ID: 999614146

View in Genome Browser
Species Human (GRCh38)
Location 5:153404538-153404560
Sequence CTTCAAGACCCAAAGGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999614142_999614146 4 Left 999614142 5:153404511-153404533 CCTCAAGGGCTGTCATTCCTGGA No data
Right 999614146 5:153404538-153404560 CTTCAAGACCCAAAGGAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999614146 Original CRISPR CTTCAAGACCCAAAGGAGCT AGG Intergenic
No off target data available for this crispr