ID: 999623912

View in Genome Browser
Species Human (GRCh38)
Location 5:153500159-153500181
Sequence CAGGATCTTCAAACTAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 142}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999623912_999623917 19 Left 999623912 5:153500159-153500181 CCCTGACTAGTTTGAAGATCCTG 0: 1
1: 0
2: 1
3: 10
4: 142
Right 999623917 5:153500201-153500223 TGCTCTCCTCTCAGCCACTCAGG 0: 1
1: 0
2: 0
3: 26
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999623912 Original CRISPR CAGGATCTTCAAACTAGTCA GGG (reversed) Intronic
901306519 1:8236914-8236936 CAGGAGTTTGAAACTAGCCAGGG - Intergenic
904217238 1:28931188-28931210 CAGGAGTTTCATACTAGCCAGGG + Intronic
906176687 1:43780227-43780249 CAGTATCTTCAAAATACTGAGGG - Intronic
906748979 1:48242007-48242029 CAGGATCTTCAAAGTTCTCTTGG - Intronic
908430338 1:64050404-64050426 AAGCATCTTCAAACTATGCAGGG - Intronic
910109886 1:83671702-83671724 CAGGAACTTCAAGCTCTTCAAGG + Intergenic
910622098 1:89267083-89267105 CAGGATCTTCAACCCTGTCAAGG + Exonic
917732008 1:177883779-177883801 CAGGATGTGGAAACTAGTTACGG + Intergenic
917967563 1:180188103-180188125 CAGGGTCTTCCAGCTAGTGAGGG + Intronic
919374641 1:196779025-196779047 CAGGATCAGGAAACTAGTTATGG + Intronic
919380487 1:196854430-196854452 CAGGATCAGGAAACTAGTTACGG + Intronic
923154522 1:231266324-231266346 CAGGATCTCCAAAGTACACATGG - Exonic
923340223 1:233000499-233000521 CTGGGTCTTCATACTCGTCAGGG + Exonic
1064150876 10:12863590-12863612 CAGGAGTTTGAAACTAGTCTGGG - Intergenic
1065679785 10:28217318-28217340 CAGGATCTTCAGACCAGCCTGGG + Intronic
1066357785 10:34701684-34701706 CAGGAGCTCCAGACTAGTCTGGG + Intronic
1066365881 10:34776687-34776709 AAGAATCTTCAAACTAGTGAAGG + Intronic
1068049545 10:51931957-51931979 CAGGATTTTCAAACATATCAAGG - Intronic
1069469499 10:68675184-68675206 AAGGATCTTCAAAACATTCAAGG + Intronic
1070519676 10:77241433-77241455 CAGGAGCTTAAAACCAGTCTGGG + Intronic
1071589767 10:86861797-86861819 CCGGATCTTGACACAAGTCAGGG + Intronic
1072419897 10:95281368-95281390 CAGGATCTTGAAACTAGTCCGGG + Intronic
1072958996 10:99912728-99912750 CAGGAGTTTGAAACTAGTCTGGG - Intronic
1074890271 10:117730023-117730045 CAGGATCTCCAAACCACTAAGGG - Intergenic
1078298062 11:10095129-10095151 CAGGAGCTTCAGACTAGCCTGGG - Intronic
1079880009 11:25915135-25915157 GAGGATCAAAAAACTAGTCAGGG + Intergenic
1081396731 11:42595093-42595115 CAGGAATTTCAGACTAGTCTGGG - Intergenic
1082620543 11:55416048-55416070 CAGGCTATTGAAACAAGTCATGG - Intergenic
1084070686 11:66732225-66732247 CAGGGTCATCAAACCAGGCAAGG + Intergenic
1085750629 11:79157922-79157944 CAGCATGTTCTAACTAGTCTGGG + Intronic
1088304365 11:108392253-108392275 CAGGATTTTGAGACTAGTCTGGG - Intronic
1089481987 11:118813313-118813335 CAGGAGCTTGAAACCAGTCTGGG - Intergenic
1090044010 11:123315302-123315324 CAGGAACTCCAAACAAGCCAGGG - Intergenic
1097648573 12:62265753-62265775 CAGGAGTTTCAAACCAGTCTAGG - Intronic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1102686388 12:114728130-114728152 GTGGATTTTCAAAATAGTCATGG + Intergenic
1105254672 13:18735613-18735635 CAGGAACTTGAAACCAGTCCTGG - Intergenic
1105462965 13:20608738-20608760 CAGGAACTTCAAACTATTAAGGG - Intronic
1105664409 13:22536334-22536356 CAGGAGCTTGAGACTAGCCAGGG - Intergenic
1108129930 13:47287907-47287929 CTGGACCTTCAAAATAGGCAGGG + Intergenic
1115099910 14:29686287-29686309 CAGGATCCTCAAACAAGGCCTGG + Intronic
1116936108 14:50742203-50742225 CAGGAGTTTCAAACTAGTCTAGG + Intronic
1117190370 14:53284499-53284521 CAGGAACCTTAAACTATTCAGGG + Intergenic
1117310206 14:54514047-54514069 CAGGATCTTCAAGCAAGAGAAGG - Intronic
1117675807 14:58153415-58153437 CAGGAGTTTGAAACTAGCCAGGG - Intronic
1120094629 14:80374788-80374810 CAGGATCTTCACAATAGGTATGG - Intronic
1120968572 14:90189191-90189213 CAAGAACTTCAATCTAATCACGG + Intergenic
1123450311 15:20355783-20355805 CAGGCACTTCAAACAAGGCAGGG - Intergenic
1124580226 15:30946718-30946740 CAGAAACTTCAAACTCGTGAAGG + Intronic
1132066862 15:98738331-98738353 AAAGATCTTCAAGCTAGGCAAGG - Intronic
1132187387 15:99813287-99813309 CAGTAACACCAAACTAGTCATGG - Intergenic
1132428285 15:101739449-101739471 CAGTAACACCAAACTAGTCATGG + Intronic
1133799775 16:9075703-9075725 CAGGACCTTCACCCTAGTGAAGG - Intergenic
1135175594 16:20225657-20225679 CAGGAAATTCAAACTCGTCTAGG + Intergenic
1135434058 16:22413375-22413397 CAGGAGTTTCAAACTAGCCTGGG - Intronic
1135610690 16:23864381-23864403 CAGGATCTTGAGACCAGCCAGGG + Intronic
1139624870 16:68179204-68179226 CAGGGTCTTCAACCTAATCTTGG - Intronic
1142807329 17:2378221-2378243 CAGGATCTTGAGACTAGCCTGGG + Intronic
1143792278 17:9307282-9307304 CAGGATCGTCAGCCTAGTGATGG - Intronic
1144690194 17:17256797-17256819 CAGGAGCTTGAAACCAGTCTGGG - Intronic
1151549953 17:74816629-74816651 TAACATCTTCAAACTGGTCATGG - Intronic
1152338127 17:79709522-79709544 CAGGCACTTCAAACAAGGCAGGG + Intergenic
1153099773 18:1453124-1453146 CAGGATCTAGAAAATAGTCTCGG + Intergenic
1154436355 18:14345001-14345023 CAGGAACTTGAAACCAGTCCAGG + Intergenic
1155074564 18:22343290-22343312 CATGATCTTGAAACTAATAAAGG - Intergenic
1156636580 18:39037964-39037986 CAGTATCTTCAAACTATTCTAGG - Intergenic
1159138422 18:64364053-64364075 CAGGAGCTTCAGACCAGTCCGGG + Intergenic
1159822369 18:73162337-73162359 TAGCATCTTCTAATTAGTCAAGG - Intronic
1164058486 19:21644099-21644121 CAGGAGCTGGAAACTAGCCAAGG - Intergenic
1166529135 19:43532328-43532350 CAGGATTTCCAAACTAGACGGGG - Intronic
1166544710 19:43627067-43627089 CAGGATGTTAAAAATAGCCATGG + Intronic
1166957161 19:46472213-46472235 CAAGATCTGCAAAATAGTCAGGG - Intergenic
1168357801 19:55713207-55713229 CATGATATACAAAATAGTCAGGG - Intronic
928027715 2:27753453-27753475 CAGCATATGCAAAGTAGTCACGG - Intergenic
928337065 2:30407204-30407226 CAGGAGCTTGAAACTAGCCTGGG + Intergenic
930413753 2:51062646-51062668 CATGATCTTCAATCTGGTGATGG + Intergenic
931365061 2:61612160-61612182 CAGGATCTTGAAACCAGCCTGGG - Intergenic
931444069 2:62312019-62312041 CAGGATTTTGAGACTAGTCTGGG + Intergenic
933250951 2:80027757-80027779 CAGGAGTTCCAAACTAGTCTGGG + Intronic
933434405 2:82228117-82228139 TAGGAGTTTCAAACTAATCAGGG - Intergenic
942779361 2:179623094-179623116 CTGGATCTTCAAACTGGCAATGG + Intronic
945770543 2:214035974-214035996 ATGGATATTAAAACTAGTCATGG - Intronic
1169182508 20:3582029-3582051 CAGGAGTTTGAAACTAGCCAGGG + Intronic
1173380912 20:42540241-42540263 CAGCACCTTCAAAGTAGTAAAGG + Intronic
1176840683 21:13840649-13840671 CAGGAACTTGAAACCAGTCCAGG - Intergenic
1176939743 21:14910629-14910651 CAGGAGTTTCAAACCAGTCTGGG - Intergenic
1181794870 22:25299838-25299860 CAGGATAAACAAACTAATCAAGG - Intergenic
1181835437 22:25603487-25603509 CAGGATAAACAAACTAATCAAGG - Intronic
1183766154 22:39877209-39877231 CAAGACCTTCAAATTAGTGAAGG + Intronic
950034489 3:9875449-9875471 CATAATCTTCAAAATGGTCAAGG + Intronic
950345055 3:12286384-12286406 CAGGAGTTTCAGACTAGTCTAGG + Intergenic
951072699 3:18351218-18351240 CAGGATTTTCAAACCTGTAAAGG - Intronic
954695704 3:52424135-52424157 CAGGACATTCAAATTAGGCAAGG + Intergenic
957626801 3:82663179-82663201 AAGGGTCTTCAAAATATTCATGG - Intergenic
962104831 3:132379747-132379769 CAGGATCGGCAAATGAGTCATGG + Intergenic
962127013 3:132630860-132630882 CAGGAGCTTAAAACTAGCCTGGG + Intronic
962324736 3:134423553-134423575 CAGCATCTTCACACTATGCAGGG + Intergenic
965513298 3:169593097-169593119 CAGGATTTTCAGACTAGCCTGGG - Intronic
968730130 4:2265603-2265625 CAGGATCCACAAACTCCTCATGG + Intergenic
968854384 4:3108311-3108333 GGAGATATTCAAACTAGTCATGG + Intronic
969863425 4:10055575-10055597 CAGGATATTCAACCTTGCCAGGG - Intergenic
974795822 4:66747863-66747885 CAGGATTTTGAGACTAGTCTGGG - Intergenic
975436016 4:74352348-74352370 CAGGATCCACAAGATAGTCACGG + Intergenic
980243115 4:130202355-130202377 CAGGATCTTCAGGCCAGGCACGG + Intergenic
982738927 4:159037568-159037590 CAGGAGTTTGAAACTAGTCTGGG + Intronic
984511264 4:180681796-180681818 CAGGATTTTCAAACTAGCCTAGG - Intergenic
984971002 4:185190443-185190465 CAGTATCTTCAGACTCCTCAGGG + Exonic
987602807 5:20094035-20094057 CAGGACCTTCCAATTAGACAAGG + Intronic
988849759 5:35168746-35168768 CAAGATCTTCAAACTTCCCAGGG - Intronic
990787939 5:59444107-59444129 CATGATCTTCTAAGTATTCATGG - Intronic
991913578 5:71584805-71584827 CAGGAACTTGAAACTAGCCTAGG - Intergenic
992702091 5:79351044-79351066 CAGGATTTTGAGACTAGTCTGGG + Intergenic
992817307 5:80456269-80456291 AAAGGTCTTCAAACTAGGCATGG - Intronic
994118909 5:96091712-96091734 CAGGAGCTTGAGACTAGTCTTGG - Intergenic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
1004648769 6:17588514-17588536 CAGGAGCTAGAGACTAGTCAGGG - Intergenic
1005066941 6:21827494-21827516 CTGGAGCTTTCAACTAGTCATGG + Intergenic
1009892708 6:69707169-69707191 CTCCATCTTCAAACCAGTCATGG + Intronic
1010649056 6:78429303-78429325 CAGGAATTTAAAACTAGTGAAGG - Intergenic
1011646412 6:89463074-89463096 CAGGACTTTGAAACAAGTCAGGG - Intronic
1011985404 6:93437323-93437345 AAGGAACTTCAACCTTGTCATGG - Intergenic
1012750126 6:103150636-103150658 CAAGATCTTCAGATTATTCAAGG + Intergenic
1013106915 6:107033508-107033530 CAGGACTTTGAAACTGGTCAGGG - Intronic
1018424286 6:163666572-163666594 CAGGAACTTCATACAACTCATGG - Intergenic
1018929113 6:168228479-168228501 CTGGATTTAAAAACTAGTCAAGG - Intergenic
1020417836 7:7966933-7966955 CAGGATTTTGAAACCAGTCTGGG - Intronic
1021124837 7:16839522-16839544 CTTGATTTTAAAACTAGTCAGGG + Intergenic
1021444753 7:20720614-20720636 CGCGATCTTCAAAAAAGTCAAGG + Intronic
1023046292 7:36213400-36213422 CAGGAACTTCAAACTCAACATGG - Intronic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1023367122 7:39475258-39475280 CAGGATCTTCAAACACTTCAGGG - Intronic
1026614711 7:71891295-71891317 CAGAATCTTTAAAATATTCATGG - Intronic
1027166788 7:75840323-75840345 CAGGAGTTTCAAACCAGTCTGGG - Intergenic
1027926047 7:84465249-84465271 CAGGATCTTCAAACTGGATAAGG + Intronic
1028924788 7:96346170-96346192 CAGGGTCATCATACTAGTCCTGG + Intergenic
1031283530 7:119836708-119836730 CAGGAAATTCAAATTAGTAATGG + Intergenic
1033228198 7:139577111-139577133 CAGTATCTTCTCACTAGTCTGGG - Intronic
1033359756 7:140630343-140630365 CTGGACCTTCCAACTAGACAGGG + Intronic
1033881667 7:145891467-145891489 CAAGATATTCAAACTTGACATGG - Intergenic
1038295490 8:26288111-26288133 CAGGATTTTGAGACTAGCCAGGG - Intergenic
1039259972 8:35760910-35760932 CAGGATTTTTAAACTGGACAGGG + Intronic
1043283448 8:78499370-78499392 CAAGATATTCACAATAGTCAAGG + Intergenic
1044270902 8:90242213-90242235 CAGGAATTTGAGACTAGTCAGGG + Intergenic
1052125114 9:24765157-24765179 CAGGAAGTTCAAACTGGGCAGGG - Intergenic
1052744602 9:32428064-32428086 CAGGAGTTTGAAACTAGCCAGGG + Intronic
1185473122 X:397015-397037 CAGGAGTTTGAAACTAGTCTGGG + Intergenic
1185941999 X:4332296-4332318 CAAGGTCTTCAAACAAGGCAGGG - Intergenic
1190439667 X:50464622-50464644 AAGGATCTTCAACCTCGCCAAGG - Intronic
1191043900 X:56115203-56115225 CAGGAGTTTGAAACTAGTCTGGG + Intergenic
1192677005 X:73208252-73208274 CAGTATCATCCAACTAGTAAAGG - Intergenic
1197223649 X:123935880-123935902 CAGGAGTTTGAAACTAGTCTGGG - Intergenic
1200763037 Y:7057197-7057219 CAGGTAATTCAAACGAGTCAGGG + Intronic
1200767837 Y:7095487-7095509 TAGGTTCTTCAAATTACTCATGG - Intergenic
1200779581 Y:7202204-7202226 CAGTATCTTCATACTAGACATGG - Intergenic