ID: 999622877

View in Genome Browser
Species Human (GRCh38)
Location 5:153490410-153490432
Sequence GTGTGCAGAAAGGTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 397}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999622877_999622887 5 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622887 5:153490438-153490460 AAGGAGGATAAGGTGAGGATGGG 0: 1
1: 0
2: 4
3: 40
4: 490
999622877_999622893 21 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622893 5:153490454-153490476 GGATGGGAGGAAGGGGGAACAGG 0: 1
1: 0
2: 12
3: 189
4: 1787
999622877_999622895 26 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622895 5:153490459-153490481 GGAGGAAGGGGGAACAGGTAGGG 0: 1
1: 0
2: 10
3: 105
4: 993
999622877_999622889 12 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622889 5:153490445-153490467 ATAAGGTGAGGATGGGAGGAAGG 0: 1
1: 1
2: 3
3: 72
4: 942
999622877_999622886 4 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622886 5:153490437-153490459 AAAGGAGGATAAGGTGAGGATGG 0: 1
1: 0
2: 6
3: 80
4: 891
999622877_999622894 25 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622894 5:153490458-153490480 GGGAGGAAGGGGGAACAGGTAGG 0: 1
1: 0
2: 11
3: 131
4: 1329
999622877_999622896 29 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622896 5:153490462-153490484 GGAAGGGGGAACAGGTAGGGAGG 0: 1
1: 0
2: 5
3: 108
4: 944
999622877_999622891 14 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622891 5:153490447-153490469 AAGGTGAGGATGGGAGGAAGGGG 0: 1
1: 1
2: 13
3: 140
4: 1360
999622877_999622892 15 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622892 5:153490448-153490470 AGGTGAGGATGGGAGGAAGGGGG No data
999622877_999622888 8 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622888 5:153490441-153490463 GAGGATAAGGTGAGGATGGGAGG 0: 1
1: 0
2: 0
3: 62
4: 908
999622877_999622885 0 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622885 5:153490433-153490455 ACAGAAAGGAGGATAAGGTGAGG 0: 1
1: 1
2: 3
3: 58
4: 1324
999622877_999622884 -5 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622884 5:153490428-153490450 CACACACAGAAAGGAGGATAAGG 0: 1
1: 0
2: 0
3: 55
4: 464
999622877_999622890 13 Left 999622877 5:153490410-153490432 CCCACCTCCACCTTTCTGCACAC 0: 1
1: 0
2: 0
3: 29
4: 397
Right 999622890 5:153490446-153490468 TAAGGTGAGGATGGGAGGAAGGG 0: 1
1: 1
2: 3
3: 69
4: 811

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999622877 Original CRISPR GTGTGCAGAAAGGTGGAGGT GGG (reversed) Intronic
900971873 1:5996343-5996365 GTGTGCAGGAAGAGGGAGGCTGG - Intronic
901279027 1:8017759-8017781 GCTTGCAGACAGGTGGGGGTTGG - Intronic
901300806 1:8198880-8198902 GTGTGCAGAATGGCGGGGCTTGG - Intergenic
901556396 1:10034612-10034634 CAGTGAAGAAATGTGGAGGTAGG - Intronic
903158710 1:21469086-21469108 GTTTGCAGTCAGGTGGGGGTGGG + Intronic
903768172 1:25748029-25748051 GGTTGGAGAAAGGTGGAGGAAGG + Intronic
904532385 1:31177765-31177787 ATGAGCAAAATGGTGGAGGTAGG - Intergenic
904699356 1:32349235-32349257 GTGGGCAGAAGGGAGGAGATGGG - Intergenic
904963935 1:34357070-34357092 GTGTGCAGCAGGGTAGAGCTAGG - Intergenic
905329164 1:37180077-37180099 GTGTGCAGCAAGGTGGGAGGTGG - Intergenic
905693814 1:39960745-39960767 GAGTCAAGAGAGGTGGAGGTGGG + Intronic
905906822 1:41623921-41623943 GTGTGCAGAGAAGTGGGGGTGGG - Intronic
907240737 1:53079550-53079572 GTCTGCAGAGGGCTGGAGGTGGG + Intronic
908372340 1:63495663-63495685 TTGTGGAGGAAGGTGGGGGTGGG + Intronic
908406619 1:63820361-63820383 GTGTTCAGTAAGGTGGATTTTGG + Intronic
908751531 1:67429431-67429453 GTGTGGAGTAAGCTGCAGGTTGG - Intronic
909394494 1:75154681-75154703 GTGGGCAGAACTGTGGAGTTTGG + Intronic
909893406 1:81035655-81035677 GTGTAGAGAGAGGTGGACGTGGG + Intergenic
911535531 1:99095379-99095401 GAGTGCCCAAAGGTGGAGGGGGG - Intergenic
912082336 1:105952124-105952146 GTGTGCAGACAGGGGCAGGCAGG - Intergenic
914754438 1:150554642-150554664 GTCTGCAGAAGGGTCGGGGTGGG + Intronic
914940527 1:152019026-152019048 GTTTGCAGTCAGGTGGCGGTGGG + Intergenic
915732921 1:158066926-158066948 GGGAGCAGAAAGGGGGTGGTAGG - Intronic
915791660 1:158678687-158678709 GTGTGCATCAAGTTGGAGCTAGG - Intronic
915853933 1:159360721-159360743 GTGTGAAGAAATAGGGAGGTGGG + Intergenic
916037471 1:160933761-160933783 GTGTGGAGGGAGGTGGACGTGGG + Intergenic
916078939 1:161219982-161220004 TTGTGCAGCACTGTGGAGGTTGG - Intronic
916205048 1:162308309-162308331 GTGGGCACACAGGTGGAGTTGGG + Intronic
916210295 1:162354802-162354824 GGGTCCAGAAATGAGGAGGTTGG - Intronic
917466288 1:175279760-175279782 GTGTGTGGAAAGGTTGAAGTTGG - Intergenic
917742689 1:177976272-177976294 GGGTGAAGAGAGGAGGAGGTTGG - Intronic
917929010 1:179811133-179811155 GTGTGCAGGAACGTGGGGGATGG + Intronic
919464811 1:197914729-197914751 GTCTGGAGAAAGCTGGGGGTGGG - Intronic
920100767 1:203515720-203515742 CAGGGGAGAAAGGTGGAGGTGGG + Intergenic
920263169 1:204703449-204703471 GTGTGCAGGGAGCTGGAGGGCGG - Intergenic
920500082 1:206480261-206480283 GTGGGCAGAGAGGGGGAGGCGGG + Intronic
921734976 1:218616960-218616982 TTGTGCATAAAGGAGGGGGTGGG + Intergenic
923371110 1:233313886-233313908 GTGTTGAGAAAGGTGCTGGTGGG + Intergenic
923925481 1:238622072-238622094 GTGGGAGGAAAGGAGGAGGTGGG + Intergenic
924494217 1:244570867-244570889 ATGTGCAAAGATGTGGAGGTAGG + Intronic
924536450 1:244939811-244939833 GTGGCCAAAAAGGTGGGGGTGGG + Intergenic
924939356 1:248802008-248802030 GTGGGCAGAGGAGTGGAGGTAGG + Intergenic
1063196507 10:3748551-3748573 GTGGGCAGGAATGTGCAGGTGGG - Intergenic
1064026633 10:11853798-11853820 GTGTGCAGTAGGGAGGAGGAAGG - Intronic
1065135738 10:22667911-22667933 GTGTGTAGAGAGGGGGAGGGAGG + Intronic
1065242903 10:23725887-23725909 GAGGGCACAAAGGTGGAAGTTGG - Intronic
1065268042 10:23997855-23997877 GTGTAGGGAATGGTGGAGGTTGG + Intronic
1065666766 10:28071431-28071453 GTGTGGAGAAAGGTTGAAGGTGG - Intronic
1067135901 10:43606874-43606896 GTGGGCAGACAGGTCCAGGTGGG - Intronic
1067482805 10:46615695-46615717 GTGTGAATAAAGGGGGAAGTGGG - Intergenic
1067611949 10:47725970-47725992 GTGTGAATAAAGGGGGAAGTGGG + Intergenic
1067716060 10:48691897-48691919 GTGTGCAGAAGGCTGCAGGGTGG + Intronic
1068781173 10:60920733-60920755 CTGAGCCGAGAGGTGGAGGTAGG - Intronic
1069882887 10:71604643-71604665 CTGAGCAAAAGGGTGGAGGTGGG - Intronic
1071228068 10:83554652-83554674 GAGTACAGACTGGTGGAGGTGGG - Intergenic
1071321798 10:84467635-84467657 GTGGGCAGTAGGGGGGAGGTGGG - Intronic
1071600501 10:86956493-86956515 GGGGGCAGGAGGGTGGAGGTAGG + Intronic
1071627367 10:87186205-87186227 GTGTGAATAAAGGGGGAAGTGGG + Intronic
1073103951 10:101021775-101021797 GTGGGCAGAACAGTGGGGGTAGG - Intronic
1073283743 10:102374392-102374414 GGGGGCAGGAAGGAGGAGGTGGG + Intronic
1075465152 10:122645395-122645417 GGGTGAAGAAAGGTGGAGCGAGG + Intergenic
1075669861 10:124256991-124257013 GTGTGGAGAAAGGTTGGGGGTGG - Intergenic
1075672100 10:124269889-124269911 GCGGGCAGTGAGGTGGAGGTAGG - Intergenic
1075803716 10:125170133-125170155 GTGGGGAGATAGGTGGTGGTGGG + Intergenic
1075849962 10:125578899-125578921 ATGTGGGGAAAGGTAGAGGTGGG - Intronic
1076084784 10:127617689-127617711 CTGGGCAGAAAGGTGGAGAATGG + Intergenic
1076514108 10:131033537-131033559 ATACGCAGAAAGATGGAGGTTGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078001501 11:7500380-7500402 GTGTGCAGAAGGGTGGATGAGGG - Intronic
1078479922 11:11666790-11666812 TTTTGCAGAGATGTGGAGGTGGG + Intergenic
1078865765 11:15295938-15295960 ATATGCAGGAAGGTGGAGGGTGG + Intergenic
1079022945 11:16924245-16924267 GGGAGCAGAAAGGTCCAGGTGGG - Intronic
1081541401 11:44037107-44037129 GGTTGGGGAAAGGTGGAGGTAGG - Intergenic
1082758850 11:57106448-57106470 GGGTTCAGAGAGGTGGAGGTAGG + Intergenic
1083180276 11:60980881-60980903 TTGAGCAGAAACCTGGAGGTGGG + Intronic
1083185505 11:61015654-61015676 GTGGGCGGAAAGGTGTAGGGAGG - Intronic
1084231652 11:67757819-67757841 CTGTGCAGAGAGGTGATGGTGGG + Intergenic
1085346562 11:75771873-75771895 GAGGGCAGGAGGGTGGAGGTGGG - Intronic
1086649360 11:89268770-89268792 GAGCCCAGAGAGGTGGAGGTGGG - Intronic
1087583782 11:100092769-100092791 GTGTGCTGGGAGGCGGAGGTGGG + Intronic
1087913435 11:103779973-103779995 GTGTTAAGAAAGGTAGTGGTAGG - Intergenic
1089130506 11:116208316-116208338 ATGGGCAGACAGGTGGTGGTAGG + Intergenic
1090166061 11:124548841-124548863 GTGTTCAGCAAGGTGGTGGAGGG - Intergenic
1090467212 11:126945195-126945217 GACAGCAGAAAGGTGGAGGTGGG - Intronic
1091301792 11:134512552-134512574 GTGTGCAGAGAGCTTGAGTTTGG + Intergenic
1091631947 12:2168710-2168732 GTCCTCAGAGAGGTGGAGGTGGG + Intronic
1091815972 12:3438193-3438215 GTGTTCAGAGAGGTGGAGGGAGG + Intronic
1092041515 12:5389266-5389288 TGGTCCAGAAAGGTGAAGGTTGG - Intergenic
1092280412 12:7093590-7093612 GGGGGCAGAAGGGTGGAGGTTGG - Intronic
1093587352 12:20855539-20855561 GTGTGAAGAAAGGTTGAGGGAGG + Intronic
1093600550 12:21016140-21016162 GTGTGAAGAAAGGCTGAGGGAGG + Intronic
1094478280 12:30859328-30859350 GTGTTCAGAGAAGTGGAGGGAGG - Intergenic
1095246599 12:39930252-39930274 GTAGGCAGCAAGGTGGAGGAGGG + Intronic
1096836114 12:54352343-54352365 GTGCGAATAAAGGTGGAGGAGGG - Intergenic
1098343288 12:69473444-69473466 GTGAGCAGAAGTGTGGAGGTGGG + Intronic
1098404048 12:70105146-70105168 GTGTGCAGAGAGGCGGGGGTGGG - Intergenic
1098738002 12:74131877-74131899 GTGGGGAGAAAGGGAGAGGTGGG - Intergenic
1099094168 12:78352580-78352602 GGGTGGAGAAACGTGGAGGGAGG - Intergenic
1099662503 12:85582386-85582408 GGGACAAGAAAGGTGGAGGTTGG - Intergenic
1100224907 12:92546644-92546666 GAGTGTAGATAGGTGGAGGAAGG - Intergenic
1100793589 12:98156867-98156889 GTGTGCAAAGACATGGAGGTAGG + Intergenic
1101369137 12:104108899-104108921 GTGGGTAGAATGGTGGTGGTGGG - Intergenic
1102542802 12:113634813-113634835 GTGAGCAGAAGGGTGGGGGTGGG - Intergenic
1102815469 12:115861838-115861860 GTGAACAGGAAGGTGGAGATTGG + Intergenic
1102969874 12:117157951-117157973 GAGCGCAAAAAGGAGGAGGTGGG - Exonic
1103412466 12:120722172-120722194 ATGTGGAGGAAGGAGGAGGTGGG + Exonic
1107743464 13:43479736-43479758 ATGGGCAGAAAGATGGAGCTGGG - Intronic
1108256181 13:48613220-48613242 TTATGCAGAAATGTGGAGATGGG + Intergenic
1108993434 13:56694132-56694154 TTTTGCAGAAAGGTGGTGGTTGG + Intergenic
1112901999 13:104368284-104368306 GTGTGTAGTAAGGTTGTGGTGGG - Intergenic
1113144331 13:107190869-107190891 GAGAGCAGAAAGGTAGAGTTTGG + Intronic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1115409937 14:33062446-33062468 GTGAGGAGAAAGGCAGAGGTGGG - Intronic
1117496492 14:56310605-56310627 GGGTACAGCAGGGTGGAGGTCGG - Intergenic
1117763935 14:59060614-59060636 GAGTGCAGAATGGTGGAGAGTGG + Intergenic
1118175468 14:63435677-63435699 GTGGGCAGTAAGGTGGAGAGAGG - Intronic
1119328642 14:73777502-73777524 GGGTGCAGAAAGGGGCAGGCAGG - Intronic
1119419366 14:74498622-74498644 GTTGGCAGGAAGGTGGAGATTGG + Exonic
1120062437 14:79999996-80000018 GTGTTCAGAAGTGTGGAGTTGGG - Intergenic
1120691900 14:87602088-87602110 GTGTAGAGAGAGGTGGAGGGAGG - Intergenic
1121563252 14:94889761-94889783 GTGTGCATGGGGGTGGAGGTGGG + Intergenic
1121773963 14:96578079-96578101 GTGGGCTGCAAGGTGGTGGTGGG - Intergenic
1121929651 14:97960853-97960875 GGGTTCAGAAAGGGGGAAGTGGG - Intronic
1122172081 14:99885020-99885042 GTGTGCAGCATGGTGAAGGGAGG - Intronic
1122307288 14:100773860-100773882 GTGTGCTGGAAGGTGCAGTTTGG + Intergenic
1122416298 14:101551232-101551254 GTGGGCAGAAGGGTTGGGGTGGG - Intergenic
1122499661 14:102188368-102188390 GTGGACAGAAATGTGGAGGAAGG - Intronic
1123034811 14:105467570-105467592 GTGTCCAGACAGGTGGAGATGGG - Intronic
1124235171 15:27983875-27983897 GTGTCCAGGAAGGGGGAGGTGGG - Intronic
1125174097 15:36800755-36800777 GTGTGCAGACATGTGGCTGTTGG - Intronic
1125524118 15:40364600-40364622 TGGGGCAGAAAGTTGGAGGTAGG + Intronic
1125738485 15:41944855-41944877 GTCTGCAGACAGGTGGAAATTGG - Intronic
1127309467 15:57739670-57739692 GTGTGCAGAGCAATGGAGGTTGG + Intronic
1128252729 15:66174275-66174297 GGCTGCAGAGAGATGGAGGTGGG + Intronic
1128535374 15:68486217-68486239 GGGAGGAGAAAGGTGGAGGGTGG + Intergenic
1128762532 15:70227170-70227192 GTGGGCAGCAGGGTGGGGGTAGG + Intergenic
1128782976 15:70375178-70375200 GTGTGCGGGGAGGTGGAGGAGGG - Intergenic
1128839533 15:70838752-70838774 GTTAGCAGAAAGTTGCAGGTAGG + Intronic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1130305696 15:82710876-82710898 GGGCCCAGAAAGGTGGAGCTTGG + Intergenic
1131008377 15:88997150-88997172 TGGTTCAGAAAGGTGGAAGTGGG - Intergenic
1131948790 15:97657374-97657396 GTGGTAAGAAAGGAGGAGGTAGG + Intergenic
1132339049 15:101066550-101066572 GTGTGCAGAAAGGTGCGGGAGGG - Intronic
1132577549 16:670949-670971 GTGTGCAGGAACGTGGCGGGCGG + Exonic
1136007502 16:27341086-27341108 GTGTGGAGAAAGGAAGAGGGTGG + Intronic
1136986661 16:35112674-35112696 CTGTGCAGAGATGTGGATGTTGG - Intergenic
1137222585 16:46470664-46470686 GTTTGCAGAGAGGCAGAGGTGGG + Intergenic
1137272074 16:46908403-46908425 GTGTGCAGAAAGGGATAGGCAGG - Intronic
1138090045 16:54166458-54166480 CTGTGCAGAAAAGTGAAGGAAGG + Intergenic
1141048810 16:80742424-80742446 GTGGGTAGAAGGGTGGAGGATGG + Intronic
1141048837 16:80742584-80742606 GTGGGTAGATAGGTGGAGGATGG + Intronic
1141206523 16:81937177-81937199 GGATGCAAATAGGTGGAGGTTGG + Intronic
1141382003 16:83585216-83585238 GAGTGCAGGAAGGTGGAAGGAGG - Intronic
1141838630 16:86559866-86559888 GTGAGGAGAAAGGGGGAGGTGGG + Intergenic
1142432964 16:90040492-90040514 GTGTCCCGCAAGCTGGAGGTAGG + Exonic
1143302652 17:5922358-5922380 GTTTGCAGTAAGGTGGGGGGGGG - Intronic
1144058738 17:11562785-11562807 GTGTGCAGCTCAGTGGAGGTGGG - Exonic
1144738246 17:17566836-17566858 GTCCACAGAAAGGTGGAAGTAGG + Intronic
1147258304 17:39195078-39195100 ATGTGCAGGGGGGTGGAGGTGGG - Intronic
1147597280 17:41725209-41725231 GTGTGGAGACGGGTGGGGGTGGG - Intronic
1148109243 17:45135575-45135597 CTGTGCTGAATGGTTGAGGTAGG + Exonic
1149423395 17:56532032-56532054 GTGTGCACACAGGTGGATATGGG - Intergenic
1149689339 17:58561380-58561402 GAGTGCAGACAGGTGGAGTCAGG + Intronic
1149693177 17:58595693-58595715 GTTTGCAGTCAGCTGGAGGTTGG - Intronic
1151188094 17:72378709-72378731 GTGTGCAGGCAGGGGGAGGGCGG + Intergenic
1151436846 17:74102957-74102979 GTGGGCAGGAAGGAGGTGGTAGG - Intergenic
1155261247 18:24044545-24044567 GTGAGGACCAAGGTGGAGGTTGG + Intronic
1155444548 18:25897415-25897437 GGGGGGAGAAAGATGGAGGTGGG - Intergenic
1156105378 18:33653201-33653223 GTGTTCAGGAGGGTGGGGGTAGG + Intronic
1157326317 18:46671426-46671448 TTGTGCACAGATGTGGAGGTGGG + Intronic
1157390164 18:47295157-47295179 GTGTGCAGAAAGAGGGAGATGGG - Intergenic
1157874184 18:51256630-51256652 GTGTGTACAAATGTGGTGGTGGG + Intergenic
1159644182 18:70898093-70898115 TTGTGGAGAAAGTTGGAGGTGGG - Intergenic
1159902450 18:74060309-74060331 GTGTGTGGAAAGGAGAAGGTAGG - Intergenic
1160087380 18:75789368-75789390 GGGTGCAGAAAGTTCCAGGTTGG + Intergenic
1160879846 19:1314401-1314423 GTGTGCAGAGGGGTAGAGGGAGG + Intergenic
1161156765 19:2735868-2735890 GTGTCCAGAAAGGAGGAGAAGGG - Intronic
1161366080 19:3880624-3880646 GTGTGCAGGGAGGAGGGGGTGGG - Exonic
1161466429 19:4433192-4433214 GTGTGCAGGTAGGTGGTGGAGGG - Exonic
1161961634 19:7526631-7526653 GTGGGCAGGCAGGTGCAGGTGGG + Intronic
1163438616 19:17310140-17310162 GGGCCCAGAATGGTGGAGGTGGG - Intronic
1163822920 19:19506339-19506361 CTGAGCAGAAAGCTGGAGGGGGG + Exonic
1164158771 19:22612758-22612780 TTGTGTAGAGGGGTGGAGGTGGG + Intergenic
1164648225 19:29874114-29874136 GGGTGCAGAAAAGGGGAGGGCGG + Intergenic
1165002456 19:32776212-32776234 GTGTGCAGTAATGTGGAATTGGG + Intronic
1165668707 19:37655935-37655957 GTTTGGAGGAGGGTGGAGGTTGG + Intronic
1166646079 19:44532845-44532867 GTGTACAGAAAGGTGTGGCTGGG - Intergenic
1166957278 19:46472927-46472949 ATGGGCAGCAAGGTTGAGGTAGG - Intergenic
1167235125 19:48309590-48309612 GTGTCCAGGAAGAAGGAGGTAGG - Intronic
924974666 2:161570-161592 GTGTGCAGGAAAGAGGAGTTGGG + Intergenic
925405120 2:3601086-3601108 GTTTGAAGAAAGGGGGATGTGGG + Intronic
926241790 2:11094337-11094359 GTGAGCAGAAAGGGGGAGGACGG - Intergenic
926245827 2:11121920-11121942 GTGTGGTGGGAGGTGGAGGTTGG - Intergenic
927715162 2:25347154-25347176 GTTTGCAGAGGGGTAGAGGTAGG + Intergenic
931201981 2:60106323-60106345 GTGTGTGCAAAGGTGGGGGTGGG - Intergenic
931668872 2:64629085-64629107 GGGTGCAGAATGCTGGAGGTGGG - Intergenic
931833936 2:66079864-66079886 GGGTGTAGAAAAGGGGAGGTGGG - Intergenic
932001625 2:67890451-67890473 GTCTGCAGATATGTTGAGGTGGG - Intergenic
932284492 2:70520804-70520826 TTGTGGAGAGTGGTGGAGGTTGG - Intronic
933198207 2:79417018-79417040 ATGTGCAGAAAGATGTAGTTTGG - Intronic
934163788 2:89275927-89275949 GAGTGCAGAGAGGAGGAGGCAGG - Intergenic
934203484 2:89906597-89906619 GAGTGCAGAGAGGAGGAGGCAGG + Intergenic
934663525 2:96155386-96155408 GGGTGGAGAAGGGTGGAGGGAGG - Intergenic
935245949 2:101219052-101219074 GGGCACAGAAAGGTGGAGGGAGG - Intronic
937150513 2:119682832-119682854 GAGAGCAGAGGGGTGGAGGTGGG + Intronic
937333393 2:121045789-121045811 CAGTGCAGAAAGGTGGATCTAGG - Intergenic
938028211 2:127969144-127969166 GTGTGGAGTGGGGTGGAGGTTGG + Intronic
938111201 2:128566522-128566544 GTGGTGAGTAAGGTGGAGGTGGG + Intergenic
939017623 2:136920476-136920498 GTGTTCAGAAAGAAGGAAGTGGG + Intronic
939098228 2:137861629-137861651 GTTGGCAAAAAGGTGAAGGTTGG + Intergenic
940800036 2:158123250-158123272 GTGTGCGGAAAGGGGGAAGGTGG + Intronic
941595536 2:167472300-167472322 GTATGAATAAAAGTGGAGGTGGG + Intergenic
942700436 2:178702096-178702118 GTGTTCAGAATGGTATAGGTAGG + Intronic
942825281 2:180168375-180168397 GTGCGGAGAAAGGAGGAAGTGGG - Intergenic
942948867 2:181700212-181700234 GTTGGCAGAAAGGTGGGGGCGGG + Intergenic
944540354 2:200748456-200748478 GTGTGCATGTATGTGGAGGTGGG - Intergenic
944932344 2:204532639-204532661 GTGTGGAAAAGGGTGGAGGGTGG - Intergenic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948588183 2:239034387-239034409 GTGTGCAGCACGGAGGAGCTGGG + Intergenic
949018800 2:241728850-241728872 CTGTGCAGACTGGTGGCGGTGGG + Exonic
1170869503 20:20192323-20192345 GGGTGGAGAAAGGTGGAGAGTGG - Intronic
1171358325 20:24567586-24567608 GTCTCCAGAAAGGAGGAGGCTGG - Intronic
1172407730 20:34702070-34702092 TTGAGCAAAAGGGTGGAGGTGGG + Intronic
1172592577 20:36128044-36128066 GTGTGCAGAAAGGAGCATGTGGG + Intronic
1174092168 20:48058275-48058297 GTATGCAGAAATGTGGAGCAGGG + Intergenic
1175290494 20:57871914-57871936 ATTTGCAGGAAGGGGGAGGTGGG + Intergenic
1175804270 20:61818785-61818807 GTGGGCGGAAAGGAGCAGGTGGG + Intronic
1175891050 20:62316116-62316138 GGGGTCAGAAGGGTGGAGGTGGG - Intronic
1179599138 21:42464348-42464370 GAGCGCAGCAAGGTGGAGATGGG + Intergenic
1179667491 21:42922789-42922811 GGGAGCAGAAGGGTGGAGGGGGG + Intergenic
1180216011 21:46324250-46324272 CGGCGCAGAAAGGTGGAGGCCGG + Exonic
1180633123 22:17243711-17243733 GTGTGGAGAAAGTGGGGGGTAGG - Intergenic
1180654975 22:17412753-17412775 GTGTGGAGACAGGTGGCGGGCGG + Intronic
1180713743 22:17857713-17857735 GTCTGCAGCAAGGCGGAGCTGGG + Intronic
1181114216 22:20621113-20621135 GTGCTAAGAAAGCTGGAGGTGGG + Intergenic
1181159512 22:20949946-20949968 GTCTGCAGAAAGCTGGACTTCGG - Exonic
1181455609 22:23058686-23058708 GTGGGCTGAGAGGTGGAGGAGGG - Intergenic
1181631053 22:24151574-24151596 CTGGGCAGCAAGGTGGGGGTGGG + Intronic
1181746021 22:24955486-24955508 TTGTGCAGAAGCCTGGAGGTAGG + Intronic
1181997067 22:26891525-26891547 ATGTGCTGGAAGGTGGAGATTGG + Intergenic
1182353322 22:29710929-29710951 GAGTGCAGGGAGCTGGAGGTGGG - Intergenic
1182517503 22:30867366-30867388 GTTTGAAGAAAGTTGGGGGTAGG - Intronic
1183199591 22:36376652-36376674 GGGAGGAGAAAGGTGGTGGTAGG - Intronic
1183392603 22:37554052-37554074 TTCAGCAGAGAGGTGGAGGTGGG - Intergenic
1183599623 22:38832379-38832401 TGGGGCAGAAAGGTGGAGGCTGG + Intronic
1183693583 22:39405670-39405692 TTGTTCAGAAATGTGGAGGAAGG + Intronic
1184050450 22:41999919-41999941 GTGTGCTTGAAGGTGGAGATGGG - Intronic
1184053586 22:42028068-42028090 GTGTGCACAAAGATGCATGTGGG + Exonic
1184280347 22:43434035-43434057 CAGTGCAGAAATGTGGACGTGGG - Intronic
1184380136 22:44140295-44140317 TTATACAGAAAGGTGGGGGTGGG - Intronic
1184883211 22:47325338-47325360 CTGAGCAGAAAGGTGGAAGGAGG + Intergenic
1185102568 22:48849564-48849586 GTGTGCAGAGAGAGGGAGCTGGG + Intronic
1185239401 22:49734643-49734665 GGGTACAGTAGGGTGGAGGTGGG - Intergenic
949676786 3:6463554-6463576 GGGGGTAGAAAGGTGGAGGGAGG + Intergenic
949869992 3:8580283-8580305 GTGTGCAGAAAGGCTGGGCTGGG - Intergenic
950313999 3:11984392-11984414 GTGTGAAGACAGATGGAGGGAGG - Intergenic
950670924 3:14524997-14525019 GTGTGCAGAAATGTGCATGTGGG + Intronic
950804062 3:15581709-15581731 GTGTACAGAGAGGTTGAGGTGGG - Intronic
951276472 3:20692588-20692610 GTGAGCAGAAAGGTAAAGGAAGG - Intergenic
952275846 3:31875905-31875927 GTGTGCAGGAGGTAGGAGGTGGG - Intronic
952521002 3:34157693-34157715 GTGTGGAGGAAGTTAGAGGTTGG + Intergenic
953183761 3:40619860-40619882 GTGTGGACAAAGGAGGAGGTGGG - Intergenic
953567493 3:44045164-44045186 GGGTGCAGAAAGGTTTCGGTGGG - Intergenic
953660006 3:44884945-44884967 GTCTGCAGAGAGGGGGAGTTGGG + Intronic
953875688 3:46665478-46665500 GTGGGCTGCAAGGTGGGGGTTGG + Intergenic
953885590 3:46712815-46712837 GAGAGCGGAACGGTGGAGGTTGG - Intronic
954579396 3:51695055-51695077 GTGTGCAGGCAGGTGCATGTTGG + Intronic
954840754 3:53509339-53509361 GTTAGGGGAAAGGTGGAGGTGGG + Intronic
955344612 3:58151871-58151893 GTATGGAGAAATGTGGAGGGCGG - Intronic
955518507 3:59751963-59751985 GACTGGAGAAAGGTGGTGGTGGG + Exonic
955943353 3:64167650-64167672 CTGGGCAGAAAGATGGAGGCTGG + Intronic
956901589 3:73721969-73721991 GTGTGGAGAAAAATGGAGATTGG + Intergenic
957048278 3:75393123-75393145 CTGTGCAGAGAGGTGATGGTGGG + Intergenic
957210777 3:77255527-77255549 GAGTTCAGAAAGTGGGAGGTTGG - Intronic
958560101 3:95737332-95737354 GAGTATAGAAAGGTGAAGGTTGG + Intergenic
961066449 3:123881055-123881077 ATCTGCAGAATGGTGCAGGTGGG + Intronic
961880353 3:130057219-130057241 CTGTGCAGAGAGGTGATGGTGGG + Intergenic
963728386 3:148947033-148947055 GAGCGCAGACAGGTGGAGGCGGG + Intergenic
964164239 3:153682338-153682360 GTGGACACAAAGGTTGAGGTTGG - Intergenic
964399791 3:156287085-156287107 GTGTGCAGTCAGTTGGAGTTGGG - Intronic
964428693 3:156580853-156580875 GTGTGTAGAAGGGTGTGGGTGGG - Intergenic
967136405 3:186516248-186516270 TTGTGCAGGTAGGTGGGGGTGGG - Intergenic
968992739 4:3925573-3925595 CTGTGCAGAGAGGTGATGGTGGG + Intergenic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969457392 4:7307989-7308011 GTGTGCACAGAGTGGGAGGTAGG + Intronic
969890886 4:10258995-10259017 GTGGGCAGACAGGTGGAGGCTGG + Intergenic
970793862 4:19889966-19889988 GGGAGCAGAAAAGTGGAGGGGGG - Intergenic
971322122 4:25614138-25614160 GGGTGCCCAAAGGTGCAGGTTGG + Intergenic
971361548 4:25942708-25942730 TGATGCAGAAAGGTGGAGGAGGG - Intergenic
973919038 4:55666096-55666118 GTCTGAAAAAAGCTGGAGGTGGG + Intergenic
973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG + Intergenic
973971421 4:56217412-56217434 CAGTCCAGAAAGGGGGAGGTGGG + Intronic
974950441 4:68579012-68579034 GGGAGCAGAAAAGTGGAGGGGGG - Intronic
974958824 4:68674531-68674553 GGGAGCAGAAAAGTGGAGGGGGG - Intergenic
977342887 4:95782257-95782279 GTGAGAAGAAAGATGGAAGTTGG - Intergenic
978237079 4:106472565-106472587 GAGGGCAGAGAGGTGGAGATAGG - Intergenic
979036674 4:115728593-115728615 ATGTTCAGAAAGCTGGAAGTAGG + Intergenic
980872766 4:138628626-138628648 GTTTGAAGAGAAGTGGAGGTAGG + Intergenic
981624010 4:146736084-146736106 GTTTGGAGAAATGTGAAGGTTGG + Intronic
981745261 4:148046511-148046533 GTGACCAGAAAGGAAGAGGTTGG + Intronic
982812292 4:159841052-159841074 AGGTTCAGAAAGGAGGAGGTTGG - Intergenic
983000526 4:162408859-162408881 GTATGCAGACAAGTGGAGGGTGG + Intergenic
983585832 4:169353600-169353622 GTATGGAGAAAGGTGGGGGTAGG - Intergenic
983612479 4:169664158-169664180 TAGTGTAGAAAGGTGGAAGTTGG + Intronic
984305511 4:177984394-177984416 GTGTGCAGAATGGGAGATGTTGG - Intronic
985720568 5:1486513-1486535 ATGTGATGAAAGGTGGAGGGAGG + Intronic
986341037 5:6789354-6789376 GTGAGCAGAATGCTGGAGGGGGG + Intergenic
986631111 5:9775164-9775186 GTGTGCAGAAAGGGGAGGGCAGG - Intergenic
986777267 5:11027842-11027864 TTGTGCAGAAAGGAGCTGGTGGG + Intronic
987398463 5:17449140-17449162 GTGGGGAGAGAGGTGGAGGTTGG - Intergenic
988491809 5:31711544-31711566 CAGTGCAGAGAGGTGGAGGGAGG + Intronic
990185097 5:53203142-53203164 GGGAGCAGAAAAGTGGAGGGGGG - Intergenic
990445094 5:55886846-55886868 GAGTTCTGAAAGGTGGAGATTGG - Intronic
990702967 5:58495532-58495554 GGATTCAGAAAGGTGGAGATAGG - Exonic
993124595 5:83817801-83817823 GTGTGCACATAGCTGGCGGTGGG + Intergenic
995042339 5:107603174-107603196 GTGTCCAGGAAGGAGGAGTTCGG - Intronic
995183912 5:109252510-109252532 GTGTGCAGCAAGGCAGAGCTGGG - Intergenic
995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG + Intergenic
996669125 5:126096527-126096549 GTCTGCAGAAAGGTTGGGGGAGG - Intergenic
996925642 5:128823209-128823231 GTTTACAGATAGGTGGGGGTTGG + Intronic
998686496 5:144533202-144533224 GTGTCTATAAAGGTGGGGGTGGG - Intergenic
998703986 5:144737911-144737933 GTGTCCAGGAAGGGTGAGGTTGG + Intergenic
999226642 5:150030844-150030866 GTATGCAGCTAGGTGGTGGTGGG + Intronic
999466983 5:151816638-151816660 TTGTGGAGCCAGGTGGAGGTGGG + Intergenic
999622877 5:153490410-153490432 GTGTGCAGAAAGGTGGAGGTGGG - Intronic
1000608649 5:163351441-163351463 GTGTGGAGAGAAGAGGAGGTAGG + Intergenic
1000874764 5:166622482-166622504 GAATGCAGAAAAGAGGAGGTGGG - Intergenic
1001519609 5:172381695-172381717 CTGTCCACAGAGGTGGAGGTGGG - Intronic
1002193156 5:177489325-177489347 GTGGGCAGACAGGTGGGGCTGGG + Intronic
1002213612 5:177612501-177612523 CTGTGCAGAAGTGGGGAGGTGGG + Intergenic
1003485104 6:6568850-6568872 GCATGGACAAAGGTGGAGGTGGG + Intergenic
1004194170 6:13488586-13488608 GGGTGCAGGGTGGTGGAGGTGGG - Intergenic
1004380921 6:15131907-15131929 GTGTGCAGAGGGCGGGAGGTGGG - Intergenic
1004466548 6:15890796-15890818 GATTGCAGAAAGCTGCAGGTTGG + Intergenic
1004473236 6:15947539-15947561 AGGTAAAGAAAGGTGGAGGTAGG + Intergenic
1004716109 6:18217806-18217828 TTGTGAAGACAGGTGGAAGTGGG + Exonic
1006337107 6:33426594-33426616 GGGGGCAGAAAGGGGGAGGGAGG - Intronic
1006695333 6:35926080-35926102 GGGTGGAGAAAGGTGGAGAGTGG + Intergenic
1006909456 6:37554790-37554812 GGGGGGAGAGAGGTGGAGGTGGG + Intergenic
1007619374 6:43202837-43202859 ATGTGGAGCAAGGTGAAGGTGGG - Intronic
1007637136 6:43306385-43306407 GTGGGCAGCAAGGGGGAGGGAGG - Intronic
1008055768 6:46944490-46944512 GTGTGTAGGAAGATGGGGGTAGG - Intronic
1008543619 6:52566630-52566652 GTGGGGACAAGGGTGGAGGTGGG - Intronic
1010165230 6:72906713-72906735 GTGTGCCCAAATGTGGAAGTGGG - Intronic
1011028879 6:82899345-82899367 GTGTGCAGAAAGTTCAGGGTTGG - Intronic
1011278907 6:85657205-85657227 GTGATGATAAAGGTGGAGGTTGG - Intergenic
1013226750 6:108124514-108124536 GGGTGCAGAGAGGTGGAGGGGGG + Intronic
1013260932 6:108441625-108441647 CTTTGCAGAAGGGTGGAGGCGGG - Intronic
1013455635 6:110326886-110326908 GGGTGGAGCAGGGTGGAGGTTGG + Intronic
1016035043 6:139375537-139375559 ATGTGCAAAAAGGTGGATCTGGG - Intergenic
1017119026 6:151006425-151006447 GTGTGAAGGAAGATGAAGGTAGG + Intronic
1018039912 6:159912488-159912510 AAGTGAAGAAAGGAGGAGGTGGG + Exonic
1020514077 7:9094185-9094207 GTGTGCATAGAGTTGTAGGTTGG - Intergenic
1022625615 7:32032945-32032967 GTGAGCAGAGAGCTGGAGATGGG + Intronic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023278579 7:38546875-38546897 GTGTGGAGAAGGGTGGAGAATGG - Intronic
1023336315 7:39174604-39174626 GGGTGAAGGAAGGAGGAGGTGGG - Intronic
1027128396 7:75573419-75573441 GTATGCAGACAAGTGGAGGGTGG - Intronic
1027254728 7:76423969-76423991 GTGTGAAGAGAGGTGGAGAAGGG - Intronic
1029729406 7:102429618-102429640 GAGTCCAGCAATGTGGAGGTGGG + Intergenic
1030093296 7:105876581-105876603 GTGTTCTGAAAGGGGGAGGGAGG + Exonic
1030820380 7:114085814-114085836 GTGGGGAGAAGGGTGGGGGTGGG + Intergenic
1031076575 7:117219209-117219231 GTGTGGTGAAAGGTGGGGATTGG + Intronic
1031277867 7:119753925-119753947 GTGAGCAGAATGGTGGTGGGGGG + Intergenic
1031500158 7:122504535-122504557 GTGGGAAGAAAGGTAGGGGTGGG - Intronic
1032144570 7:129367455-129367477 GTGTGCAGCAAGGAGGGAGTTGG + Intronic
1033322453 7:140352218-140352240 GTGTGGGGGAAGGTGGGGGTGGG + Intronic
1035421043 7:158729385-158729407 GGGAGGAGCAAGGTGGAGGTTGG + Intergenic
1036800343 8:11786328-11786350 GTGTCCAGAAAGGAGGATGTGGG + Exonic
1037130642 8:15404351-15404373 GGGTACAGGAAGGTGGAGATTGG + Intergenic
1037411951 8:18607263-18607285 TTCTGCAGAAATGTGGAGCTGGG - Intronic
1037686604 8:21144887-21144909 GTTTTCAGGAAGCTGGAGGTGGG - Intergenic
1037745607 8:21641837-21641859 CTGGGAAGAAAGGTGGAGGCAGG - Intergenic
1038672337 8:29592288-29592310 GTGTGTATAAGGGTGGTGGTAGG + Intergenic
1038928516 8:32167541-32167563 GTGTGAAGAAAGGTAGATCTGGG - Intronic
1039954932 8:42199967-42199989 GTGTGTTGAAATGTGGAGTTGGG - Intronic
1040599870 8:48872450-48872472 GTGTGACGAGAGGTGGAGGAAGG + Intergenic
1040620024 8:49081757-49081779 GTATGCTGGGAGGTGGAGGTGGG + Intergenic
1040694505 8:49979533-49979555 GTGTGCAGACAGGCAGAGGAAGG - Intronic
1041523165 8:58776719-58776741 GTGTGGAAAGAGGTGGACGTGGG + Intergenic
1041626184 8:60029995-60030017 GCGGGCAGAGAGGTGGAGGCAGG - Intergenic
1042158094 8:65865967-65865989 GGGAGCAGAAAAGTGGAGGACGG - Intergenic
1044900522 8:96938783-96938805 GAGTGGAGAAAGGTGGAGAGTGG + Intronic
1046015497 8:108599655-108599677 GTATCCAGGAAGTTGGAGGTGGG - Intergenic
1046496780 8:115024602-115024624 GGATGAAGAAAGGTGGAGGGTGG - Intergenic
1046637240 8:116683498-116683520 GTGTGATGATAGCTGGAGGTGGG - Intronic
1048887027 8:138916847-138916869 GTGGGCTGGAAGGTGGTGGTAGG + Intergenic
1049508768 8:143017701-143017723 GTGTGCGGAAATGTGAGGGTGGG - Intergenic
1049605776 8:143528618-143528640 ATGTGCAGGCCGGTGGAGGTCGG - Intronic
1050833688 9:10048893-10048915 AAGAGCAGAAAGGTGGTGGTAGG + Intronic
1051108058 9:13603503-13603525 GTGTGTAGAGAGGTGAAGCTGGG + Intergenic
1052797652 9:32938423-32938445 GTGTCTAGAATGGTGGTGGTGGG - Intergenic
1053428853 9:38028527-38028549 GTTTGCACAAAGGAGGAGATTGG - Intronic
1054848220 9:69819904-69819926 GTGTTCAGAAAGGTAGGGGAAGG + Intergenic
1057040706 9:91845500-91845522 GTGTGCATGAGGGTGGGGGTTGG - Intronic
1058659139 9:107252969-107252991 ATGTTCAAAAAGATGGAGGTAGG + Intergenic
1058893959 9:109383935-109383957 GTGGGGAGAATGGTGGAGGAGGG - Intronic
1058916247 9:109568646-109568668 GTGTGCACACCGGTGGGGGTAGG - Intergenic
1060259058 9:122057817-122057839 GTCTGTAGGAGGGTGGAGGTGGG - Intronic
1060412955 9:123412068-123412090 GTGTGGAGCATGGTGGAGGGCGG - Intronic
1060739784 9:126090753-126090775 GTGTGCTGAAGCCTGGAGGTGGG + Intergenic
1060780538 9:126409059-126409081 CTCAGCAGAATGGTGGAGGTGGG - Intronic
1061163142 9:128907408-128907430 GTCGGCAGAATGGTGGAGTTGGG - Exonic
1061225380 9:129278262-129278284 GTGTGGAGAAGGGTGGAGCTGGG - Intergenic
1061618514 9:131795561-131795583 GTGTGAAGACAGGTAGAGATTGG - Intergenic
1062180301 9:135187791-135187813 GTATGCAGATGGGTGGGGGTGGG - Intergenic
1062590252 9:137271357-137271379 GTGTGCGGACAGGTTGAGGATGG - Intronic
1186867264 X:13733099-13733121 GTGGGACCAAAGGTGGAGGTGGG + Intronic
1188285908 X:28325183-28325205 TATTGAAGAAAGGTGGAGGTGGG - Intergenic
1188732284 X:33664569-33664591 GGGTGGAGAAAGGTGGAGACTGG + Intergenic
1190620633 X:52284119-52284141 GTGTCCAGGAAGAAGGAGGTAGG + Intergenic
1191151031 X:57221112-57221134 GGGAGCAGAAAAGTGGAGGGGGG - Intergenic
1191864746 X:65694893-65694915 GTGTGAAGAATGGAGGATGTAGG + Intronic
1192430815 X:71110395-71110417 ATGGGCAGAAAAGAGGAGGTAGG - Intronic
1193963364 X:87952322-87952344 CTCTGCAGGAAGGTGGAGTTGGG - Intergenic
1194214747 X:91115977-91115999 GTCTGCTTAAAGGTGGAGGGTGG + Intergenic
1194222657 X:91214795-91214817 GTGTGCAGAAATATGAAGGATGG + Intergenic
1195178478 X:102333734-102333756 GTATGCAGACAAGTGGAGGGTGG + Intergenic
1195180386 X:102353349-102353371 GTATGCAGACAAGTGGAGGGTGG - Intergenic
1196160645 X:112478797-112478819 GGGAAAAGAAAGGTGGAGGTGGG - Intergenic
1196481589 X:116156648-116156670 GTGTGGAGAAGGGTGGTGGGTGG + Intergenic
1196535734 X:116841451-116841473 GGGTGCTGCAAGGTAGAGGTTGG - Intergenic
1198310076 X:135421942-135421964 GTGTGCGGGATCGTGGAGGTGGG + Intergenic
1198511449 X:137355834-137355856 GTGCCCAGAAAGTTGGAGGCAGG - Intergenic
1200085311 X:153601316-153601338 GTGTGCACAGATGTGGTGGTGGG - Intergenic
1200559188 Y:4678560-4678582 GTGTGCAGAAATATGAAGGATGG + Intergenic
1201691432 Y:16769998-16770020 CTGTGCAGCAAGGTGGATTTGGG - Intergenic