ID: 999624306

View in Genome Browser
Species Human (GRCh38)
Location 5:153504212-153504234
Sequence TCCGTATGGTTTTGGTGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999624306_999624318 13 Left 999624306 5:153504212-153504234 CCAGCCCACCAAAACCATACGGA 0: 1
1: 0
2: 0
3: 10
4: 68
Right 999624318 5:153504248-153504270 TAATTCCCTCAAAGGGAATCAGG 0: 1
1: 0
2: 0
3: 10
4: 143
999624306_999624316 5 Left 999624306 5:153504212-153504234 CCAGCCCACCAAAACCATACGGA 0: 1
1: 0
2: 0
3: 10
4: 68
Right 999624316 5:153504240-153504262 GGGAGGAATAATTCCCTCAAAGG 0: 1
1: 0
2: 0
3: 10
4: 139
999624306_999624317 6 Left 999624306 5:153504212-153504234 CCAGCCCACCAAAACCATACGGA 0: 1
1: 0
2: 0
3: 10
4: 68
Right 999624317 5:153504241-153504263 GGAGGAATAATTCCCTCAAAGGG 0: 1
1: 0
2: 0
3: 14
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999624306 Original CRISPR TCCGTATGGTTTTGGTGGGC TGG (reversed) Intronic
902594999 1:17503332-17503354 GCCGTGTGGTTTTGCTGGCCAGG - Intergenic
905999996 1:42416419-42416441 TCAGGATGATCTTGGTGGGCAGG - Exonic
906043251 1:42805806-42805828 TGGGTATGGTTTTTGTGGGTTGG - Intergenic
909212561 1:72843129-72843151 TCCATAGGGTTTTGGGGAGCAGG - Intergenic
910714206 1:90212986-90213008 TTCTTATGGTGTTGGTGTGCTGG + Intergenic
916148942 1:161767043-161767065 TTTGTTTGGTTTTGGTGGTCAGG + Intronic
917853946 1:179086959-179086981 TCCATATGGCTTTGGAGGGCAGG + Intronic
921626814 1:217386318-217386340 TGCATATGGTCTTGGTGGGTTGG + Intergenic
1068370021 10:56101195-56101217 TCTGTATGGTTATGGTGGCAGGG - Intergenic
1081993338 11:47349207-47349229 GCCTTAAGGTTCTGGTGGGCAGG + Intronic
1088231816 11:107680673-107680695 TACCTATGGATTTGGTGGGGGGG + Intergenic
1093689134 12:22089932-22089954 GCAGAATGGTTTTAGTGGGCGGG - Intronic
1096929050 12:55184263-55184285 TCCGTATGTTTTTGGGGAACAGG - Intergenic
1101735355 12:107459129-107459151 TCCATAGGGTTGTGGGGGGCAGG - Intronic
1103175813 12:118862259-118862281 TCCTTCTGGTTTGGGTGGGTGGG - Intergenic
1105597720 13:21855194-21855216 TCAGTAGGGTTTTGGGGGACAGG + Intergenic
1107110551 13:36693034-36693056 TCTCTAAGGTTTTGGTGGGAAGG - Intronic
1112494996 13:99897179-99897201 CCCCTCCGGTTTTGGTGGGCAGG + Intergenic
1113200129 13:107858003-107858025 TGTGTATGGTTTTGGTGGGATGG - Intronic
1113317732 13:109201615-109201637 TCCATAGGTTTTTGGTGAGCAGG + Intronic
1113983271 13:114294258-114294280 TTTGTTTGGTTTTGGTGGGGGGG + Intronic
1117136104 14:52735451-52735473 TTCCTATGGTTTTGGTGGGAGGG - Intronic
1118420876 14:65601995-65602017 TCCGTAAGTTTTTGGAGGACAGG + Intronic
1119206872 14:72800959-72800981 TCTGTATGGTTTTGGGTGTCTGG + Intronic
1121580121 14:95023872-95023894 TCCTTCTGGTTTTGGTGGTATGG + Intergenic
1122408941 14:101516381-101516403 TGCTTGTGGTTTTGGTGGGCAGG + Intergenic
1122451870 14:101815422-101815444 TGCGTATGTTCTTGGTGTGCAGG + Intronic
1124352357 15:28966395-28966417 TCTGTATGTTCTTGGTAGGCTGG + Intronic
1130731521 15:86498258-86498280 TATTTATGGTTTTGGTTGGCAGG + Intronic
1141308130 16:82886347-82886369 TCCATATGGTTTTGATGGCCAGG + Intronic
1146472295 17:33134334-33134356 TCTGTAAGCTTTTGGAGGGCAGG - Intronic
1153296435 18:3551035-3551057 TAAGTCTGGTTCTGGTGGGCTGG - Intronic
1159416050 18:68150793-68150815 TTCATATGTTTTTGGTGGGAAGG + Intergenic
1159677369 18:71302540-71302562 TTCTTCTGGTTTTGGTGGGTGGG + Intergenic
1166140100 19:40800800-40800822 TCGGGACGGTTTTGGCGGGCAGG + Exonic
1168218480 19:54943593-54943615 TCCGTCTGGGTTGGGGGGGCGGG + Intronic
948001354 2:234570402-234570424 TTCCTGTGGTTTGGGTGGGCTGG - Intergenic
948116906 2:235500019-235500041 ACCTTTTGGATTTGGTGGGCTGG + Intronic
1169753085 20:9015426-9015448 TCCGTATGTTTTTGGGGAACAGG + Intergenic
1172621715 20:36321778-36321800 TGCATATTGTTCTGGTGGGCAGG - Intronic
1173160456 20:40648288-40648310 ACAGTATGGTGTTGGTGGGCAGG - Intergenic
1178390302 21:32192486-32192508 TCAGTGTGGCTTTGGTGGCCTGG - Intergenic
1178889647 21:36510386-36510408 GCCATATGGTTTGGCTGGGCTGG + Intronic
1182217195 22:28729106-28729128 TCTGTCTGGTTTTGGTATGCTGG - Intronic
1182273843 22:29172268-29172290 TTCCTATGGTTTGGGTGGGGAGG + Intergenic
954314825 3:49795462-49795484 TGCCTATGGATCTGGTGGGCTGG - Intronic
957625752 3:82650520-82650542 TCCCTGTGCTCTTGGTGGGCTGG + Intergenic
964358880 3:155873590-155873612 TCCGTATGTTATTGGGGAGCAGG + Intronic
967516380 3:190373866-190373888 TCAGTATTGTTTTGGTGGTCTGG + Intronic
973872163 4:55177659-55177681 TCCTTCTGGCTTTGGTGGGCAGG + Intergenic
981711162 4:147710094-147710116 TCTGTATTGCTTTGGTGGGGAGG - Intergenic
986185099 5:5428180-5428202 TCTGCTTGGTTTTGGTGGGTGGG + Intronic
988917102 5:35905508-35905530 TCCTTATGTTTTTAGTGGGAAGG - Intronic
991609672 5:68437019-68437041 CACTTATGGTTTTGGTGGGGAGG - Intergenic
992230893 5:74662971-74662993 TCCGTATGATGGTGGTGGGGAGG - Intronic
992417155 5:76562640-76562662 TCTGTAAGGATTTGGGGGGCTGG + Intronic
997803654 5:136891562-136891584 TCTTTATGATTTTGGTGGGTGGG + Intergenic
999624306 5:153504212-153504234 TCCGTATGGTTTTGGTGGGCTGG - Intronic
1001575101 5:172758112-172758134 TCCGTATGTATTTATTGGGCAGG + Intergenic
1016190603 6:141260776-141260798 TCCCTGTGGTCTTGGGGGGCCGG + Intergenic
1017885624 6:158597332-158597354 TCCTTACAGTTTTGGAGGGCAGG + Intronic
1020022611 7:4878088-4878110 TCAGTTTGCTCTTGGTGGGCGGG + Exonic
1020236511 7:6359943-6359965 TCCATATGGTTTGGGTGGGGTGG + Intergenic
1023847068 7:44128362-44128384 TATGTATGGGTTTGGTGGGAGGG - Intergenic
1026607471 7:71828097-71828119 TAGGTATGGTTTTGGAGGACAGG + Intronic
1031917902 7:127580382-127580404 TTCTTATGGGTTTAGTGGGCAGG - Intergenic
1033846557 7:145440005-145440027 TGCATATGGTTTTGATGGGCAGG - Intergenic
1034099028 7:148435986-148436008 TCCGTGTGGGTTTGGGAGGCAGG - Intergenic
1036049365 8:5179062-5179084 TCAGAATGGTTTTGGAGGACAGG + Intergenic
1038522117 8:28242854-28242876 TCTGGATGGATTTGGGGGGCAGG - Intergenic
1043969737 8:86515532-86515554 TCCGTATGGTTTTAGGGCACAGG + Intronic
1046993139 8:120483759-120483781 TACGTATGCTTTTGGTGGAGAGG + Intronic
1047271709 8:123366862-123366884 TCCGTAGGTTTTTGGGGAGCAGG - Intronic
1061568890 9:131463788-131463810 TTCGTATTTTTTTGGGGGGCTGG + Intronic
1061959914 9:133982602-133982624 GCCGCCTGGTTTTGGAGGGCTGG + Intronic
1188063270 X:25626987-25627009 ACCGTATGGTTTTGATGAGATGG - Intergenic
1188418901 X:29972548-29972570 TCTATATGGTTTTGGGGGGTAGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1196142520 X:112280027-112280049 TGTGTATGTTTTTGGTGGGTAGG + Intergenic