ID: 999624368

View in Genome Browser
Species Human (GRCh38)
Location 5:153504850-153504872
Sequence GCAGGAAATGTCCTGGTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999624368_999624371 30 Left 999624368 5:153504850-153504872 CCAGTGACCAGGACATTTCCTGC 0: 1
1: 0
2: 0
3: 13
4: 185
Right 999624371 5:153504903-153504925 AACTCTTTAACAGTCCCAGTTGG 0: 1
1: 0
2: 0
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999624368 Original CRISPR GCAGGAAATGTCCTGGTCAC TGG (reversed) Intronic
900777000 1:4593041-4593063 GCAGGCACTGTTCTGGGCACAGG - Intergenic
901337826 1:8466322-8466344 GCATGGAATGTCCTGAGCACTGG - Intronic
901455161 1:9358921-9358943 GCAGGAAATCGCCTATTCACAGG - Intronic
902334541 1:15747461-15747483 GGAGGAAGTGCCCGGGTCACTGG + Intronic
903234203 1:21938942-21938964 GAAGGAAATGCCCAGCTCACTGG + Intergenic
905181894 1:36172393-36172415 GGAGGAAATGTCCTTGGCCCAGG + Intronic
906450845 1:45946105-45946127 TCAGGCACTGTCCTGGACACTGG + Intronic
907669814 1:56464531-56464553 GCAGGAAATGCCTTGGTATCAGG - Intergenic
908569882 1:65398262-65398284 GCAGAACATGTACTGGGCACTGG - Intronic
909576410 1:77181643-77181665 GCAGGAAATATGAGGGTCACAGG + Intronic
910213337 1:84816443-84816465 AAAGGAAATGCCCTGGTCAAGGG + Intronic
911260453 1:95679452-95679474 GCAGGAAATCTTGTGGACACCGG - Intergenic
914349675 1:146830171-146830193 CTAGGAGATGTCCTGGGCACTGG - Intergenic
914381862 1:147123511-147123533 GCAGGGAATACCCTGGTGACAGG - Intergenic
914957985 1:152181798-152181820 GCAGCAACTGTCCTGGGTACAGG + Intergenic
915467387 1:156105460-156105482 GCAGGAGATTTCCTGGCCGCTGG - Intronic
916248129 1:162708722-162708744 AAATGAAATGTCCTGGTCAAAGG + Intronic
919768163 1:201140589-201140611 GCAGGAGAGCTCCTGGTCACAGG + Intronic
921989268 1:221346737-221346759 GCAGGCACTGTCCTAGGCACAGG + Intergenic
924782886 1:247169258-247169280 GCAGGAGATTCCCTGGTCCCCGG + Intronic
1065152939 10:22840731-22840753 CCAGAAAATATGCTGGTCACTGG + Intergenic
1066059143 10:31706978-31707000 GCAGCAAATGTACTGGTCCCTGG - Intergenic
1070757501 10:79002512-79002534 GCAGGGAGTGTCCTTGTGACTGG + Intergenic
1070967209 10:80536774-80536796 CTAGGCAATGTCCAGGTCACAGG - Intergenic
1072001403 10:91199206-91199228 GTAGAAAATGTACTTGTCACAGG + Intronic
1073767103 10:106694737-106694759 ACAGAACATGCCCTGGTCACTGG + Intronic
1076770074 10:132657941-132657963 GCAGGTAATGACCTGCTCCCCGG + Intronic
1076928960 10:133514825-133514847 GCAGGATATGTCATGTTCATGGG + Intergenic
1077463538 11:2722772-2722794 GGAGGAAGGGTCTTGGTCACAGG - Intronic
1083135995 11:60677624-60677646 GAAGGAAATTTCCTTGTCTCAGG - Intergenic
1083742196 11:64716894-64716916 GCAGCAAGTTTCCTGGACACTGG - Intronic
1084238697 11:67804905-67804927 GCAGTAACCGTTCTGGTCACTGG - Intergenic
1086457038 11:86969236-86969258 GTAGGAAGGGTCCTGGTAACAGG - Intergenic
1086970579 11:93076537-93076559 GAAGGAAATGTTCTTGTCTCCGG + Intergenic
1089075832 11:115737752-115737774 GCAGCAAAGGTCCTTATCACTGG - Intergenic
1090678776 11:129030815-129030837 GCAGGAGGTGTTTTGGTCACAGG + Intronic
1092409381 12:8242538-8242560 GCAGTAATCGTTCTGGTCACTGG - Intergenic
1093409370 12:18845742-18845764 GCAGGAAAGGTCCTGGGAGCTGG - Intergenic
1095832391 12:46601720-46601742 GGAGGAAATCTCCTGGTCTGAGG + Intergenic
1097435617 12:59549500-59549522 GGAGGAAATCTCCTGGTCTGTGG + Intergenic
1097575489 12:61388277-61388299 GCAGGAAATGTTCAGGTTATGGG - Intergenic
1097951192 12:65429929-65429951 GCAGGGACTGAACTGGTCACTGG - Intronic
1099195890 12:79615405-79615427 GCAGGAAATAACCAGGTGACAGG + Intronic
1099604302 12:84782734-84782756 CCAGGAAATGTGCTAGTAACTGG - Intergenic
1100954933 12:99896610-99896632 GCAGGAATAGTCTTGGTCATGGG - Intronic
1106023299 13:25934606-25934628 TCAGGCACTGTGCTGGTCACTGG - Intronic
1106095683 13:26641068-26641090 GGAGGAAATGTACTGGAAACAGG - Intronic
1106145836 13:27049106-27049128 GCGGGGATTGTCCTGGGCACAGG - Intergenic
1107630515 13:42338031-42338053 GACGGAAATATCCTGGTTACTGG + Intergenic
1110488226 13:76071051-76071073 GTAGGAGATGTCCAGGTCATAGG - Intergenic
1110941972 13:81362534-81362556 GCAGGGAATCTCCTGGTCTGTGG - Intergenic
1114136889 14:19862755-19862777 GTAGGTAAAGTCCTGGTGACTGG + Intergenic
1117097310 14:52312154-52312176 GCAGGAAATTTCATGATCTCAGG - Intergenic
1117964749 14:61195450-61195472 TCAGGCAATGTGCTAGTCACTGG + Intronic
1119268255 14:73278142-73278164 GCAAGATATGGCCAGGTCACTGG - Intronic
1119593471 14:75912069-75912091 CCAGCAAATGACCTGGCCACGGG - Intronic
1119620741 14:76130252-76130274 GCAGGAGTTTTCCTGGGCACAGG - Intergenic
1122402507 14:101475639-101475661 GCAGGACTTGTCCTGGCCTCGGG + Intergenic
1123113319 14:105882871-105882893 ACAGGAAATGGCCTGAACACAGG - Intergenic
1123117581 14:105901616-105901638 GCAGGAAATGGCATGAGCACAGG - Intergenic
1123119918 14:105911737-105911759 GCAGGAAATGGCCTGAACACAGG - Intergenic
1123402652 15:20003304-20003326 GCAGGAAATGGCCTGAACACAGG - Intergenic
1123511991 15:21009958-21009980 GCAGGAAATGGCCTGAACACAGG - Intergenic
1125270390 15:37932655-37932677 GCAGGAAATGCCCTGGACCAAGG - Intronic
1126465666 15:48959413-48959435 GCAGGAACTGTTCTAGGCACTGG - Intronic
1127763461 15:62164022-62164044 GAAGCAAAAGTCCTGGTCAAAGG + Exonic
1127846527 15:62875819-62875841 GCAGGAAATGCCGTGGCCATGGG - Intergenic
1132769752 16:1554778-1554800 GCAGGTTTTGTCCTGGTCATCGG + Exonic
1133350355 16:5097331-5097353 GCAGTAATCGTTCTGGTCACTGG - Intronic
1134539311 16:15052087-15052109 TCAGAAAATCTGCTGGTCACTGG - Intronic
1135794350 16:25426853-25426875 GTCTGAAATGTCTTGGTCACAGG - Intergenic
1137323101 16:47406588-47406610 GCAGGCACTGTTCTGGGCACTGG + Intronic
1137924071 16:52522928-52522950 GCAGGCACAGTCCTGGACACTGG + Intronic
1139984360 16:70885375-70885397 CTAGGAGATGTCCTGGGCACTGG + Intronic
1140749715 16:78012131-78012153 GCCAGAAATGTGCTGGCCACAGG - Intergenic
1141169858 16:81684467-81684489 GCAGGAAGCGTCCTGTCCACAGG + Intronic
1143174725 17:4949396-4949418 GCAGGCAATGTCTGGATCACCGG + Intronic
1145957143 17:28862342-28862364 GCAGGAAGGGTCCTGGCAACTGG + Intergenic
1147550516 17:41438577-41438599 GCAGGACATGTCCTGCTCCGAGG - Exonic
1150197707 17:63318060-63318082 GCAGTAAATTTCTTGGTCACTGG - Intronic
1152099381 17:78292187-78292209 ACAGGTAATGTCCTGGCCAGCGG + Intergenic
1152883325 17:82832964-82832986 CGAGGAAAGGTCCAGGTCACAGG - Intronic
1153495948 18:5699896-5699918 ACAGCAAAAGTCCAGGTCACTGG - Intergenic
1156567621 18:38213366-38213388 GGAGGAAATGTGATGGTCAAAGG - Intergenic
1156955530 18:42958376-42958398 GCTAGAAATGTCCTTCTCACTGG + Intronic
1159767279 18:72505413-72505435 GAAGGAAATGCTCTGGTCTCTGG + Intergenic
1159833248 18:73304164-73304186 GCGGGAAGAGTCCTGGTCCCAGG + Intergenic
1160654938 19:261069-261091 ACAGGAAATGTCCTCTCCACAGG + Intergenic
1162332510 19:10038959-10038981 AGAGTGAATGTCCTGGTCACAGG - Intergenic
1163476816 19:17531439-17531461 GCAGGATCTGTCCTTGTCACTGG - Intronic
1163729215 19:18940130-18940152 GCAGCTGCTGTCCTGGTCACAGG + Intronic
1164560425 19:29288327-29288349 GAAGGAAATGGCATGGTCATGGG + Intergenic
1164624375 19:29716447-29716469 GCAGGCAGAGTGCTGGTCACAGG - Intergenic
1165089660 19:33377333-33377355 ACAAGAACTGGCCTGGTCACTGG + Intronic
1166926429 19:46271943-46271965 GGAAGAAATGTCCAGGTCATTGG - Intergenic
1167774496 19:51545807-51545829 GAAGCATTTGTCCTGGTCACTGG + Intergenic
925048420 2:791906-791928 CCAAAAAAGGTCCTGGTCACTGG - Intergenic
926157699 2:10466735-10466757 GCAGAAAATGTCTTGGTGGCTGG - Intergenic
927120698 2:19958520-19958542 TCAGGTACTGTACTGGTCACTGG - Intronic
927378113 2:22442406-22442428 TCAGGAAAACTTCTGGTCACTGG - Intergenic
929333590 2:40713091-40713113 AGAGGAAATCTCCTGGTCTCTGG + Intergenic
929579040 2:43070204-43070226 GCAGGAAGTCTCCAGGCCACTGG + Intergenic
932852680 2:75201532-75201554 GCAGGTACTGTGCTGGGCACTGG + Intergenic
935225977 2:101053602-101053624 GCAGGAATTGTCCTAGGCAATGG - Intronic
941732010 2:168928601-168928623 CCAGTGAATGTTCTGGTCACAGG - Intronic
942608874 2:177720572-177720594 GCTGGAAAGGTTCTGGTCTCTGG - Intronic
942939940 2:181605179-181605201 GCAGAGAATCTCCAGGTCACAGG + Intronic
943459803 2:188158357-188158379 GCAGCAAATGTTCTGGTAAGAGG - Intergenic
946619244 2:221543803-221543825 TCCAGAAAAGTCCTGGTCACGGG + Intronic
946688426 2:222293739-222293761 TCAGGAAAGGCCCTGGTCTCCGG - Intronic
948783600 2:240339809-240339831 ACAGGGAAGGGCCTGGTCACTGG + Intergenic
1169554184 20:6732101-6732123 GCTGGGAATGTCCAGGTCAGAGG + Intergenic
1170552903 20:17492184-17492206 CCAGGCATGGTCCTGGTCACTGG - Intergenic
1170678027 20:18500199-18500221 ACAGGAAATATCCTCTTCACAGG + Intergenic
1170687057 20:18578912-18578934 GCATGAAACATCCTGGTAACTGG - Intronic
1171092360 20:22297072-22297094 GCAGGGACTGTCCCGGGCACAGG + Intergenic
1173321340 20:41989949-41989971 GCAGGACCTAACCTGGTCACTGG + Intergenic
1174310260 20:49647728-49647750 GGAGGAAATGTCTTGGTGAAAGG - Intronic
1174711531 20:52711268-52711290 GCAGGAGCTGTCCAGGCCACAGG - Intergenic
1176336462 21:5603880-5603902 GCAGGGAATGTGCGCGTCACTGG + Intergenic
1176391295 21:6217068-6217090 GCAGGGAATGTGCGCGTCACTGG - Intergenic
1176470124 21:7099106-7099128 GCAGGGAATGTGCGCGTCACTGG + Intergenic
1176493685 21:7480884-7480906 GCAGGGAATGTGCGCGTCACTGG + Intergenic
1176506957 21:7657499-7657521 GCAGGGAATGTGCGCGTCACTGG - Intergenic
1179324035 21:40322193-40322215 GCAGCAAATGTCCTGGGCGAGGG - Intronic
1179797191 21:43792049-43792071 GCAGGAGACGTCCTTGTCTCAGG - Intronic
1182988241 22:34741658-34741680 GCAGGAAGGGTTCTGGGCACTGG - Intergenic
1184384811 22:44167913-44167935 TCAGCAACTGTCCTTGTCACTGG - Intronic
1185316246 22:50180445-50180467 GCAGGACATGCCCTGGACTCAGG + Intergenic
950509084 3:13414872-13414894 GCAGGAGATGCCCTGCTCTCAGG - Intronic
952270485 3:31826141-31826163 GCAGGAAATTTATGGGTCACTGG + Intronic
952396369 3:32924156-32924178 GGAGGAAATCTCTTGGTCAAAGG - Intergenic
954400905 3:50319050-50319072 GCAGGAAAAGGGATGGTCACTGG + Intronic
958705846 3:97654382-97654404 GTAGGTACTGTTCTGGTCACTGG + Intronic
959264760 3:104123363-104123385 GAAGAAAATGTCATGGTCATGGG - Intergenic
961300200 3:125917010-125917032 GCAGTAATCGTTCTGGTCACTGG + Intergenic
961449609 3:126996596-126996618 GCAAGAAGTGTGCTGGCCACAGG + Intronic
961888305 3:130111064-130111086 GCAGTAATCGTTCTGGTCACTGG - Intronic
963836767 3:150065973-150065995 CCAGGCACTGTCCTGGACACTGG + Intergenic
964407723 3:156366946-156366968 GAAGGAAAAGACCTGGTCCCGGG + Intronic
967263915 3:187673133-187673155 GCAGGAAGTGGCATGGTCACAGG + Intergenic
968782182 4:2591399-2591421 GCAGAGAATGTTCTGGTCATAGG + Intronic
969370587 4:6728739-6728761 GCAGGACAGGTCCTGGCCCCGGG - Intergenic
969756562 4:9153682-9153704 GCAGTAATCGTTCTGGTCACTGG + Intergenic
973539159 4:51918440-51918462 GCAGGACATGCCATGGTCGCTGG + Intergenic
975437847 4:74374653-74374675 GCAGTAAATGTCGTGGGCCCTGG - Intronic
975800811 4:78057675-78057697 GCCGGAAAGTTGCTGGTCACTGG - Exonic
977241469 4:94575640-94575662 GCAGGAGATGTAATGGGCACAGG - Intronic
977919664 4:102628901-102628923 GCAGGTATTGTCCTTGTCACTGG - Intergenic
979931756 4:126640734-126640756 CCAGGAAATGTGCCTGTCACAGG + Intergenic
984282183 4:177683700-177683722 CCAGAAAATGACCTGGTCACAGG - Intergenic
985091251 4:186364545-186364567 ACAGGGAATGTTGTGGTCACAGG - Intergenic
985233899 4:187851981-187852003 ACATGAAATGTCATGGTAACTGG + Intergenic
986302212 5:6486649-6486671 TCAGGAACTGTGCTGGTGACCGG - Intronic
993437580 5:87916422-87916444 ACAGGGGATGTCCTGGTAACCGG - Intergenic
999624368 5:153504850-153504872 GCAGGAAATGTCCTGGTCACTGG - Intronic
1003123396 6:3336328-3336350 GTAGCAAAAGCCCTGGTCACAGG - Intronic
1004400977 6:15288411-15288433 GCAGGAAGTGTCTGGGTCATAGG - Intronic
1004823710 6:19398161-19398183 CCAGGCAATGTTCAGGTCACAGG - Intergenic
1005834104 6:29694993-29695015 TCAGGAAATGTGCTGGTAAGTGG + Intergenic
1008606593 6:53146045-53146067 GCAGGAAAAGTCCTAGCCATTGG - Intronic
1009590506 6:65663772-65663794 GCAGGAAATGGCCTGAACCCGGG - Intronic
1013358404 6:109368921-109368943 GGAGGAATTGTCCTGGTCTTGGG - Exonic
1014523951 6:122478887-122478909 GGAGGGAATCTCCTGGTCAGTGG + Intronic
1018631644 6:165827047-165827069 GCAGGCCACGTCCTGGTCAGGGG - Intronic
1018891415 6:167985864-167985886 GCAGGAAATTCTCTGGTCGCTGG + Intergenic
1022576197 7:31499305-31499327 GCAGGAACAGTCCTGGTAGCAGG - Intergenic
1023437253 7:40151388-40151410 GCTGGACATGTCCTTTTCACTGG + Intronic
1024084569 7:45882772-45882794 GCAGGAGGTCTCCTGGTCCCCGG + Intergenic
1024550389 7:50558248-50558270 CCAGGACATGTCATGGGCACTGG - Intronic
1026113915 7:67480321-67480343 AAAGGCAATGTCATGGTCACAGG + Intergenic
1030542195 7:110844830-110844852 CCAGGAAATTTACTGGTCACAGG + Intronic
1031676750 7:124619812-124619834 GCAGAACATGTCCTGGGAACAGG - Intergenic
1035678806 8:1472525-1472547 GCAGGAAATGTCAGGGTCTCGGG + Intergenic
1035771872 8:2153987-2154009 GCTGGACCTGTCCTTGTCACTGG - Intronic
1036379794 8:8228990-8229012 GCAGTAATCGTTCTGGTCACTGG + Intergenic
1036849767 8:12193662-12193684 GCAGTAATCGTTCTGGTCACTGG - Intronic
1036871131 8:12435935-12435957 GCAGTAATCGTTCTGGTCACTGG - Intronic
1037148652 8:15607266-15607288 GCAGGCACCGGCCTGGTCACTGG + Intronic
1045755593 8:105537587-105537609 GCAGGAAATTTCCTGAACCCAGG + Intronic
1052029039 9:23607708-23607730 CCAGGAAGTGTGCTGGGCACTGG + Intergenic
1052644883 9:31221013-31221035 GCAGGAAAAGTTCAAGTCACAGG - Intergenic
1053065747 9:35067760-35067782 GCAGGAAGCCTCCTGGTCATGGG - Intronic
1056220180 9:84444163-84444185 CCAGGAACTGTCCTAGGCACTGG - Intergenic
1056788686 9:89611226-89611248 GCAGGAAGGCTCCTGGTCAGAGG + Intergenic
1057444611 9:95104812-95104834 GCTGGAATTGTCCTTGTCACAGG + Intronic
1057501875 9:95602586-95602608 GGAGGACATGTCCTGGTAAATGG + Intergenic
1057929618 9:99182329-99182351 GCAGAAAATGTTGGGGTCACTGG + Intergenic
1058723603 9:107781369-107781391 GCTGTAAATGGCTTGGTCACAGG - Intergenic
1059029236 9:110672400-110672422 GCAGTAAATGTTCAGGTCAGGGG - Intronic
1060745310 9:126127229-126127251 CCAGGAGATGTCTTGGCCACGGG + Intergenic
1061207957 9:129175254-129175276 GCAGGAAATGTGCTGGAGGCTGG + Intergenic
1203425185 Un_GL000195v1:31022-31044 GCAGGGAATGTGCGCGTCACTGG - Intergenic
1186429404 X:9491758-9491780 GGAGAAAAGGTCCTTGTCACTGG + Intronic
1192740971 X:73892533-73892555 GGAGGGAATCTCCTGGTCTCTGG - Intergenic
1194419869 X:93660713-93660735 GGAGGAAATCTCCTGGTCTGTGG - Intergenic
1195102241 X:101566855-101566877 GGAGGAAATCTCCTGGTCTGTGG - Intergenic
1200014947 X:153152993-153153015 GCAGGAAATGTCAAGATCATTGG + Intergenic
1200078553 X:153564315-153564337 GCAAGAAAAGCCCTGGACACCGG - Intronic