781_999597785 6 Left 999597781 5:153224172-153224194 CCTTGACGTAAAAGTATGGTTCT No data
Right 999597785 5:153224201-153224223 CAGCGGAATCAGCATCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999597781 Original CRISPR AGAACCATACTTTTACGTCA AGG (reversed) Intergenic
No off target data available for this crispr