ID: 999597785

View in Genome Browser
Species Human (GRCh38)
Location 5:153224201-153224223
Sequence CAGCGGAATCAGCATCATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999597781_999597785 6 Left 999597781 5:153224172-153224194 CCTTGACGTAAAAGTATGGTTCT No data
Right 999597785 5:153224201-153224223 CAGCGGAATCAGCATCATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999597785 Original CRISPR CAGCGGAATCAGCATCATGT GGG Intergenic
No off target data available for this crispr