ID: 999601633

View in Genome Browser
Species Human (GRCh38)
Location 5:153272568-153272590
Sequence CTTTTTGCACTGACTGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999601630_999601633 -5 Left 999601630 5:153272550-153272572 CCGTAGACTCATTTCTGCCTTTT No data
Right 999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG No data
999601629_999601633 4 Left 999601629 5:153272541-153272563 CCTGGGAAGCCGTAGACTCATTT No data
Right 999601633 5:153272568-153272590 CTTTTTGCACTGACTGAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999601633 Original CRISPR CTTTTTGCACTGACTGAGGC CGG Intergenic
No off target data available for this crispr