ID: 999624538

View in Genome Browser
Species Human (GRCh38)
Location 5:153506511-153506533
Sequence CTCAATTAACAAATGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1498
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 1445}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999624538_999624542 -6 Left 999624538 5:153506511-153506533 CCAAGCTCCATTTGTTAATTGAG 0: 1
1: 0
2: 2
3: 50
4: 1445
Right 999624542 5:153506528-153506550 ATTGAGGTGGTTAATTAGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 146
999624538_999624543 15 Left 999624538 5:153506511-153506533 CCAAGCTCCATTTGTTAATTGAG 0: 1
1: 0
2: 2
3: 50
4: 1445
Right 999624543 5:153506549-153506571 GGAGTCTCCCTTGAGCAAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999624538 Original CRISPR CTCAATTAACAAATGGAGCT TGG (reversed) Intronic
900841821 1:5055614-5055636 CTTATTTAATAAATGGTGCTGGG + Intergenic
902187756 1:14738146-14738168 GTCATTTATCACATGGAGCTGGG - Intronic
902474726 1:16676356-16676378 CTTATTTAATAAATGGTGCTGGG + Intergenic
904776362 1:32909894-32909916 GTCTTTCAACAAATGGAGCTGGG + Intergenic
904828477 1:33291297-33291319 CCTATTTAACAAATGGTGCTGGG - Intronic
905623626 1:39471199-39471221 ATCAAATAAAAAATGGTGCTAGG + Intronic
906452494 1:45962996-45963018 CCTATTTAACAAATGGTGCTGGG - Intronic
906663914 1:47603798-47603820 CCTATTTAACAAATGGTGCTGGG + Intergenic
907435609 1:54444498-54444520 CCCATTTAATAAATGGTGCTGGG - Intergenic
907547059 1:55271125-55271147 CTCAATTAAAAGATAGAGATTGG - Intergenic
907649511 1:56281377-56281399 CTTATTTAACAAATGGTGCTGGG - Intergenic
908129801 1:61063901-61063923 CTCAATTTAAAAATAGGGCTGGG - Intronic
908394221 1:63710696-63710718 CTCAAATTACAAAAGGAGTTGGG + Intergenic
908859857 1:68471890-68471912 CCAAATTAAGAAATGGGGCTGGG - Intergenic
908881200 1:68735339-68735361 CCTATTTAACAAATGGTGCTGGG - Intergenic
909082015 1:71123764-71123786 CTTATTTAATAAATGGTGCTGGG + Intergenic
909084088 1:71151191-71151213 CTTATTTAATAAATGGTGCTGGG + Intergenic
909178399 1:72389127-72389149 CCTATTTAACAAATGGTGCTGGG - Intergenic
909303760 1:74046366-74046388 CCTAATTAATAAATGGTGCTAGG + Intronic
909374902 1:74928825-74928847 CTTATTTAATAAATGGTGCTGGG + Intergenic
909499015 1:76312187-76312209 CCTAATTAACAAATGGTGTTGGG + Intronic
909545087 1:76837810-76837832 CCTATTTAACAAATGGTGCTGGG - Intergenic
909678626 1:78266098-78266120 CTTATTTAATAAATGGTGCTGGG - Intergenic
909838526 1:80288409-80288431 CCTATTTAACAAATGGTGCTGGG + Intergenic
909853660 1:80501557-80501579 CCTATTTAACAAATGGTGCTGGG + Intergenic
909891657 1:81015075-81015097 CCTATTTAACAAATGGTGCTGGG + Intergenic
909903409 1:81166667-81166689 TTCACTTAACAAATGGAGAAAGG - Intergenic
910158004 1:84242087-84242109 CCTATTTAACAAATGGTGCTGGG - Intergenic
910336024 1:86132598-86132620 CCTATTTAACAAATGGTGCTGGG - Intronic
910338898 1:86163583-86163605 CCTACTTAACAAATGGTGCTGGG - Intergenic
910502696 1:87911001-87911023 CTCAAATGATTAATGGAGCTGGG - Intergenic
910597329 1:88993335-88993357 CTCAAATGACAAATGCATCTAGG - Intergenic
910600759 1:89029755-89029777 CCCTATTAATAAATGGTGCTGGG - Intergenic
910614598 1:89183309-89183331 CCCATTTAATAAATGGTGCTGGG + Exonic
910786367 1:91002437-91002459 CCTATTTAACAAATGGTGCTGGG + Intronic
911000033 1:93154940-93154962 CTTAATTAAAAAATGAGGCTGGG + Intronic
911106739 1:94139008-94139030 CCTATTTAACAAATGGTGCTGGG + Intergenic
911120209 1:94288730-94288752 CCTATTTAACAAATGGTGCTGGG - Intergenic
911800793 1:102135043-102135065 CCTATTTAACAAATGGAGCTGGG + Intergenic
911824377 1:102462606-102462628 CTTATTTAATAAATGGTGCTGGG - Intergenic
911825586 1:102481124-102481146 CCTATTTAACAAATGGTGCTGGG - Intergenic
911882844 1:103263887-103263909 CCTATTTAACAAATGGTGCTGGG + Intergenic
911903309 1:103532061-103532083 CTTATTCAACAAATGGTGCTGGG - Intronic
912034295 1:105291874-105291896 CTTATTTAATAAATGGTGCTGGG - Intergenic
912108593 1:106312419-106312441 CCTATTTAATAAATGGAGCTGGG - Intergenic
912156834 1:106931233-106931255 CCTATTTAACAAATGGTGCTGGG - Intergenic
912748106 1:112262749-112262771 CTCCATTTACAAATGCAGCATGG - Intergenic
912959614 1:114183861-114183883 CCTATTTAACAAATGGTGCTGGG - Intergenic
912999198 1:114562661-114562683 CCTATTTAACAAATGGTGCTGGG + Intergenic
913228117 1:116718475-116718497 CCTATTTAACAAATGGTGCTGGG + Intergenic
913391143 1:118313729-118313751 CCTATTTAACAAATGGTGCTGGG + Intergenic
913394697 1:118353653-118353675 CCTAATTAACAAATGGTGCTGGG + Intergenic
913512966 1:119579100-119579122 CCTATTTAACAAATGGTGCTGGG + Intergenic
913525867 1:119692326-119692348 CTTATTTAATAAATGGTGCTGGG - Intronic
913608180 1:120485614-120485636 CCTATTTAACAAATGGTGCTGGG + Intergenic
913647432 1:120872092-120872114 CTTATTTAATAAATGGTGCTGGG - Intergenic
913694427 1:121310657-121310679 CTTATTTAATAAATGGTGCTGGG - Intronic
914008284 1:143753102-143753124 CCTATTTAACAAATGGTGCTGGG - Intergenic
914208269 1:145554547-145554569 CCTATTTAACAAATGGTGCTGGG - Intergenic
914218972 1:145660210-145660232 CTTATTTAATAAATGGTGCTGGG + Intronic
914219596 1:145667804-145667826 CCTATTTAACAAATGGTGCTGGG - Intronic
914336346 1:146718421-146718443 CCTATTTAACAAATGGTGCTGGG - Intergenic
914351234 1:146842420-146842442 CTCACCAAACAAATGGAGTTGGG + Intergenic
914369596 1:147011432-147011454 CCTATTTAACAAATGGTGCTGGG + Intergenic
914389388 1:147205674-147205696 CCTATTTAACAAATGGTGCTGGG + Intronic
914472178 1:147990681-147990703 CCTATTTAACAAATGGTGCTGGG - Intronic
915026465 1:152835122-152835144 CCCATTTAATAAATGGTGCTAGG + Intergenic
915045077 1:153005855-153005877 CTTATTTAATAAATGGTGCTGGG - Intergenic
915051546 1:153079597-153079619 CTTATTTAATAAATGGTGCTGGG - Intergenic
915690331 1:157682476-157682498 CTTTATTAATAAATGGTGCTGGG - Intronic
915761270 1:158315890-158315912 CCCATTTAATAAATGGTGCTGGG - Intergenic
915794129 1:158708822-158708844 CCTATTTAATAAATGGAGCTGGG - Intergenic
916331278 1:163620086-163620108 CCCATTAAACAAATGGTGCTGGG - Intergenic
916637316 1:166686767-166686789 CCTATTTAACAAATGGTGCTGGG - Intergenic
916639185 1:166708684-166708706 CCTATTTAACAAATGGTGCTGGG + Intergenic
916829805 1:168479259-168479281 CTTATTTAATAAATGGTGCTGGG + Intergenic
916837570 1:168563698-168563720 CCTATTTAACAAATGGTGCTGGG + Intergenic
916916533 1:169412782-169412804 CTTATTTAATAAATGGTGCTGGG + Intronic
917022878 1:170609464-170609486 CTTATTTAATAAATGGTGCTGGG - Intergenic
917066264 1:171098023-171098045 CCTATTTAACAAATGGTGCTGGG - Intronic
917092179 1:171364447-171364469 CTTATTTAACAAATGGTGTTGGG + Intergenic
917192848 1:172436500-172436522 CTGATTTAATAAATGGTGCTGGG + Intronic
917413224 1:174781799-174781821 CCCATTTAACAAATGGTGCTGGG - Intronic
917484083 1:175439283-175439305 CCTATTTAACAAATGGTGCTGGG + Intronic
917616492 1:176751073-176751095 CCTATTTAACAAATGGTGCTGGG - Intronic
917682340 1:177380140-177380162 CCTATTTAACAAATGGTGCTGGG - Intergenic
917834318 1:178929118-178929140 CTCAAATAACAAAGGGCACTCGG - Intergenic
918165749 1:181945859-181945881 CTCATTCAATAAATGGTGCTGGG + Intergenic
918219291 1:182421315-182421337 CTTATTTAATAAATGGTGCTGGG - Intergenic
918525502 1:185460003-185460025 CCTATTTAACAAATGGTGCTGGG + Intergenic
918563834 1:185902139-185902161 CTCAATTCATAAATGGATATAGG - Intronic
918638591 1:186810215-186810237 CCTATTTAACAAATGGTGCTGGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918665198 1:187142314-187142336 CCTATTTAACAAATGGTGCTGGG + Intergenic
918786790 1:188773786-188773808 CCCATTTAATAAATGGTGCTGGG + Intergenic
919014715 1:192017931-192017953 CCTATTTAACAAATGGTGCTGGG + Intergenic
919152519 1:193719098-193719120 CCTATTTAACAAATGGTGCTGGG - Intergenic
919169426 1:193935146-193935168 CTCAATTAACCTAGGGGGCTTGG - Intergenic
919287378 1:195581021-195581043 CTCAATTAAAAAATGGGAATTGG - Intergenic
919368550 1:196696913-196696935 CTTATTTAATAAATGGTGCTGGG + Intronic
919514616 1:198507701-198507723 CCTAATCAACAAATGGTGCTGGG - Intergenic
919542902 1:198873341-198873363 CCTATTTAACAAATGGTGCTGGG + Intergenic
919580518 1:199366350-199366372 CCCATTTAATAAATGGTGCTGGG + Intergenic
919765778 1:201126672-201126694 AACAATTAAGTAATGGAGCTAGG + Intronic
920065007 1:203262860-203262882 CCTATTTAACAAATGGTGCTGGG + Intronic
920085923 1:203416875-203416897 CCCATTTAATAAATGGTGCTGGG + Intergenic
920088656 1:203436407-203436429 CCCATTTAATAAATGGTGCTGGG + Intergenic
920359277 1:205401935-205401957 CCCATTTAATAAATGGTGCTGGG - Intronic
920637476 1:207718214-207718236 CACCATTAACAAAGGGAACTCGG + Intronic
920767760 1:208849919-208849941 ATAAAGTCACAAATGGAGCTAGG - Intergenic
920866485 1:209757885-209757907 CTCATTTATAAAATGGGGCTAGG - Intronic
920953452 1:210596202-210596224 CCTATTTAACAAATGGTGCTGGG - Intronic
920990212 1:210930442-210930464 CTGATTCAACAAATGGTGCTGGG + Intronic
921690587 1:218144593-218144615 CTTATTCAACAAATGGTGCTGGG + Intergenic
921835718 1:219776114-219776136 CCTATTTAACAAATGGTGCTGGG - Intronic
922393599 1:225173017-225173039 CTTATTTAATAAATGGTGCTGGG + Intronic
922401516 1:225262578-225262600 CTCTATTCAAAAATGGTGCTGGG - Intronic
924142216 1:241037422-241037444 ATCAATCAACAAATGGAGGCCGG + Intronic
924201157 1:241660145-241660167 CCTATTTAACAAATGGTGCTGGG - Intronic
924407957 1:243771947-243771969 CCTATTTAACAAATGGTGCTGGG + Intronic
924408907 1:243782685-243782707 ATTATTTAACAAATGGAACTGGG + Intronic
924412827 1:243824167-243824189 CCTATTTAACAAATGGTGCTAGG + Intronic
924790283 1:247240150-247240172 CCTATTTAACAAATGGTGCTGGG + Intergenic
924849428 1:247810118-247810140 CCTATTTAACAAATGGTGCTGGG - Intergenic
924912299 1:248527224-248527246 CCTATTTAACAAATGGTGCTGGG - Intergenic
1062781059 10:208055-208077 CTTATTTAATAAATGGTGCTGGG + Intronic
1063293348 10:4775254-4775276 CTCAATTAAGAAATGGGGCTGGG + Intergenic
1063744503 10:8864756-8864778 CCTATTTAATAAATGGAGCTGGG - Intergenic
1063806706 10:9653224-9653246 ATGAATTAACAAAAGGATCTTGG + Intergenic
1064077899 10:12284852-12284874 CCTATTTAATAAATGGAGCTGGG - Intergenic
1064383293 10:14865556-14865578 CCTATTTAACAAATGGTGCTGGG - Intronic
1064522469 10:16217499-16217521 CCTATTTAACAAATGGTGCTGGG - Intergenic
1064794018 10:18990937-18990959 CCTATTTAACAAATGGTGCTGGG + Intergenic
1064794609 10:18997340-18997362 CTTATTTAATAAATGGTGCTGGG + Intergenic
1064801577 10:19080526-19080548 CCTATTTAACAAATGGTGCTGGG + Intronic
1064857409 10:19785357-19785379 CCTATTTAACAAATGGTGCTGGG + Intronic
1064897983 10:20261016-20261038 CTCAATTTAAAAATGGAGAAAGG - Intronic
1064990112 10:21249186-21249208 CCCAATTAAAAAATGGGGCTGGG - Intergenic
1065055806 10:21841011-21841033 CCTATTTAACAAATGGTGCTGGG + Intronic
1065183832 10:23153360-23153382 CCTATTTAACAAATGGTGCTGGG + Intergenic
1065463239 10:25991746-25991768 CCTATTTAACAAATGGTGCTGGG - Intronic
1065715088 10:28558957-28558979 TTATATTAACAAATTGAGCTGGG - Intronic
1066032627 10:31444646-31444668 CCTATTTAACAAATGGTGCTGGG - Intronic
1066799305 10:39166645-39166667 CTTATTTAATAAATGGTGCTGGG + Intergenic
1066821115 10:39490835-39490857 CATATTTAACAAATGGTGCTGGG - Intergenic
1066930670 10:41754103-41754125 CTTATTTAATAAATGGTGCTGGG + Intergenic
1068105096 10:52605170-52605192 CCTATTTAACAAATGGTGCTGGG - Intergenic
1068178773 10:53495237-53495259 CCTATTTAACAAATGGTGCTGGG - Intergenic
1068185302 10:53577484-53577506 CTTATTTAATAAATGGTGCTGGG + Intergenic
1069260360 10:66386854-66386876 CTTATTTAATAAATGGTGCTGGG + Intronic
1069263545 10:66430661-66430683 CTTATTTAATAAATGGTGCTGGG + Intronic
1069298210 10:66873669-66873691 CCCATTCAACAAATGGTGCTGGG + Intronic
1069355475 10:67580288-67580310 CTTATTTAATAAATGGTGCTGGG - Intronic
1070444082 10:76477810-76477832 CCTATTTAACAAATGGTGCTGGG + Intronic
1070852296 10:79575234-79575256 CCCTATTAATAAATGGTGCTGGG + Intergenic
1071059492 10:81553030-81553052 CTTATTTAATAAATGGTGCTGGG + Intergenic
1071373399 10:84976852-84976874 CCTATTTAACAAATGGTGCTAGG + Intergenic
1071740367 10:88351462-88351484 CCTATTTAACAAATGGTGCTGGG - Intronic
1071762938 10:88629677-88629699 CCTATTTAACAAATGGTGCTGGG - Intergenic
1071900355 10:90114308-90114330 CTTATTTAACAAATGGTGCTGGG - Intergenic
1072032488 10:91534541-91534563 CCTATTTAACAAATGGTGCTGGG + Intergenic
1072173089 10:92886674-92886696 CACAATTTACAAATGTAGTTTGG - Intronic
1072457211 10:95587195-95587217 CTTAATGAAATAATGGAGCTAGG - Intergenic
1072778800 10:98228816-98228838 CCTATTTAACAAATGGTGCTGGG - Intronic
1072841888 10:98784174-98784196 CCTATTTAACAAATGGTGCTGGG - Intronic
1072902034 10:99416837-99416859 CCTATTTAACAAATGGTGCTGGG + Intronic
1072953057 10:99865025-99865047 CTAATTTAATAAATGGTGCTGGG - Intergenic
1073697835 10:105890904-105890926 CCTATTTAACAAATGGTGCTGGG + Intergenic
1073924374 10:108497942-108497964 CTTATTTAATAAATGGTGCTGGG + Intergenic
1073933840 10:108606623-108606645 CCCATTTAATAAATGGTGCTGGG - Intergenic
1074925609 10:118067122-118067144 CCTATTTAACAAATGGTGCTGGG + Intergenic
1076320501 10:129577444-129577466 CTTATTTAATAAATGGTGCTGGG + Intronic
1076419015 10:130315287-130315309 CCTATTTAACAAATGGTGCTGGG - Intergenic
1076665137 10:132083764-132083786 CCCTTTTAACAAATGGTGCTGGG - Intergenic
1077448320 11:2614611-2614633 GTCTTTTAACAAATGGTGCTGGG - Intronic
1077731981 11:4741147-4741169 CCTAATCAACAAATGGTGCTGGG - Intronic
1077742219 11:4858980-4859002 CCTATTTAATAAATGGAGCTGGG + Intronic
1077743051 11:4868976-4868998 CCTATTTAATAAATGGAGCTGGG + Intronic
1077750615 11:4964344-4964366 CTTATTTAATAAATGGTGCTAGG - Intronic
1077830812 11:5868077-5868099 CCCATTTAATAAATGGTGCTGGG - Intronic
1077952967 11:6981841-6981863 CCCATTTAATAAATGGTGCTGGG - Intronic
1077965594 11:7129113-7129135 CCTATTTAACAAATGGTGCTGGG - Intergenic
1078029268 11:7732746-7732768 CTTAATCAATAAATGGTGCTGGG + Intergenic
1078322921 11:10352879-10352901 CACAATTAGAAAATGGGGCTGGG - Intronic
1078990265 11:16639147-16639169 CCTATTTAACAAATGGTGCTGGG - Intronic
1078991561 11:16652521-16652543 CTTATTTAACAAATAGTGCTGGG + Intronic
1079300293 11:19272747-19272769 CCCACTTAATAAATGGTGCTGGG + Intergenic
1079463091 11:20701741-20701763 CCCATTTAATAAATGGTGCTGGG - Intronic
1079625610 11:22613160-22613182 TTCAATAAATAAATGGTGCTGGG - Intergenic
1079678401 11:23261858-23261880 CCTATTTAACAAATGGTGCTGGG + Intergenic
1079764269 11:24371099-24371121 CTTATTTAATAAATGGTGCTGGG - Intergenic
1080067116 11:28030439-28030461 CCCATTTAATAAATGGTGCTGGG + Intronic
1080080052 11:28206340-28206362 CCCATTTAATAAATGGTGCTGGG - Intronic
1080150513 11:29047000-29047022 CCTATTTAACAAATGGTGCTGGG - Intergenic
1080468690 11:32524315-32524337 CCTATTTAACAAATGGTGCTGGG - Intergenic
1080488463 11:32735918-32735940 CCTATTTAACAAATGGTGCTGGG + Intronic
1080491302 11:32767229-32767251 CCTATTTAACAAATGGTGCTGGG + Intronic
1080567750 11:33527352-33527374 CTTATTCAACAAATGGTGCTGGG + Intergenic
1080900219 11:36482741-36482763 CTTATTTAATAAATGGTGCTGGG + Intergenic
1081176448 11:39933029-39933051 GTCAGCTAAGAAATGGAGCTTGG + Intergenic
1081309173 11:41549684-41549706 CTTATTTAATAAATGGTGCTGGG + Intergenic
1081313603 11:41603832-41603854 CTTATTTAATAAATGGTGCTGGG + Intergenic
1081364270 11:42215409-42215431 CCTATTTAACAAATGGTGCTGGG + Intergenic
1082123672 11:48407221-48407243 CCTATTTAACAAATGGTGCTGGG + Intergenic
1082211439 11:49507308-49507330 CCTATTTAACAAATGGTGCTGGG - Intergenic
1082557355 11:54578501-54578523 CCTATTTAACAAATGGTGCTGGG + Intergenic
1082586898 11:54951735-54951757 CTTATTTAATAAATGGTGCTGGG + Intergenic
1082600008 11:55137599-55137621 CTTATTTAATAAATGGCGCTGGG + Intergenic
1082672268 11:56048706-56048728 GTCAATTAATGAATGGAGGTAGG - Intergenic
1082730739 11:56794021-56794043 CCTATTTAACAAATGGTGCTGGG + Intergenic
1082731226 11:56800413-56800435 ATCATTCAACAAATGGAACTGGG + Intergenic
1082925435 11:58540947-58540969 CCCATTTAATAAATGGTGCTGGG + Intronic
1082951496 11:58820850-58820872 CCTATTTAACAAATGGTGCTGGG + Intergenic
1083497215 11:63066537-63066559 CCTATTTAACAAATGGTGCTGGG - Intergenic
1085013912 11:73159948-73159970 CTGAATTAACAAAGGCAGCTGGG - Intergenic
1085491983 11:76928693-76928715 CTTATTTAATAAATGGTGCTGGG - Intronic
1085495862 11:76968701-76968723 CTTATTTAATAAATGGTGCTGGG + Intronic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1086280185 11:85176372-85176394 CCTATTTAACAAATGGTGCTAGG + Intronic
1086304647 11:85466542-85466564 CTTATTTAATAAATGGTGCTGGG - Intronic
1086442539 11:86843179-86843201 CCTATTTAACAAATGGTGCTGGG + Intronic
1086531472 11:87791446-87791468 CTTATTTAATAAATGGTGCTGGG + Intergenic
1086531480 11:87791531-87791553 CTTATTTAATAAATGGTGCTGGG + Intergenic
1086638211 11:89117768-89117790 CCTATTTAACAAATGGTGCTGGG + Intergenic
1086659366 11:89395736-89395758 CCTATTTAATAAATGGAGCTGGG - Intronic
1086741541 11:90375689-90375711 CCTATTTAATAAATGGAGCTGGG - Intergenic
1086762462 11:90649683-90649705 CCCTATTAATAAATGGTGCTGGG + Intergenic
1086765087 11:90686927-90686949 CTTATTTAATAAATGGTGCTGGG - Intergenic
1086807005 11:91256317-91256339 CCTATTTAACAAATGGTGCTGGG + Intergenic
1087289653 11:96306430-96306452 TTCAAGTCACAAAGGGAGCTAGG - Intronic
1087391606 11:97541964-97541986 CCCTATTAATAAATGGTGCTGGG + Intergenic
1087395648 11:97593603-97593625 CCTATTTAACAAATGGTGCTGGG + Intergenic
1087467209 11:98523908-98523930 CCTATTTAACAAATGGTGCTGGG - Intergenic
1087649129 11:100844207-100844229 CCCATTGAACAAATGGTGCTGGG + Intronic
1087653582 11:100897072-100897094 CCTATTTAACAAATGGTGCTGGG - Intronic
1087739941 11:101875688-101875710 CTTATTTAATAAATGGTGCTGGG - Intergenic
1087911698 11:103761336-103761358 CCTATTTAACAAATGGTGCTGGG + Intergenic
1087964390 11:104394271-104394293 CTCAATTAACAAACAAATCTGGG - Intergenic
1087969567 11:104462576-104462598 CTCAATTACCAAACACAGCTGGG - Intergenic
1088053164 11:105543373-105543395 CTGAATTGCCAAAAGGAGCTTGG + Intergenic
1088158471 11:106839208-106839230 CCTATTTAACAAATGGTGCTGGG - Intronic
1088187984 11:107194857-107194879 CCTATTTAACAAATGGTGCTGGG + Intergenic
1088362494 11:109005739-109005761 CCTACTTAACAAATGGTGCTGGG + Intergenic
1088490626 11:110384017-110384039 CCTATTTAACAAATGGTGCTGGG - Intergenic
1089133358 11:116229695-116229717 CTGAATTAAAAAATGTAACTAGG - Intergenic
1089722151 11:120435863-120435885 CTGAATTAAACAATGGATCTAGG - Intronic
1089885774 11:121822521-121822543 CCTATTTAACAAATGGTGCTGGG - Intergenic
1090215866 11:124963875-124963897 CCCTATTAATAAATGGTGCTGGG - Intronic
1090313145 11:125760859-125760881 CCTATTTAATAAATGGAGCTGGG + Intergenic
1090544786 11:127752402-127752424 CCTATTTAACAAATGGTGCTGGG - Intergenic
1090587036 11:128224009-128224031 CTTATTTAATAAATGGTGCTGGG + Intergenic
1090606487 11:128427461-128427483 CTTATTTAATAAATGGTGCTGGG - Intergenic
1091064968 11:132501138-132501160 CCTATTTAACAAATGGTGCTGGG + Intronic
1091329633 11:134721382-134721404 CTTATTTAATAAATGGTGCTGGG - Intergenic
1092325135 12:7523118-7523140 CCTATTTAACAAATGGTGCTGGG - Intergenic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1092684928 12:11032285-11032307 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1092689606 12:11093177-11093199 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1092706343 12:11289327-11289349 CCTATTTAACAAATGGTGCTGGG + Intergenic
1092779419 12:11971489-11971511 CCCATTTAATAAATGGTGCTGGG + Intergenic
1093106815 12:15096916-15096938 CCTATTTAACAAATGGTGCTGGG - Intergenic
1093386431 12:18561306-18561328 GTCAATAAAAAAATGGAGGTGGG + Intronic
1093655783 12:21692925-21692947 CTTATTTAATAAATGGGGCTGGG + Intronic
1093777241 12:23090182-23090204 CCTATTTAACAAATGGTGCTGGG - Intergenic
1094009003 12:25786593-25786615 CTCAATTAAAATATTAAGCTAGG - Intergenic
1094351322 12:29528673-29528695 CTCAAATGACAAATGGACATTGG + Intronic
1094382023 12:29853365-29853387 CCCATTTAATAAATGGTGCTGGG + Intergenic
1094387876 12:29914797-29914819 CCTATTTAACAAATGGTGCTGGG + Intergenic
1094593711 12:31844879-31844901 CTCAATTAAAAAATAAAGCATGG - Intergenic
1094869280 12:34581048-34581070 CTTATTTAATAAATGGTGCTGGG - Intergenic
1095074261 12:37897293-37897315 CCCATTTAATAAATGGTGCTGGG + Intergenic
1095234893 12:39784483-39784505 CCTACTTAACAAATGGTGCTGGG + Intronic
1095449931 12:42319771-42319793 ATCAATCAACATATTGAGCTGGG - Intronic
1095705980 12:45237456-45237478 CTTATTTAATAAATGGTGCTGGG - Intronic
1095770462 12:45949683-45949705 TTCCATTAACAACTGGGGCTGGG + Intronic
1095776559 12:46017004-46017026 CCCATTTAATAAATGGTGCTAGG - Intergenic
1095867389 12:46987406-46987428 CCCATTTAATAAATGGAGCTAGG + Intergenic
1095879547 12:47118423-47118445 CTTATTTAATAAATGGTGCTGGG - Intronic
1095920193 12:47521788-47521810 CCCTATTAATAAATGGTGCTGGG - Intergenic
1096034390 12:48452243-48452265 CTTATTTAATAAATGGTGCTGGG + Intergenic
1096360101 12:50977404-50977426 CCTATTTAACAAATGGTGCTGGG + Intergenic
1096584312 12:52609677-52609699 CTCAGTTATAAAATGGTGCTTGG + Intronic
1096877133 12:54638392-54638414 CTTATTTAATAAATGGTGCTGGG + Intergenic
1096920259 12:55076724-55076746 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097472917 12:60017855-60017877 CCTATTTAACAAATGGTGCTGGG - Intergenic
1097508253 12:60503588-60503610 CACATTTAATAAATGGTGCTGGG - Intergenic
1097530436 12:60793154-60793176 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097531710 12:60809806-60809828 CTTATTTAATAAATGGTGCTGGG - Intergenic
1097581747 12:61465717-61465739 CTTATTTAATAAATGGTGCTGGG + Intergenic
1098053404 12:66477787-66477809 CCTATTTAACAAATGGTGCTGGG + Intronic
1098211798 12:68174034-68174056 CCTATTTAACAAATGGTGCTGGG + Intergenic
1098347414 12:69520648-69520670 CCTAATCAACAAATGGTGCTAGG - Intronic
1098371423 12:69764375-69764397 CTTATTCAACAAATGGTGCTAGG - Intronic
1098406954 12:70137097-70137119 CTTATTCAACAAATGGTGCTGGG + Intergenic
1098452135 12:70631337-70631359 CCTATTTAATAAATGGAGCTGGG + Intronic
1098473073 12:70867945-70867967 CCTATTTAACAAATGGTGCTGGG + Intronic
1098473962 12:70878008-70878030 CCTATTTAACAAATGGTGCTGGG + Intronic
1098520890 12:71434381-71434403 CTCTATTAACAAATGGTGCTGGG + Intronic
1098720838 12:73895687-73895709 CCTATTTAACAAATGGTGCTGGG - Intergenic
1098742833 12:74196154-74196176 CTCAATAAATTAATGGATCTAGG + Intergenic
1099070844 12:78044163-78044185 CCTATTTAACAAATGGTGCTGGG - Intronic
1099073092 12:78071706-78071728 CTTATTTAATAAATGGCGCTGGG - Intronic
1099168871 12:79339903-79339925 CCTATTTAACAAATGGTGCTGGG - Intronic
1099261714 12:80390698-80390720 CCTATTTAACAAATGGTGCTGGG + Intergenic
1099268832 12:80482283-80482305 CTTATTTAATAAATGGTGCTGGG + Intronic
1099330982 12:81286694-81286716 CTTAAGTAACAAATGGAAATGGG + Intronic
1099383533 12:81985488-81985510 CCTATTTAACAAATGGTGCTGGG - Intergenic
1099388653 12:82050741-82050763 CCTATTTAACAAATGGTGCTGGG + Intergenic
1099427841 12:82546416-82546438 CCTATTTAACAAATGGTGCTGGG - Intergenic
1099434802 12:82630380-82630402 CCTATTTAACAAATGGTGCTGGG - Intergenic
1099484359 12:83209813-83209835 CCTATTTAACAAATGGTGCTGGG - Intergenic
1099500042 12:83402924-83402946 CCTATTTAACAAATGGTGCTGGG - Intergenic
1099679072 12:85801438-85801460 CTCAATTCAAAAAGGGAGCAGGG + Exonic
1099788271 12:87295853-87295875 CCTATTTAACAAATGGTGCTGGG + Intergenic
1099795884 12:87398816-87398838 CGTATTTAACAAATGGTGCTGGG + Intergenic
1099820025 12:87697502-87697524 CTTATTTAATAAATGGTGCTGGG - Intergenic
1099880587 12:88462415-88462437 CTCTATTAATAAATGGTGTTAGG - Intergenic
1100374699 12:94003557-94003579 CTTATTTAACAAATGGTGTTGGG - Intergenic
1100564271 12:95780058-95780080 CCTATTTAACAAATGGTGCTGGG + Intronic
1100706697 12:97208262-97208284 CCTACTCAACAAATGGAGCTGGG + Intergenic
1100876279 12:98965806-98965828 CTTATTTAATAAATGGTGCTGGG + Intronic
1100918926 12:99460175-99460197 CCTATTTAACAAATGGTGCTGGG + Intronic
1100966176 12:100015585-100015607 CCTATTTAACAAATGGTGCTGGG + Intergenic
1101060298 12:100964247-100964269 CTCAAGTAAGGAATGGAGCCTGG - Intronic
1101284530 12:103297092-103297114 CCTATTTAACAAATGGTGCTGGG - Intronic
1101488198 12:105186909-105186931 CCCAATTAAAAAATGGACCAAGG - Intronic
1101524419 12:105515095-105515117 CCCTATTAATAAATGGTGCTGGG - Intergenic
1101743156 12:107517100-107517122 CCTATTTAACAAATGGTGCTGGG - Intronic
1102887124 12:116530603-116530625 CTCATCTAAAAGATGGAGCTAGG + Intergenic
1103039306 12:117681765-117681787 CCCATTTAGCAAATGGTGCTGGG - Intronic
1103168709 12:118794341-118794363 CTTATTTAATAAATGGTGCTGGG - Intergenic
1103695234 12:122809927-122809949 CCTATTTAACAAATGGTGCTGGG + Intronic
1104129302 12:125877508-125877530 CCTATTTAACAAATGGTGCTGGG + Intergenic
1104333553 12:127870627-127870649 CCTATTTAACAAATGGTGCTGGG + Intergenic
1104524528 12:129506617-129506639 CATATTTAACAAATGGTGCTGGG + Intronic
1104685171 12:130780207-130780229 CTCAAAAAACAAAGGGTGCTGGG + Intergenic
1105283900 13:18988605-18988627 CCTATTTAACAAATGGTGCTGGG + Intergenic
1105453859 13:20523563-20523585 CCCACTTAACAAATAGGGCTTGG - Intronic
1105598483 13:21862706-21862728 CCTAATCAACAAATGGACCTGGG - Intergenic
1106074427 13:26445451-26445473 CTCATTTATAAAATGGAGATGGG + Intergenic
1106445319 13:29824939-29824961 CCTATTTAACAAATGGTGCTGGG - Intronic
1106613658 13:31307089-31307111 CCTATTTAACAAATGGTGCTGGG + Intronic
1106623734 13:31397202-31397224 CCTATTTAACAAATGGTGCTGGG - Intergenic
1106894516 13:34284503-34284525 CCTATTTAACAAATGGTGCTGGG + Intergenic
1106902334 13:34367068-34367090 CCTATTTAACAAATGGTGCTGGG + Intergenic
1106945826 13:34826724-34826746 CTCATTTAACCAATAAAGCTTGG - Intergenic
1106977886 13:35244347-35244369 CTCTTTCAACAAATGGTGCTGGG - Intronic
1106983408 13:35317336-35317358 CCCATTTAATAAATGGTGCTGGG - Intronic
1107084823 13:36415344-36415366 CCTATTTAACAAATGGTGCTGGG + Intergenic
1107304328 13:39002078-39002100 CCTATTTAACAAATGGTGCTGGG - Intergenic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107960932 13:45557663-45557685 CTTATTCAACAAATGGTGCTGGG - Intronic
1108785673 13:53898450-53898472 CCTATTTAACAAATGGTGCTGGG + Intergenic
1108793986 13:54008613-54008635 CCTATTTAACAAATGGTGCTGGG + Intergenic
1108832046 13:54491524-54491546 CCTATTTAACAAATGGTGCTGGG + Intergenic
1108865942 13:54922642-54922664 CTTATTTAATAAATGGTGCTGGG + Intergenic
1108917623 13:55635183-55635205 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109049519 13:57460135-57460157 CCTATTTAACAAATGGTGCTGGG - Intergenic
1109057965 13:57576589-57576611 CCTATTTAACAAATGGTGCTGGG - Intergenic
1109081259 13:57904224-57904246 CTTATTTAATAAATGGTGCTAGG + Intergenic
1109096817 13:58129337-58129359 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109127623 13:58537486-58537508 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109137584 13:58673852-58673874 CCTATTTAACAAATGGTGCTGGG - Intergenic
1109146481 13:58786119-58786141 CTTATTTAATAAATGGTGCTCGG - Intergenic
1109196895 13:59387859-59387881 CCTATTTAACAAATGGTGCTGGG - Intergenic
1109270166 13:60247129-60247151 CCCATTTAATAAATGGTGCTGGG - Intergenic
1109565897 13:64116125-64116147 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109757270 13:66777038-66777060 CCCATTTAATAAATGGTGCTGGG + Intronic
1109764060 13:66870155-66870177 CCCATTTAATAAATGGTGCTGGG - Intronic
1109870696 13:68328558-68328580 CTTATTTAATAAATGGTGCTGGG - Intergenic
1109954142 13:69543891-69543913 CCTATTTAACAAATGGTGCTGGG - Intergenic
1110001941 13:70213633-70213655 CTTATTTAATAAATGGTGCTGGG + Intergenic
1110182204 13:72630877-72630899 CTTATTTAACAGATGGTGCTGGG + Intergenic
1110394872 13:75018087-75018109 CTTATTTAACAAATGGTGCTGGG + Intergenic
1110418921 13:75282831-75282853 CCCATTCAACAAATGGTGCTTGG - Intergenic
1110504437 13:76269074-76269096 CCTATTTAACAAATGGAGCTGGG - Intergenic
1110595097 13:77311652-77311674 CTCAATAAGAAAATGGAGATGGG + Intronic
1110755902 13:79173537-79173559 CCTATTTAACAAATGGTGCTAGG - Intergenic
1110837656 13:80103194-80103216 CTTAATTAACAAATGAATCAAGG + Intergenic
1111225999 13:85271672-85271694 CCTATTTAACAAATGGTGCTGGG + Intergenic
1111234301 13:85388920-85388942 CCTATTTAACAAATGGTGCTGGG + Intergenic
1111342003 13:86898781-86898803 CTTATTTAATAAATGGTGCTGGG + Intergenic
1111465011 13:88597072-88597094 CCTATTTAACAAATGGTGCTGGG + Intergenic
1111663873 13:91243523-91243545 CTTACTTATCAAATGGAGGTAGG - Intergenic
1111839169 13:93427509-93427531 CCTATTTAACAAATGGTGCTGGG + Intronic
1112069259 13:95830038-95830060 CTTATTTAATAAATGGTGCTGGG + Intronic
1112178269 13:97050417-97050439 CCTATTTAACAAATGGTGCTGGG - Intergenic
1112671343 13:101642796-101642818 CACATTTAATAAATGGTGCTGGG - Intronic
1113020860 13:105885670-105885692 CCCATTTAACAAATGGTGCTGGG - Intergenic
1113173678 13:107535985-107536007 CTTATTTAATAAATGGTGCTGGG + Intronic
1113348358 13:109503544-109503566 CCTAATTAATAAATGGTGCTGGG - Intergenic
1113544240 13:111135032-111135054 CCTATTTAACAAATGGTGCTGGG - Intronic
1114358180 14:21938338-21938360 CTCATTCAACAAATGGTGCTGGG - Intergenic
1114432456 14:22673279-22673301 CCTATTTAACAAATGGTGCTGGG - Intergenic
1114433428 14:22682707-22682729 CCTATTTAACAAATGGTGCTGGG + Intergenic
1114973881 14:28069595-28069617 CTCAATTAACAACTGCAGAATGG + Intergenic
1115065162 14:29250900-29250922 CCCTATTAATAAATGGTGCTGGG + Intergenic
1115067687 14:29284664-29284686 CCTATTTAACAAATGGTGCTGGG + Intergenic
1115185737 14:30686044-30686066 CCTAATTAATAAATGGTGCTGGG - Intronic
1115264752 14:31489526-31489548 CTCAATTAAAAAAAGGAATTTGG + Intergenic
1115392834 14:32872825-32872847 CTTATTCAACAAATGGTGCTGGG - Intergenic
1115443997 14:33468351-33468373 TTCTGTTAACACATGGAGCTTGG - Intronic
1115578870 14:34738458-34738480 CTTATTTAATAAATGGTGCTGGG - Intergenic
1115869295 14:37781859-37781881 CCCACTTAATAAATGGTGCTGGG - Intronic
1116112655 14:40606553-40606575 CCCATTTAATAAATGGTGCTGGG + Intergenic
1116117827 14:40679794-40679816 CCTATTTAACAAATGGTGCTGGG - Intergenic
1116168936 14:41372632-41372654 CCTATTTAACAAATGGTGCTGGG + Intergenic
1116476878 14:45350419-45350441 CTTATTTAATAAATGGTGCTGGG - Intergenic
1116483203 14:45416306-45416328 CCTATTTAACAAATGGTGCTGGG + Intergenic
1116705253 14:48287717-48287739 CTTATTTAATAAATGGTGCTGGG + Intergenic
1116720117 14:48485243-48485265 CCCTATTAATAAATGGTGCTGGG + Intergenic
1116872184 14:50078747-50078769 CCTATTTAACAAATGGTGCTGGG + Intergenic
1116943566 14:50814799-50814821 CCTATTTAACAAATGGTGCTGGG + Intronic
1117079731 14:52139300-52139322 CCTATTTAACAAATGGTGCTGGG + Intergenic
1117087120 14:52213040-52213062 CCTATTTAACAAATGGTGCTGGG + Intergenic
1117173092 14:53120706-53120728 CTTATTTAATAAATGGTGCTGGG + Intronic
1117415733 14:55493743-55493765 CCTAATTAATAAATGGTGCTGGG - Intergenic
1117628854 14:57668563-57668585 CCTATTTAACAAATGGTGCTGGG - Intronic
1117655004 14:57946358-57946380 CCCAATTAACAAAAAGTGCTGGG - Intronic
1117664701 14:58044373-58044395 CCTATTTAACAAATGGTGCTGGG + Intronic
1117697433 14:58379900-58379922 CCCATTCAACAAATGGTGCTAGG - Intergenic
1117751466 14:58928582-58928604 CCCTATTAATAAATGGTGCTGGG + Intergenic
1117890154 14:60412223-60412245 CTTATTCAACAAATGGTGCTGGG - Intronic
1118510345 14:66465042-66465064 CCCAGTTAACAAAAGTAGCTAGG + Intergenic
1118926525 14:70195221-70195243 CTCATTTAATAGATGGTGCTGGG - Intergenic
1118931171 14:70242359-70242381 CTCATTTAATAAATGGTGTTGGG - Intergenic
1119683272 14:76609020-76609042 CCTATTTAACAAATGGTGCTGGG - Intergenic
1120001665 14:79310165-79310187 CCTATTTAACAAATGGTGCTGGG - Intronic
1120630046 14:86879575-86879597 CCTATTTAACAAATGGTGCTGGG - Intergenic
1120709318 14:87776691-87776713 CCTATTTAACAAATGGTGCTGGG - Intergenic
1121299333 14:92857721-92857743 CCCTATTAATAAATGGTGCTGGG + Intergenic
1121860833 14:97316590-97316612 CTCAATTAGCAAATCGGGTTAGG + Intergenic
1121913791 14:97817558-97817580 CCTATTTAACAAATGGTGCTGGG + Intergenic
1122577872 14:102753011-102753033 CCCACTCAACAAATGCAGCTCGG + Intergenic
1202887808 14_KI270722v1_random:124539-124561 CCTATTTAACAAATGGTGCTGGG + Intergenic
1124668825 15:31619007-31619029 CCTATTTAACAAATGGTGCTGGG - Intronic
1124674406 15:31671304-31671326 CTTATTTAATAAATGGTGCTGGG - Intronic
1124682848 15:31750835-31750857 CTTATTCAACAAATGGTGCTGGG + Intronic
1125055350 15:35353512-35353534 CCTATTTAACAAATGGTGCTGGG - Intronic
1125286649 15:38100329-38100351 CCCTATTAATAAATGGTGCTGGG + Intergenic
1126372046 15:47957726-47957748 CTCATTCAATAAATGGTGCTGGG - Intergenic
1126566317 15:50103990-50104012 CCAATTTAACAAATGGTGCTGGG + Intronic
1126715387 15:51510951-51510973 CCTATTTAACAAATGGTGCTAGG + Intronic
1126722452 15:51595828-51595850 CTTATTTAATAAATGGTGCTGGG + Intronic
1126856256 15:52842329-52842351 CCTATTTAACAAATGGTGCTGGG + Intergenic
1126919144 15:53501253-53501275 CTTATTTAACAAATGGTACTGGG - Intergenic
1127022050 15:54759251-54759273 CTCATTCAATAAATGGTGCTGGG + Intergenic
1127022352 15:54762240-54762262 CCTATTTAACAAATGGTGCTGGG + Intergenic
1127226540 15:56936711-56936733 CCCATTCAACAAATGGTGCTGGG - Intronic
1127527515 15:59808244-59808266 CCCACTTAATAAATGGTGCTGGG + Intergenic
1127749311 15:62017518-62017540 CCTATTTAACAAATGGTGCTGGG - Intronic
1127838815 15:62812270-62812292 TTCAACTAAGAAATGGAACTGGG - Intronic
1130230002 15:82089478-82089500 CTCAAAAAATAAATGGAGGTTGG + Intergenic
1130366590 15:83245831-83245853 CTTATTCAACAAATGGTGCTGGG - Intergenic
1130453102 15:84077294-84077316 CCCATTTAAGAAATGGTGCTGGG + Intergenic
1130848208 15:87767335-87767357 GTGAATTAAGAAATGAAGCTTGG - Intergenic
1130959530 15:88650494-88650516 CCCAGTTATCAAATGGTGCTTGG + Intronic
1131719811 15:95155644-95155666 CCTATTTAACAAATGGTGCTGGG - Intergenic
1131814189 15:96205337-96205359 CCTATTTAACAAATGGTGCTGGG + Intergenic
1131834892 15:96380709-96380731 CCTATTTAACAAATGGTGCTGGG - Intergenic
1131866462 15:96716371-96716393 CTCAATTAACATGTCCAGCTGGG + Intergenic
1132188708 15:99829188-99829210 CCTATTTAACAAATGGTGCTCGG - Intergenic
1132277185 15:100577932-100577954 CCTATTTAACAAATGGTGCTGGG + Intronic
1132412501 15:101593764-101593786 CTCATTCAACAAATGGTGCTGGG - Intergenic
1133148730 16:3810361-3810383 CTCCATCAACAAAAGGAGCCTGG + Intronic
1133642273 16:7728661-7728683 CCCATTTAATAAATGGTGCTGGG + Intergenic
1133859993 16:9585725-9585747 CCTATTTAACAAATGGTGCTGGG - Intergenic
1133938266 16:10285903-10285925 CTCAACCAAAAAAGGGAGCTGGG - Intergenic
1134255588 16:12608559-12608581 CCCATTTAATAAATGGTGCTGGG + Intergenic
1135600373 16:23778095-23778117 CCTATTTAACAAATGGTGCTGGG - Intergenic
1137062994 16:35809258-35809280 CTCAGTTGACAACTGGAGCTAGG + Intergenic
1137326473 16:47442659-47442681 CCCATTTAATAAATGGTGCTGGG + Intronic
1137416070 16:48281414-48281436 CTTAATTAATAAATGGTGGTAGG + Intronic
1137470769 16:48755729-48755751 CCTATTTAACAAATGGTGCTGGG + Intergenic
1137972395 16:52999065-52999087 CTTATTTAATAAATGGTGCTGGG + Intergenic
1138035769 16:53604423-53604445 CTAACTTAACAAATGGGACTAGG + Intronic
1138321033 16:56111972-56111994 CTCATTTAACAAATGAAATTGGG - Intergenic
1138752746 16:59443637-59443659 CCTATTTAACAAATGGTGCTGGG + Intergenic
1138762389 16:59560526-59560548 CCTATTTAACAAATGGTGCTGGG - Intergenic
1139131887 16:64156647-64156669 CCTATTTAACAAATGGTGCTGGG + Intergenic
1139770579 16:69272594-69272616 CCCAATTAAGAAATGGGGCTGGG + Intronic
1139982802 16:70873126-70873148 CTCACCAAACAAATGGAGTTGGG - Intronic
1140569606 16:76087992-76088014 CCTATTTAACAAATGGTGCTGGG - Intergenic
1141037981 16:80644897-80644919 CCCATTTAATAAATGGTGCTGGG + Intronic
1141730380 16:85818785-85818807 CCTATTTAACAAATGGTGCTGGG + Intergenic
1142938542 17:3360650-3360672 CCTATTTAACAAATGGTGCTGGG - Intergenic
1143234891 17:5391090-5391112 CACAGGTAACAAATAGAGCTGGG - Intronic
1143737932 17:8926920-8926942 ATAAATTAAAAAATGGTGCTGGG + Intronic
1146092500 17:29893862-29893884 CTTAAATAACAAATTGAGTTGGG + Intronic
1146542537 17:33710048-33710070 CTCCATCAACCTATGGAGCTTGG - Intronic
1146571892 17:33960063-33960085 CTAAACCAACAACTGGAGCTAGG - Intronic
1146829204 17:36053095-36053117 CTTAATCAATAAATGGTGCTTGG + Intergenic
1147461473 17:40573495-40573517 CTTATTTAATAAATGGTGCTGGG + Intergenic
1149366280 17:55948202-55948224 CCTATTTAACAAATGGTGCTGGG - Intergenic
1150024932 17:61664329-61664351 CTTATTTAACAAATGGTGTTGGG - Intergenic
1150195996 17:63300015-63300037 CTTATTTAATAAATGGTGCTGGG - Intronic
1150531330 17:65985520-65985542 CTCCATGAACAAATGGTGCCAGG + Intronic
1150876818 17:68979692-68979714 CTTATTTAATAAATGGTGCTGGG + Intronic
1150902647 17:69298604-69298626 CCTATTTAACAAATGGTGCTGGG + Intronic
1150973630 17:70058948-70058970 GTTAATGAACAAATGAAGCTGGG + Intronic
1151052984 17:71000422-71000444 CTCAATGGACAACTGGGGCTTGG - Intergenic
1151284801 17:73102657-73102679 CCTATTTAACAAATGGTGCTGGG - Intergenic
1152212168 17:79008555-79008577 ATAAAATAAGAAATGGAGCTGGG + Intronic
1203162659 17_GL000205v2_random:64953-64975 CTTATTTAATAAATGGTGCTGGG - Intergenic
1153165305 18:2254953-2254975 CCCATTCAACAAATGGGGCTGGG + Intergenic
1153360224 18:4186508-4186530 CTTATTTAACAAATGGCGTTGGG - Intronic
1153418739 18:4880662-4880684 CCTATTTAACAAATGGTGCTGGG + Intergenic
1153420274 18:4897478-4897500 CCTATTTAACAAATGGTGCTGGG + Intergenic
1153425490 18:4958756-4958778 CTTATTTAACAAATGGTGCTGGG + Intergenic
1153548360 18:6234074-6234096 CCCATTTAATAAATGGTGCTGGG + Intronic
1154216987 18:12422708-12422730 CTCAATTAAAAAATGTATATTGG + Intronic
1154320880 18:13350862-13350884 CCTATTTAATAAATGGAGCTGGG - Intronic
1155111646 18:22721400-22721422 CCCATTTAATAAATGGTGCTGGG + Intergenic
1155478524 18:26260514-26260536 CCTATTTAACAAATGGTGCTGGG - Intronic
1156004502 18:32423836-32423858 GTCTATTAAGAAATGGAGCTGGG + Intronic
1156178778 18:34578699-34578721 CCTATTTAACAAATGGTGCTGGG - Intronic
1156186203 18:34666654-34666676 CCTATTTAACAAATGGTGCTAGG - Intronic
1156667881 18:39430176-39430198 CTTATTCAACAAATGGTGCTGGG + Intergenic
1156734056 18:40231049-40231071 CCTATTTAACAAATGGTGCTGGG - Intergenic
1156780703 18:40847012-40847034 CCTATTTAACAAATGGTGCTGGG + Intergenic
1156887233 18:42149569-42149591 CCTATTTAACAAATGGTGCTGGG - Intergenic
1157074176 18:44446912-44446934 CCTATTTAACAAATGGTGCTGGG + Intergenic
1157206793 18:45707479-45707501 CTCAAAAAAAAAAAGGAGCTGGG + Intergenic
1157466698 18:47953536-47953558 CTCAATGCACAGATGGTGCTGGG - Intergenic
1158114037 18:53974993-53975015 CCTATTTAACAAATGGTGCTGGG - Intergenic
1158229122 18:55234127-55234149 TGCATTTAAAAAATGGAGCTTGG - Intronic
1158251987 18:55499501-55499523 CTACATAAACAGATGGAGCTAGG - Intronic
1158365135 18:56725887-56725909 CCTATTTAACAAATGGTGCTGGG - Intronic
1158704148 18:59776214-59776236 CTTATTTAATAAATGGTGCTGGG + Intergenic
1159227262 18:65555636-65555658 CCTATTTAACAAATGGTGCTGGG - Intergenic
1159294190 18:66460859-66460881 CTCACTTCAAAAATGGTGCTGGG - Intergenic
1159313359 18:66738460-66738482 CCCATTTAATAAATGGTGCTGGG - Intergenic
1164094162 19:21990316-21990338 CTTATTTAATAAATGGTGCTGGG - Intronic
1164195529 19:22954422-22954444 CTTATTTAATAAATGGTGCTGGG + Intergenic
1164357698 19:27461342-27461364 CTTATTTAATAAATGGTGCTGGG - Intergenic
1164367115 19:27597603-27597625 CTTATTTAATAAATGGTGCTGGG - Intergenic
1164913281 19:32029271-32029293 CTCAACTACCAAACAGAGCTGGG + Intergenic
1164967996 19:32502561-32502583 TTCAAATAACAATTGAAGCTGGG - Intergenic
1165338826 19:35195530-35195552 CTCAATAACAAAATGGAGATGGG - Intergenic
1165588424 19:36943311-36943333 CTCAATAAAATAATGGATCTAGG - Intronic
1165616035 19:37201409-37201431 CTACTTTATCAAATGGAGCTGGG - Intronic
1165646775 19:37446209-37446231 CCTATTTAACAAATGGTGCTGGG + Intronic
1167202915 19:48079430-48079452 CTTATTCAACAAATGGTGCTGGG + Intronic
1167903591 19:52640024-52640046 CTCCATTACCAAATAGAGCCAGG - Intronic
1202663211 1_KI270708v1_random:91377-91399 CCTATTTAACAAATGGTGCTGGG + Intergenic
1202670776 1_KI270709v1_random:48683-48705 CCCATTTAATAAATGGTGCTGGG + Intergenic
924971244 2:129002-129024 CTCATTCAATAAATGGTGCTAGG - Intergenic
925215674 2:2093923-2093945 CCTATTTAACAAATGGTGCTGGG - Intronic
925441658 2:3892615-3892637 CTTATTCAACAAATGGTGCTGGG - Intergenic
926319263 2:11737142-11737164 CCCTATTAATAAATGGTGCTGGG + Intronic
926649020 2:15321153-15321175 CTTATTTAACAAATGGTGCTTGG + Intronic
927230538 2:20820523-20820545 CCTACTTAACAAATGGTGCTGGG + Intronic
927284337 2:21340813-21340835 CCTATTTAACAAATGGTGCTGGG + Intergenic
927301609 2:21522226-21522248 CCTATTTAACAAATGGTGCTGGG - Intergenic
928463137 2:31494494-31494516 CCTATTTAACAAATGGTGCTGGG + Intergenic
928581780 2:32715305-32715327 CTTATTCAACAAATGGTGCTGGG - Intronic
928766693 2:34654871-34654893 CTTATTTAACAAATGGTGCTGGG + Intergenic
928825386 2:35414294-35414316 CCTATTTAACAAATGGTGCTGGG - Intergenic
928878148 2:36065428-36065450 CTTATTTAATAAATGGTGCTGGG + Intergenic
928882504 2:36113741-36113763 CCTATTTAACAAATGGTGCTGGG - Intergenic
929025302 2:37595414-37595436 CCTATTTAACAAATGGTGCTGGG - Intergenic
929039313 2:37728037-37728059 CTTATTTAACAAATGGTGCTGGG + Intronic
929232740 2:39576250-39576272 CCTATTTAACAAATGGTGCTGGG - Intergenic
929456073 2:42066852-42066874 CCTATTTAACAAATGGCGCTGGG - Intergenic
929873819 2:45779527-45779549 CTCAGTTCACAAATGGAGCAAGG - Intronic
930568086 2:53048567-53048589 CTCGTTTAATAAATGGTGCTGGG + Intergenic
930658670 2:54032358-54032380 CCTATTTAACAAATGGTGCTAGG - Intronic
930973360 2:57423474-57423496 CTTATTTAATAAATGGTGCTGGG + Intergenic
930976441 2:57467711-57467733 CTCATTCAATAAATGGTGCTAGG - Intergenic
931215296 2:60236562-60236584 CCCATTTAATAAATGGTGCTGGG - Intergenic
931369093 2:61645497-61645519 CTCAATTTTAAAATGGGGCTGGG + Intergenic
931475374 2:62582117-62582139 CTTATTTAACAAGTGGTGCTTGG - Intergenic
931773755 2:65522214-65522236 GACATTCAACAAATGGAGCTGGG - Intergenic
931886026 2:66618334-66618356 CCTATTTAACAAATGGTGCTGGG - Intergenic
932509025 2:72266487-72266509 CCTATTTAACAAATGGTGCTGGG - Intronic
932517669 2:72369770-72369792 CCTATTTAACAAATGGTGCTGGG + Intronic
932841090 2:75083158-75083180 CCTATTTAACAAATGGTGCTGGG - Intronic
932925836 2:75973332-75973354 CCTAATCAACAAATGGTGCTGGG + Intergenic
932951612 2:76300635-76300657 CCTATTTAACAAATGGTGCTGGG - Intergenic
932955460 2:76346399-76346421 CCTATTTAACAAATGGTGCTGGG - Intergenic
933017002 2:77140383-77140405 CCTAATTAATAAATGGTGCTGGG + Intronic
933085999 2:78054622-78054644 CCCATTCAACAAATGGTGCTGGG - Intergenic
933300773 2:80538457-80538479 CCCATTTAATAAATGGTGCTGGG - Intronic
933340610 2:81021183-81021205 TTCAATAAACAAATGGTGCTTGG - Intergenic
933381787 2:81557569-81557591 CCTATTTAACAAATGGTGCTGGG - Intergenic
934115977 2:88793934-88793956 CTTATTTAATAAATGGTGCTGGG + Intergenic
934481164 2:94646355-94646377 CCTATTTAACAAATGGTGCTGGG - Intergenic
934511802 2:94950657-94950679 CTTATTTAATAAATGGTGCTGGG - Intergenic
935001095 2:99016404-99016426 CTTATTCAACAAATGGTGCTGGG + Intronic
935007505 2:99094161-99094183 CTTATTCAACAAATGGTGCTGGG + Intronic
935345590 2:102104697-102104719 CTGAATTAACAACTCTAGCTAGG + Intronic
935397805 2:102626330-102626352 CCTATTTAACAAATGGTGCTGGG + Intronic
935925396 2:108063503-108063525 CCTATTTAACAAATGGTGCTGGG - Intergenic
936545867 2:113392735-113392757 CCTATTTAACAAATGGTGCTGGG - Intergenic
936781493 2:116038427-116038449 CCTATTTAATAAATGGAGCTGGG + Intergenic
936782409 2:116050176-116050198 CCTATTTAATAAATGGAGCTGGG - Intergenic
936860047 2:117006027-117006049 CTTATTTAACAAATGGTGCTGGG + Intergenic
937026603 2:118703682-118703704 CCTATTTAACAAATGGTGCTGGG + Intergenic
937507684 2:122555571-122555593 CCTATTTAACAAATGGTGCTGGG + Intergenic
937741692 2:125362258-125362280 CCTATTTAACAAATGGTGCTGGG + Intergenic
937801768 2:126088972-126088994 CCTATTTAACAAATGGTGCTGGG + Intergenic
937809030 2:126179282-126179304 CCTATTTAACAAATGGTGCTGGG - Intergenic
938404402 2:131021388-131021410 CCCATTTAATAAATGGTGCTGGG + Intronic
938409194 2:131049847-131049869 GTCAATTAAGAAATAGAACTTGG - Exonic
938809375 2:134838453-134838475 CTTGATTAACAAATAAAGCTTGG + Intergenic
939179732 2:138790129-138790151 CTTATTTAACAAATGGTGCTGGG - Intergenic
939455648 2:142431539-142431561 CCTATTTAACAAATGGTGCTGGG + Intergenic
939759100 2:146152359-146152381 CTTATTTAACAAATGGTGCTGGG - Intergenic
939923397 2:148144680-148144702 CTTATTTAATAAATGGTGCTGGG - Intronic
940435403 2:153647698-153647720 CCTATTTAACAAATGGTGCTGGG - Intergenic
940623306 2:156141605-156141627 CCTACTTAACAAATGGTGCTGGG + Intergenic
941503433 2:166310009-166310031 CCTATTTAACAAATGGTGCTGGG + Intronic
941535352 2:166715971-166715993 CCTATTTAACAAATGGTGCTGGG + Intergenic
941895376 2:170623806-170623828 CCTATTTAACAAATGGTGCTGGG - Intronic
942341582 2:174954202-174954224 CTAATTCAACAAATGGTGCTGGG + Intronic
942790266 2:179753166-179753188 CCTATTTAACAAATGGTGCTGGG - Intronic
942984229 2:182120139-182120161 CTTATTTAATAAATGGTGCTGGG - Intronic
943136061 2:183914377-183914399 CTTATTTAATAAATGGTGCTGGG - Intergenic
943499563 2:188670100-188670122 CCTATTTAACAAATGGTGCTGGG + Intergenic
943580551 2:189678656-189678678 CTTATTCAACAAATGGTGCTGGG - Intronic
943610444 2:190027148-190027170 CTCTTTTAACAAATGGTGTTGGG - Intronic
943766809 2:191671963-191671985 CCTATTTAACAAATGGTGCTGGG + Intergenic
944072800 2:195692082-195692104 CCTATTTAACAAATGGTGCTGGG - Intronic
944301899 2:198133061-198133083 CCTATTTAACAAATGGTGCTGGG - Intronic
944375187 2:199033357-199033379 CCTATTTAACAAATGGTGCTCGG + Intergenic
944600158 2:201295419-201295441 CTTATTTAATAAATGGTGCTTGG + Intronic
944602514 2:201318004-201318026 CTTATTCAACAAATGGTGCTGGG + Intronic
945210530 2:207377698-207377720 CCTATTTAATAAATGGAGCTGGG - Intergenic
945378148 2:209104128-209104150 CCTATTTAACAAATGGAGCTGGG + Intergenic
945387395 2:209219162-209219184 CCTATTCAACAAATGGAGCTGGG + Intergenic
945556500 2:211282583-211282605 CTCATTTAAGCAGTGGAGCTGGG + Intergenic
945563177 2:211363482-211363504 CTCATTTAGTAAATGGTGCTGGG + Intergenic
945998399 2:216459593-216459615 CCTATTTAACAAATGGTGCTGGG + Intronic
946106876 2:217378455-217378477 CCTATTTAACAAATGGTGCTGGG + Intronic
946636119 2:221729227-221729249 CTTATTTAATAAATGGTGCTGGG + Intergenic
946719502 2:222589271-222589293 CCTATTTAACAAATGGCGCTGGG + Intronic
946739116 2:222784737-222784759 CTCTTTGAACAAATGGATCTAGG - Intergenic
946795220 2:223344009-223344031 CCTATTTAACAAATGGTGCTGGG - Intergenic
947002595 2:225474042-225474064 CTTATTTAACAAATGGTGCTGGG - Intronic
947241787 2:228002800-228002822 CCTATTTAACAAATGGTGCTGGG - Intronic
947261336 2:228226420-228226442 CTCCAATGACAAATGGATCTAGG + Intergenic
947320305 2:228909913-228909935 CCTATTTAACAAATGGTGCTGGG - Intronic
947323378 2:228947737-228947759 CCTATTTAACAAATGGTGCTGGG + Intronic
947424038 2:229966613-229966635 CCTATTTAACAAATGGTGCTGGG - Intronic
947891259 2:233622958-233622980 CTTATTTAATAAATGGTGCTGGG - Intronic
947902410 2:233732538-233732560 CTTATTTAATAAATGGTGCTGGG - Intronic
948367025 2:237462920-237462942 CCTATTTAACAAATGGTGCTGGG + Intergenic
948713121 2:239837886-239837908 CCTATTTAACAAATGGTGCTGGG + Intergenic
948746694 2:240101131-240101153 CCTATTTAATAAATGGAGCTGGG + Intergenic
1169096341 20:2902373-2902395 CTCAATTAAGAAAGGGAGTAGGG - Intronic
1169175873 20:3513341-3513363 CCTATTTAACAAATGGTGCTGGG - Intronic
1169738659 20:8866048-8866070 ATCTATTAACAAAAGGATCTGGG + Intronic
1169841557 20:9943550-9943572 CTCATTTAAAAAAAGAAGCTGGG - Intergenic
1170050282 20:12135521-12135543 CCTATTTAACAAATGGTGCTGGG - Intergenic
1170435695 20:16326057-16326079 CTTATTCAACAAATGGGGCTGGG + Intronic
1171076694 20:22134084-22134106 CTTATTTAATAAATGGTGCTGGG + Intergenic
1171098540 20:22358060-22358082 CCTAATTAATAAATGGTGCTGGG + Intergenic
1171525786 20:25809555-25809577 CCTATTTAACAAATGGTGCTGGG + Intronic
1171551041 20:26046329-26046351 CCTATTTAACAAATGGTGCTGGG - Intergenic
1171912021 20:30971686-30971708 CCTATTTAACAAATGGTGCTGGG - Intergenic
1173437392 20:43045344-43045366 CTCAATAAACAAATAAAGATTGG - Intronic
1173568776 20:44062898-44062920 CTTATTCAACAAATGGTGCTTGG + Intronic
1174877455 20:54242904-54242926 CCTATTTAACAAATGGTGCTGGG + Intergenic
1175848328 20:62071312-62071334 CCTATTTAACAAATGGTGCTGGG + Intergenic
1177022571 21:15881602-15881624 CTTATTTAATAAATGGTGCTAGG - Intergenic
1177202450 21:17973050-17973072 CTTATTTAATAAATGGTGCTGGG + Intronic
1177266275 21:18788757-18788779 CCTATTTAACAAATGGTGCTGGG - Intergenic
1177309939 21:19376920-19376942 CCTATTTAACAAATGGTGCTGGG + Intergenic
1177341989 21:19815455-19815477 CCTATTTAACAAATGGTGCTGGG + Intergenic
1177367716 21:20158818-20158840 CTTATTTAATAAATGGTGCTGGG - Intergenic
1177370810 21:20200737-20200759 CCTATTTAACAAATGGTGCTGGG - Intergenic
1177384589 21:20392272-20392294 CCTATTTAACAAATGGTGCTGGG - Intergenic
1178219515 21:30640308-30640330 CCCATTTAATAAATGGTGCTAGG - Intergenic
1178772191 21:35515899-35515921 CTTATTTAATAAATGGTGCTGGG + Intronic
1178904013 21:36621425-36621447 CACATTTAACAAAAGGTGCTGGG + Intergenic
1178946462 21:36952320-36952342 CTAATTTATAAAATGGAGCTCGG + Intronic
1178964859 21:37106932-37106954 CTCTTTTAATAAATGGTGCTGGG - Intronic
1179083751 21:38198025-38198047 TTTATTTAACAAATGGTGCTGGG - Intronic
1180006630 21:45025528-45025550 CCTATTTAACAAATGGTGCTGGG - Intergenic
1180329950 22:11468262-11468284 CCTATTTAACAAATGGTGCTGGG + Intergenic
1180640490 22:17294530-17294552 CCTATTTAACAAATGGTGCTGGG - Intergenic
1181342381 22:22192725-22192747 CATATTTAACAAATGGTGCTGGG + Intergenic
1182025400 22:27114401-27114423 CTTCATTAAAAAGTGGAGCTGGG + Intergenic
1182714521 22:32346612-32346634 CTTATTTAATAAATGGTGCTGGG + Intergenic
1182968696 22:34550916-34550938 CCTATTTAACAAATGGTGCTGGG - Intergenic
1182980305 22:34664123-34664145 ATCATTTAACAAATGGTGCTGGG + Intergenic
1182993736 22:34793594-34793616 CCTATTTAACAAATGGTGCTGGG + Intergenic
1182996890 22:34821687-34821709 CCTATTTAACAAATGGTGCTGGG + Intergenic
1183452242 22:37903236-37903258 ATCAATTAAGAAATGGGGCCAGG - Intergenic
1183942786 22:41305538-41305560 CTGAATTAGCAAATGAAACTGGG + Intronic
1184905737 22:47485193-47485215 CTCAATTAGCTGATGGATCTAGG - Intronic
1185240703 22:49743421-49743443 CCTATTTAACAAATGGTGCTGGG + Intergenic
949225306 3:1686550-1686572 CTTATTTAATAAATGGTGCTGGG + Intergenic
949423968 3:3896191-3896213 CTTATTTAATAAATGGTGCTGGG - Intronic
949427632 3:3936439-3936461 CTCTATTAATAAATGGTCCTGGG - Intronic
949532550 3:4970662-4970684 CTTATTTAATAAATGGTGCTGGG + Intergenic
949599916 3:5586563-5586585 CCTATTTAACAAATGGTGCTGGG + Intergenic
949672064 3:6410271-6410293 CCTATTTAACAAATGGTGCTGGG + Intergenic
950137707 3:10593472-10593494 CCTACTTAACAAATGGTGCTGGG + Intronic
950815631 3:15699149-15699171 CTTATTTAATAAATGGTGCTGGG + Intronic
950841413 3:15971740-15971762 CCCATTCAACAAATGGTGCTGGG + Intergenic
951052471 3:18109806-18109828 CCTATTTAACAAATGGTGCTGGG + Intronic
951161666 3:19430199-19430221 CTTATTTAATAAATGGTGCTGGG - Intronic
951172518 3:19558237-19558259 CCTATTTAACAAATGGTGCTGGG - Intergenic
951182719 3:19677912-19677934 CCCATTTAATAAATGGTGCTGGG - Intergenic
951189581 3:19752669-19752691 CCTATTTAACAAATGGTGCTGGG + Intergenic
951302316 3:21013105-21013127 CTTATTCAACAAATGGTGCTGGG - Intergenic
951393692 3:22138575-22138597 CTTATTTAATAAATGGTGCTGGG + Intronic
951749890 3:26023044-26023066 CTTATTCAACAAATGGTGCTGGG - Intergenic
951849038 3:27118050-27118072 CTTATTTAATAAATGGTGCTGGG - Intronic
952048807 3:29358278-29358300 CCTATTTAACAAATGGTGCTGGG - Intronic
952493237 3:33892312-33892334 ATAAATTAATAAATGGTGCTGGG - Intergenic
952572754 3:34736759-34736781 CCTATTTAACAAATGGTGCTGGG + Intergenic
952692528 3:36226612-36226634 CCTATTTAACAAATGGTGCTGGG + Intergenic
952747908 3:36799171-36799193 CCTATTTAACAAATGGTGCTGGG - Intergenic
952926478 3:38323871-38323893 CTCAATACAAAAATGGGGCTAGG - Intergenic
953142266 3:40240140-40240162 CTTATTTAATAAATGGTGCTGGG - Intronic
953265966 3:41388607-41388629 CCTATTTAACAAATGGTGCTGGG - Intronic
953275765 3:41495336-41495358 CCTATTTAACAAATGGTGCTGGG + Intronic
953297690 3:41736925-41736947 CCCATTTAATAAATGGTGCTGGG - Intronic
953380912 3:42472457-42472479 TTCAATTAAGAATTCGAGCTGGG - Intergenic
953834395 3:46330365-46330387 CTCAATTTAATAAGGGAGCTGGG + Intergenic
954835123 3:53459908-53459930 CCTATTTAACAAATGGTGCTGGG - Intergenic
955121752 3:56066781-56066803 CTTATTTAATAAATGGTGCTGGG - Intronic
955361225 3:58276847-58276869 CCTATTTAACAAATGGTGCTGGG - Intronic
955440577 3:58950669-58950691 CCTATTTAACAAATGGTGCTGGG + Intronic
955504584 3:59618710-59618732 CCTATTTAACAAATGGTGCTGGG + Intergenic
955582764 3:60442505-60442527 CCTATTTAACAAATGGTGCTGGG - Intronic
955591291 3:60538699-60538721 CTTATTTAACAAATGGTACTGGG + Intronic
955616667 3:60815469-60815491 CTTATTTAATAAATGGCGCTGGG - Intronic
955704468 3:61713834-61713856 GTCTATTAACAAATGGAAATGGG - Intronic
956328322 3:68077541-68077563 CTTATTTAATAAATGGTGCTGGG - Intronic
956354974 3:68381002-68381024 CTTATTTAATAAATGGTGCTGGG - Intronic
956375205 3:68606957-68606979 CTTATTTAATAAATGGTGCTGGG + Intergenic
956461417 3:69476436-69476458 CTTATTTAATAAATGGTGCTGGG - Intronic
956512331 3:70007879-70007901 CCCATTTAACAAATGGTGCTGGG - Intergenic
956619425 3:71206041-71206063 CTTATTAAACAAATGGAGCTGGG - Intronic
956717196 3:72088748-72088770 CTCACTTCCCAAATGGTGCTGGG - Intergenic
956829735 3:73034460-73034482 CATAGTTATCAAATGGAGCTAGG - Intronic
957463868 3:80559804-80559826 CCCATTTAACAAATCGTGCTGGG - Intergenic
957599043 3:82308477-82308499 CCTATTTAACAAATGGTGCTGGG + Intergenic
957631402 3:82720714-82720736 CCCTATTAATAAATGGTGCTGGG - Intergenic
957644657 3:82905675-82905697 CCCATTTAATAAATGGTGCTGGG - Intergenic
957750137 3:84404307-84404329 CCTATTTAACAAATGGTGCTGGG - Intergenic
957857103 3:85893254-85893276 CTTATTTAATAAATGGTGCTAGG + Intronic
958133729 3:89462060-89462082 CTTATTTAATAAATGGTGCTGGG - Intronic
958184726 3:90106217-90106239 CCTATTTAACAAATGGTGCTGGG - Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958563585 3:95779534-95779556 CCTATTTAACAAATGGTGCTGGG + Intergenic
958706718 3:97665227-97665249 CCTATTTAACAAATGGTGCTGGG + Intronic
958970112 3:100601645-100601667 ATCAATTAACAGCTGTAGCTGGG - Intergenic
959034534 3:101345677-101345699 CTTATTCAACAAATGGTGCTGGG + Intronic
959152439 3:102623309-102623331 CCTATTTAACAAATGGTGCTGGG + Intergenic
959180155 3:102968947-102968969 CTTATTTAATAAATGGTGCTGGG - Intergenic
959222863 3:103543723-103543745 CTTATTTAATAAATGGTGCTGGG - Intergenic
959259035 3:104051461-104051483 CTTATTTAATAAATGGTGCTTGG + Intergenic
959352351 3:105281648-105281670 CTCAATTACCAAGTGGAAATTGG + Intergenic
959360943 3:105390827-105390849 CTTATTTAATAAATGGTGCTGGG - Intronic
959408842 3:105995866-105995888 CTTATTTAATAAATGGTGCTGGG + Intergenic
959535413 3:107479423-107479445 TACATTTAACAAATGGTGCTGGG + Intergenic
959556414 3:107724640-107724662 CCTATTTAACAAATGGTGCTGGG - Intronic
959726077 3:109543075-109543097 CCTAATTAATAAATGGTGCTGGG + Intergenic
959767912 3:110055294-110055316 CACAATCAATAAATGGTGCTAGG + Intergenic
959844460 3:111017430-111017452 ACCATTTAACAAATGGTGCTGGG + Intergenic
959878164 3:111411340-111411362 CCTAATCAACAAATGGTGCTGGG + Intronic
960233961 3:115259870-115259892 CCTATTTAACAAATGGTGCTGGG + Intergenic
960264775 3:115608030-115608052 CCTATTTAACAAATGGTGCTGGG - Intergenic
960265156 3:115613115-115613137 GACAGTTAACAAATGGGGCTGGG + Intergenic
960318329 3:116204634-116204656 CCTAATTAATAAATGGTGCTGGG - Intronic
960332049 3:116372325-116372347 CAGTATTAACAAATGGTGCTGGG + Intronic
960363905 3:116747748-116747770 CCTATTTAACAAATGGTGCTGGG + Intronic
960414286 3:117365298-117365320 CTCACTTAAAAAATGAAGATTGG - Intergenic
960422966 3:117471029-117471051 CTTATTTAACAAATTTAGCTAGG + Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960681656 3:120254212-120254234 CCTATTTAACAAATGGCGCTAGG + Intronic
960730808 3:120724708-120724730 CCTAATTAATAAATGGTGCTGGG + Intronic
960750721 3:120949648-120949670 CCTATTTAACAAATGGTGCTGGG - Intronic
960756849 3:121023637-121023659 CCTATTTAACAAATGGTGCTGGG + Intronic
960896225 3:122508577-122508599 CTCATTTTAGAAAAGGAGCTTGG - Intronic
961395665 3:126587223-126587245 CTTATTTAATAAATGGTGCTGGG - Intronic
962239428 3:133739223-133739245 CGCATTTAATAAATGGTGCTAGG + Intergenic
962427398 3:135283519-135283541 CTTATTTAATAAATGGTGCTGGG + Intergenic
962460606 3:135608901-135608923 CTTATTTAATAAATGGTGCTGGG + Intergenic
962612835 3:137095120-137095142 CCTATTTAACAAATGGTGCTGGG - Intergenic
962656415 3:137548539-137548561 CTTATTTAATAAATGGTGCTGGG + Intergenic
962691306 3:137901504-137901526 CCTATTTAACAAATGGTGCTGGG + Intergenic
962699660 3:137984711-137984733 CCTATTTAACAAATGGTGCTGGG + Intergenic
963159531 3:142136653-142136675 CCTATTTAACAAATGGTGCTGGG - Intronic
963381864 3:144540708-144540730 CTTATTTAATAAATGGTGCTGGG + Intergenic
963484860 3:145922798-145922820 CTTATTTAATAAATGGTGCTGGG + Intergenic
963485742 3:145932542-145932564 CTTATTTAATAAATGGTGCTGGG + Intergenic
963545991 3:146658891-146658913 CTCCATGATCAAATGGAGGTGGG - Intergenic
963695337 3:148560150-148560172 CCTATTTAACAAATGGTGCTGGG - Intergenic
963996146 3:151711148-151711170 CCTATTTAACAAATGGTGCTGGG + Intergenic
964082465 3:152776163-152776185 CTCTCTGAAGAAATGGAGCTGGG + Intergenic
964187543 3:153964796-153964818 CTTATTTAATAAATGGTGCTGGG + Intergenic
964214800 3:154267474-154267496 CCCATTTAATAAATGGTGCTGGG + Intergenic
964486666 3:157192258-157192280 CTTATTTAATAAATGGTGCTTGG - Intergenic
964635577 3:158854896-158854918 CTTATTTAATAAATGGTGCTTGG - Intergenic
964680819 3:159336576-159336598 CCTATTTAATAAATGGAGCTGGG - Intronic
965128937 3:164669620-164669642 CTAATTTAACAAATGGTGTTGGG + Intergenic
965174815 3:165318005-165318027 CCCATTTAATAAATGGTGCTGGG - Intergenic
965194572 3:165577099-165577121 CTTATTTAATAAATGGTGCTGGG + Intergenic
965218936 3:165901577-165901599 CCTATTTAACAAATGGTGCTGGG - Intergenic
965227399 3:166007265-166007287 CCTATTTAACAAATGGTGCTGGG - Intergenic
965228463 3:166022332-166022354 CCTATTTAACAAATGGTGCTGGG - Intergenic
965982195 3:174706869-174706891 CCTATTTAACAAATGGTGCTGGG - Intronic
965988408 3:174785374-174785396 CTTATTTAATAAATGGTGCTGGG - Intronic
966106078 3:176335541-176335563 CCCATTTAATAAATGGTGCTGGG - Intergenic
966114840 3:176449369-176449391 CCTACTTAACAAATGGTGCTGGG - Intergenic
966167688 3:177039399-177039421 CTCAACTAACAAATGGAATACGG + Intronic
966321035 3:178701189-178701211 CCTATTTAACAAATGGTGCTGGG - Intronic
966384653 3:179383301-179383323 CCTATTTAACAAATGGTGCTGGG - Intronic
966492015 3:180538457-180538479 CTTATTTAACAAATGGTGCTGGG - Intergenic
966583259 3:181592132-181592154 CTCATTCAATAAATGGTGCTGGG - Intergenic
966838737 3:184070204-184070226 CTCAATAAAAAAATGGGGCCAGG - Intergenic
967239979 3:187428892-187428914 CCTATTTAACAAATGGTGCTGGG - Intergenic
967372681 3:188765581-188765603 CTCATTTTACAAATGTGGCTCGG + Intronic
967376552 3:188809913-188809935 CTTATTTAATAAATGGTGCTGGG - Intronic
967445436 3:189560296-189560318 CCTATTTAACAAATGGTGCTGGG - Intergenic
967460288 3:189738431-189738453 CTCATTTAACAAGTGGGGGTTGG + Intronic
967664066 3:192150548-192150570 CCCATTTAATAAATGGTGCTGGG - Intronic
969551966 4:7875618-7875640 CTCAAAAAAAAAATGGAGGTGGG + Intronic
970107405 4:12600374-12600396 CCTACTTAACAAATGGTGCTGGG + Intergenic
970155686 4:13139756-13139778 CTCTATTCACTGATGGAGCTGGG - Intergenic
970907955 4:21239133-21239155 CCTATTTAACAAATGGTGCTGGG + Intronic
970925375 4:21445532-21445554 CCTATTTAACAAATGGTGCTGGG + Intronic
970939255 4:21612236-21612258 TGCATTGAACAAATGGAGCTGGG + Intronic
970983431 4:22128048-22128070 CCCATTTAATAAATGGTGCTGGG + Intergenic
971115096 4:23636672-23636694 CACAATTAACAAATGCAGAAAGG + Intergenic
971602724 4:28615836-28615858 CTCATTCAAGAAATGGTGCTGGG - Intergenic
971631722 4:29000904-29000926 CTAAATCAAAAAATGGATCTGGG - Intergenic
972049195 4:34706996-34707018 CTCATTCAACAAATGGTGGTGGG + Intergenic
972187530 4:36549399-36549421 CTCTATCAGCAAATGCAGCTTGG + Intergenic
972220866 4:36952542-36952564 CTTATTTAATAAATGGTGCTGGG - Intergenic
972373026 4:38444025-38444047 CTTATTTAATAAATGGTGCTGGG - Intergenic
972799275 4:42456655-42456677 ATCAAATATCAAATGGATCTGGG + Intronic
972955846 4:44390368-44390390 CCTATTTAACAAATGGTGCTGGG - Intronic
973025770 4:45268366-45268388 CTAAATTAAAAAATGGATGTGGG - Intergenic
973131985 4:46659070-46659092 CTCAGGTAACAAATGTGGCTAGG - Intergenic
973341400 4:49008707-49008729 CCTATTTAACAAATGGTGCTGGG - Intronic
973542535 4:51948728-51948750 CCTATTTAACAAATGGTGCTGGG - Intergenic
973546220 4:51984594-51984616 CTTATTTAACAAATGGCGCTGGG - Intergenic
973546317 4:51985638-51985660 CCTATTTAACAAATGGTGCTGGG - Intergenic
973568619 4:52214384-52214406 CTTATTTAATAAATGGTGCTGGG - Intergenic
973731282 4:53824865-53824887 CTTATTTAATAAATGGTGCTGGG - Intronic
974119386 4:57620567-57620589 CCTATTTAACAAATGGTGCTGGG - Intergenic
974206454 4:58708738-58708760 CCTATTTAACAAATGGTGCTGGG - Intergenic
974265402 4:59580770-59580792 CTTATTTAATAAATGGTGCTGGG - Intergenic
974317453 4:60300360-60300382 TCCTATTAACAAATGGTGCTAGG + Intergenic
974398256 4:61368461-61368483 CCCATTTAATAAATGGTGCTGGG - Intronic
974522112 4:62995299-62995321 CTTATTTAATAAATGGTGCTGGG - Intergenic
974548118 4:63338477-63338499 CTTATTTAATAAATGGTGCTGGG + Intergenic
974619547 4:64338190-64338212 CCTATTTAACAAATGGTGCTGGG + Intronic
974731830 4:65877047-65877069 CCTATTTAACAAATGGTGCTGGG + Intergenic
974854271 4:67440797-67440819 CCCATTTAATAAATGGTGCTGGG + Intergenic
974959374 4:68678732-68678754 CCTAATTAATAAATGGTGCTGGG - Intergenic
974997872 4:69184575-69184597 CCTATTTAACAAATGGTGCTGGG - Intronic
975000458 4:69219266-69219288 CTCCATTAAAAAATGGGGCAGGG - Intergenic
975005310 4:69275936-69275958 CTCCATTAAAAAATGGGGCAGGG + Intergenic
975013730 4:69384925-69384947 CTCCATTAAAAAATGGGGCAGGG + Intronic
975014989 4:69404276-69404298 CTCCATTAAAAAATGGGGCAGGG + Intronic
975061703 4:70011085-70011107 CTTATTCAACAAATGGTGCTGGG - Intergenic
975179659 4:71330492-71330514 CCTATTTAACAAATGGTGCTGGG + Intronic
975253257 4:72204210-72204232 CTTATTTAATAAATGGTGCTGGG + Intergenic
975277198 4:72516069-72516091 CCCATTTAATAAATGGTGCTGGG - Intronic
975289098 4:72656047-72656069 CCCATTTAATAAATGGTGCTGGG + Intergenic
975308868 4:72880005-72880027 CCTATTTAACAAATGGTGCTGGG - Intergenic
975403010 4:73959024-73959046 CCTATTTAACAAATGGTGCTGGG + Intergenic
975407177 4:74002962-74002984 CCTATTTAACAAATGGTGCTGGG - Intergenic
975543103 4:75534320-75534342 CCTATTTAACAAATGGTGCTGGG + Intronic
975968281 4:80002318-80002340 CTTATTTAATAAATGGTGCTGGG + Intronic
976083266 4:81380000-81380022 CTATTTTAACAAATGGAGGTGGG + Intergenic
976157288 4:82160203-82160225 CTTATTTAATAAATGGTGCTGGG + Intergenic
976372504 4:84305355-84305377 CTCTCTTAATAAATGGTGCTAGG + Intergenic
976373259 4:84314657-84314679 CCTATTTAACAAATGGTGCTGGG + Intergenic
976466912 4:85380653-85380675 CCTATTTAACAAATGGTGCTGGG + Intergenic
976532538 4:86171485-86171507 CCTATTTAACAAATGGTGCTGGG + Intronic
976594783 4:86884935-86884957 CCTATTTAACAAATGGTGCTGGG - Intronic
976655483 4:87484315-87484337 CTTATTTAATAAATGGTGCTGGG - Intronic
976820418 4:89200027-89200049 CCTATTTAACAAATGGTGCTGGG - Intergenic
976837702 4:89394106-89394128 CCTATTTAACAAATGGTGCTGGG + Intergenic
976876305 4:89857257-89857279 CCTATTTAACAAATGGTGCTGGG + Intergenic
976957312 4:90916422-90916444 CCTATTTAACAAATGGTGCTGGG + Intronic
976993649 4:91402627-91402649 CCTATTTAACAAATGGTGCTGGG - Intronic
977001247 4:91506166-91506188 CCCATTTAATAAATGGTGCTAGG - Intronic
977183756 4:93910529-93910551 CCCATTTAACAAATGGTGCTGGG - Intergenic
977298255 4:95235716-95235738 CCGATTTAACAAATGGTGCTGGG - Intronic
977448321 4:97160961-97160983 CCCATTTAATAAATGGTGCTGGG + Intergenic
977469584 4:97425944-97425966 CCTATTTAACAAATGGTGCTGGG - Intronic
977469817 4:97428800-97428822 CCTATTTAACAAATGGTGCTGGG - Intronic
977507454 4:97920474-97920496 CACAATTAACAAGTGGAAATTGG + Intronic
977543649 4:98349200-98349222 CCTATTTAACAAATGGTGCTGGG - Intronic
977588987 4:98805804-98805826 CTTATTTAACAAATGGTGCTGGG + Intergenic
977590059 4:98816119-98816141 CTCAAATATGAAATGGTGCTTGG + Intergenic
977653619 4:99497017-99497039 CCTATTTAACAAATGGTGCTGGG + Intergenic
977823970 4:101508145-101508167 CCTATTTAACAAATGGTGCTGGG - Intronic
977844524 4:101752782-101752804 CTTATTCAACAAATGGTGCTGGG - Intronic
978074814 4:104515252-104515274 CCTATTTAACAAATGGTGCTGGG - Intergenic
978141461 4:105322168-105322190 CTTATTTAATAAATGGTGCTGGG + Intergenic
978142196 4:105330705-105330727 CTTATTTAATAAATGGTGCTGGG + Intergenic
978238641 4:106490194-106490216 CCTATTTAACAAATGGTGCTGGG + Intergenic
978364025 4:107961564-107961586 CTTATTTAATAAATGGTGCTGGG + Intergenic
978667079 4:111196589-111196611 CTTATTTAATAAATGGTGCTGGG + Intergenic
978911450 4:114068776-114068798 CCTATTTAACAAATGGTGCTGGG + Intergenic
978985697 4:115009443-115009465 CCTATTTAACAAATGGTGCTAGG + Intronic
978997692 4:115176625-115176647 CCTATTTAACAAATGGTGCTGGG + Intergenic
979074331 4:116253140-116253162 CTTATTTAATAAATGGTGCTGGG - Intergenic
979156514 4:117398432-117398454 CTTATTCAACAAATGGTGCTAGG + Intergenic
979177404 4:117681384-117681406 CCTATTTAACAAATGGTGCTGGG - Intergenic
979215855 4:118162508-118162530 CTTATTTAATAAATGGTGCTGGG + Intronic
979316860 4:119275330-119275352 CCTATTTAACAAATGGTGCTGGG - Intronic
979614342 4:122725522-122725544 CCTAATCAACAAATGGTGCTGGG + Intergenic
979658557 4:123225443-123225465 CTTAGTTAATAAATGGTGCTGGG - Intronic
979741180 4:124153149-124153171 CCTATTTAACAAATGGTGCTGGG - Intergenic
979776979 4:124602154-124602176 CCTATTTAACAAATGGTGCTGGG + Intergenic
980020259 4:127701006-127701028 CTCAATGAATTAATGGATCTAGG + Intronic
980021690 4:127718215-127718237 CTTATTTAATAAATGGTGCTGGG - Exonic
980217555 4:129871974-129871996 CTTATTTAATAAATGGTGCTGGG - Intergenic
980280770 4:130716380-130716402 CCTATTTAACAAATGGTGCTGGG - Intergenic
980320921 4:131273906-131273928 CTCATTTAATAAATGGTGTTGGG + Intergenic
980390086 4:132133634-132133656 CCTATTTAACAAATGGTGCTGGG + Intergenic
980437409 4:132795514-132795536 CTTATTTAATAAATGGTGCTGGG + Intergenic
980506270 4:133728294-133728316 CCTATTTAACAAATGGTGCTGGG + Intergenic
980561384 4:134481058-134481080 CTCTATTAATAAATGGTGCCGGG - Intergenic
981181755 4:141754272-141754294 CTCAAGTGTCACATGGAGCTGGG + Intergenic
981200114 4:141970596-141970618 CTTATTTAATAAATGGTGCTGGG + Intergenic
981255200 4:142653131-142653153 CCCTATTAATAAATGGTGCTGGG + Intronic
981325878 4:143447027-143447049 CCCATTTAATAAATGGTGCTGGG - Intronic
981344558 4:143660316-143660338 CCCATTTAATAAATGGTGCTGGG - Intronic
981346026 4:143677301-143677323 CCTATTTAACAAATGGTGCTGGG + Intronic
981349915 4:143717744-143717766 CCTATTTAATAAATGGAGCTGGG - Intergenic
981351543 4:143735537-143735559 CCCATTCAACAAATGGTGCTGGG - Intergenic
981522478 4:145677819-145677841 CCCATTCAACAAATGGTGCTGGG - Intergenic
981608952 4:146571545-146571567 CTTATTTAATAAATGGTGCTGGG - Intergenic
981680687 4:147394286-147394308 CTTATTCAACAAATGGTGCTGGG + Intergenic
981790546 4:148531682-148531704 CCCATTTAATAAATGGTGCTGGG - Intergenic
982077071 4:151748420-151748442 CCTATTTAACAAATGGTGCTGGG + Intronic
982309104 4:153965354-153965376 CCTATTTAACAAATGGTGCTGGG - Intergenic
982323416 4:154104392-154104414 CTTATTCAACAAATGGTGCTGGG - Intergenic
982347940 4:154382188-154382210 CTTAATCAATAAATGGTGCTGGG + Intronic
982406270 4:155023421-155023443 CCTATTTAACAAATGGTGCTGGG + Intergenic
982683844 4:158464415-158464437 CCTATTTAACAAATGGTGCTGGG - Intronic
982690794 4:158545682-158545704 CCTATTTAACAAATGGTGCTGGG - Intronic
982819725 4:159930301-159930323 CCTATTTAACAAATGGTGCTGGG - Intergenic
982886698 4:160790495-160790517 CCTATTTAACAAATGGTGCTGGG + Intergenic
982902924 4:161029734-161029756 CTTATTTAATAAATGGTGCTGGG + Intergenic
982906756 4:161084349-161084371 CTTATTTAATAAATGGTGCTGGG + Intergenic
983131673 4:164027508-164027530 CTTATTTAATAAATGGTGCTGGG + Intronic
983668733 4:170212017-170212039 CCTATTTAACAAATGGTGCTGGG + Intergenic
984131457 4:175880119-175880141 CCTATTTAACAAATGGTGCTGGG - Intronic
984319275 4:178170829-178170851 CCTATTTAACAAATGGTGCTGGG + Intergenic
984345036 4:178512139-178512161 CCCATTTAACAAATGGTGCTGGG - Intergenic
984372843 4:178888838-178888860 CTTATTTAATAAATGGTGCTGGG + Intergenic
984428025 4:179612997-179613019 CCTATTTAACAAATGGTGCTGGG + Intergenic
984574791 4:181435590-181435612 CCCATTTAATAAATGGTGCTGGG - Intergenic
984695981 4:182780288-182780310 CCCATTTAATAAATGGTGCTGGG - Intronic
985242879 4:187949476-187949498 CTTATTTAATAAATGGTGCTGGG - Intergenic
985243430 4:187955459-187955481 CTTATTTAATAAATGGTGCTGGG + Intergenic
985274048 4:188220078-188220100 CTCAATTAACATCTGGACCCTGG + Intergenic
985439350 4:189968594-189968616 CTTATTTAACAAATGGTGCTGGG + Intergenic
985745779 5:1646341-1646363 CCTATTTAACAAATGGTGCTGGG + Intergenic
986358988 5:6957030-6957052 CACATTTAATAAATGGTGCTGGG + Intergenic
986475521 5:8126960-8126982 CCCATTCAACAAATGGTGCTGGG - Intergenic
986527672 5:8698026-8698048 CCCATTTAATAAATGGTGCTGGG + Intergenic
986531846 5:8745410-8745432 CCCATTTAATAAATGGTGCTGGG + Intergenic
986967452 5:13291428-13291450 CCTATTTAATAAATGGAGCTGGG - Intergenic
986998134 5:13630676-13630698 CCCATTCAACAAATGGTGCTGGG + Intergenic
987009562 5:13748111-13748133 CCTATTTAACAAATGGTGCTGGG - Intronic
987750169 5:22029020-22029042 CCTATTTAACAAATGGTGCTGGG + Intronic
987975837 5:25013935-25013957 CTTATTTAATAAATGGTGCTGGG + Intergenic
988036402 5:25832806-25832828 CTTATTTAATAAATGGTGCTGGG + Intergenic
988251180 5:28759892-28759914 CCTATTTAACAAATGGTGCTGGG + Intergenic
988268559 5:28984292-28984314 CCTATTTAACAAATGGGGCTGGG - Intergenic
988333811 5:29878156-29878178 CCTATTTAACAAATGGTGCTGGG - Intergenic
988676321 5:33436748-33436770 CCTATTTAACAAATGGTGCTGGG - Intergenic
989656962 5:43754947-43754969 CCCATTCAACAAATGGTGCTGGG - Intergenic
989809620 5:45658146-45658168 CTTATTTAATAAATGGTGCTGGG + Intronic
989818236 5:45762798-45762820 CCCATTTAATAAATGGTGCTGGG - Intergenic
989820578 5:45791037-45791059 CTTATTTAATAAATGGTGCTGGG + Intergenic
989835282 5:45980952-45980974 CTTATTTAATAAATGGTGCTGGG - Intergenic
989990261 5:50755413-50755435 CCTATTTAACAAATGGTGCTGGG - Intronic
989994535 5:50812826-50812848 CTTATTTAATAAATGGTGCTGGG - Intronic
990234908 5:53756657-53756679 CCTATTTAACAAATGGTGCTGGG + Intergenic
990235467 5:53762656-53762678 CCTATTTAACAAATGGTGCTGGG + Intergenic
990497491 5:56363175-56363197 CTTATTCAACAAATGGTGCTGGG - Intergenic
990648027 5:57866594-57866616 CTTATTTAATAAATGGTGCTGGG - Intergenic
990653402 5:57927724-57927746 CCTATTTAACAAATGGTGCTGGG + Intergenic
990912357 5:60865188-60865210 CTTATTTAATAAATGGTGCTGGG + Intergenic
990934092 5:61128557-61128579 CCTATTTAACAAATGGTGCTGGG + Intronic
991103823 5:62822118-62822140 CCTATTTAACAAATGGTGCTGGG + Intergenic
991418872 5:66420213-66420235 CCCATTCAACAAATGGTGCTGGG - Intergenic
991623363 5:68570134-68570156 CCTATTTAACAAATGGTGCTGGG + Intergenic
992022028 5:72634227-72634249 CTCAATTATCAAATGAGGTTGGG + Intergenic
992026561 5:72675547-72675569 CCCTATTAATAAATGGTGCTTGG - Intergenic
992095780 5:73361347-73361369 CTCAAATAACAAAAGAAGGTAGG - Intergenic
992227717 5:74635207-74635229 CACAATCAACAAATGGACCATGG - Exonic
992649925 5:78849298-78849320 CCCATTTAATAAATGGTGCTGGG - Intronic
992803469 5:80314430-80314452 CCTATTTAACAAATGGTGCTGGG - Intergenic
992815406 5:80432343-80432365 CCTATTTAACAAATGGTGCTGGG + Intronic
993240737 5:85381085-85381107 CTTATTTAATAAATGGTGCTGGG - Intergenic
993406510 5:87517823-87517845 CCTATTTAACAAATGGTGCTGGG + Intergenic
993676087 5:90817646-90817668 CCTATTTAACAAATGGTGCTGGG - Intronic
993818535 5:92584054-92584076 CCTATTTAACAAATGGCGCTGGG + Intergenic
994143101 5:96363067-96363089 CCCATTTAATAAATGGTGCTGGG - Intergenic
994222536 5:97212532-97212554 CCTATTTAACAAATGGTGCTGGG - Intergenic
994390100 5:99182148-99182170 CTTATTTAATAAATGGTGCTGGG - Intergenic
994442681 5:99830187-99830209 CTTATTTAATAAATGGTGCTGGG - Intergenic
994616603 5:102112065-102112087 CCTATTTAACAAATGGTGCTGGG - Intergenic
994680667 5:102882952-102882974 CCTATTTAACAAATGGTGCTGGG - Intronic
994779814 5:104075591-104075613 CCTATTTAACAAATGGTGCTGGG - Intergenic
994861614 5:105202711-105202733 CCTATTTAACAAATGGTGCTGGG + Intergenic
994990879 5:106995517-106995539 CTTATTTAATAAATGGTGCTGGG - Intergenic
995089928 5:108162201-108162223 CTCAATAAACACCTGGGGCTGGG + Intronic
995230226 5:109752858-109752880 GATTATTAACAAATGGAGCTGGG + Intronic
995343486 5:111086114-111086136 CTTATTTAATAAATGGTGCTGGG - Intergenic
995644121 5:114292424-114292446 CCTATTTAACAAATGGTGCTGGG - Intergenic
995806357 5:116056880-116056902 CCTATTTAACAAATGGTGCTGGG - Intronic
996122294 5:119686020-119686042 CCTAATTAATAAATGGTGCTGGG - Intergenic
996246970 5:121276054-121276076 CTTATTTAATAAATGGTGCTGGG + Intergenic
997289974 5:132723558-132723580 CCTATTTAACAAATGGTGCTGGG + Intronic
997573348 5:134951803-134951825 CTCATTTAAAAAATGGTGGTTGG + Intronic
997670278 5:135665654-135665676 CTTATTTAATAAATGGTGCTGGG - Intergenic
997751022 5:136345932-136345954 CCTATTTAACAAATGGTGCTGGG - Intronic
998504805 5:142663942-142663964 CGCAAATCACAAGTGGAGCTCGG + Intronic
998776153 5:145605405-145605427 CTTATTTAATAAATGGTGCTGGG - Intronic
999488029 5:152019691-152019713 CTCAAAAAACAAAAGAAGCTAGG - Intergenic
999624538 5:153506511-153506533 CTCAATTAACAAATGGAGCTTGG - Intronic
999867324 5:155715176-155715198 CTTATTTAATAAATGGTGCTGGG - Intergenic
999964173 5:156790373-156790395 CTTATTTAATAAATGGTGCTGGG + Intergenic
1000016384 5:157281310-157281332 CTCTACAAACAAATGGATCTAGG - Intronic
1000387652 5:160690115-160690137 CTTATTTAATAAATGGTGCTGGG + Intronic
1000480619 5:161769005-161769027 CCCTATTAATAAATGGTGCTGGG + Intergenic
1000490184 5:161903273-161903295 CTTATTTAATAAATGGTGCTGGG - Intergenic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1000647619 5:163777870-163777892 CCTATTTAACAAATGGTGCTGGG - Intergenic
1000655414 5:163872865-163872887 CTTATTTAATAAATGGTGCTGGG + Intergenic
1001336323 5:170800250-170800272 CCTACTTAACAAATGGTGCTGGG + Intronic
1001899772 5:175416890-175416912 ATCAATGAACAAATGGATCGTGG - Intergenic
1002026499 5:176399444-176399466 CTCATTTGAAAAATGGGGCTGGG + Intronic
1002825781 6:772785-772807 CTTATTTAATAAATGGTGCTGGG - Intergenic
1003266765 6:4572622-4572644 CCCTATTAATAAATGGTGCTGGG - Intergenic
1003297078 6:4839651-4839673 CTTATTTAACAAATGGTGCTGGG - Intronic
1003782854 6:9448629-9448651 CTTATTTAATAAATGGTGCTGGG + Intergenic
1004018067 6:11750293-11750315 CCCAATTAACAAATAGGACTTGG + Intronic
1004032318 6:11882768-11882790 CTTATTTAATAAATGGTGCTGGG + Intergenic
1004304104 6:14484882-14484904 CCTATTTAACAAATGGTGCTGGG + Intergenic
1004510485 6:16280278-16280300 CTCAGGTAACAACTGAAGCTAGG + Intronic
1005305442 6:24509348-24509370 CTCCCTCAACAAATGGTGCTGGG - Intronic
1005851030 6:29822252-29822274 CCTATTTAACAAATGGTGCTGGG + Intergenic
1005877776 6:30026785-30026807 CTTATTGAACAAATGGTGCTGGG + Intergenic
1006279879 6:33042881-33042903 CCTATTTAACAAATTGAGCTGGG - Intergenic
1006617148 6:35337799-35337821 CTTATTTAATAAATGGTGCTGGG - Intergenic
1007137630 6:39537975-39537997 CCTATTTAACAAATGGTGCTGGG + Intronic
1007155730 6:39741313-39741335 CCTATTTAACAAATGGTGCTGGG + Intergenic
1007158242 6:39767344-39767366 CCTATTTAACAAATGGTGCTGGG - Intergenic
1007978310 6:46124341-46124363 CCTATTTAACAAATGGTGCTGGG + Intergenic
1007993271 6:46279624-46279646 TTCAACTGACAAATGGAGATGGG - Intronic
1008293614 6:49750576-49750598 CTTATTTAATAAATGGTGCTGGG - Intergenic
1008637792 6:53429134-53429156 CTCATTCAAGAAATGGAGCAAGG - Intergenic
1009328433 6:62383674-62383696 CCCTATTAATAAATGGTGCTGGG - Intergenic
1009384432 6:63071509-63071531 CCTATTTAACAAATGGTGCTGGG - Intergenic
1009454537 6:63840357-63840379 TCCAATTAAGAAATGGGGCTGGG - Intronic
1009457500 6:63874227-63874249 CCTATTTAACAAATGGTGCTCGG - Intronic
1009517291 6:64636348-64636370 CCTATTTAACAAATGGTGCTGGG + Intronic
1009605898 6:65866756-65866778 CCTATTTAATAAATGGAGCTGGG + Intergenic
1009660870 6:66609550-66609572 CTTATTTAATAAATGGTGCTGGG - Intergenic
1009664033 6:66653088-66653110 CCTAGTTAACAAATGGTGCTGGG - Intergenic
1009679267 6:66870991-66871013 CCCCATTAATAAATGGTGCTGGG - Intergenic
1009681124 6:66894800-66894822 CCCATTTAATAAATGGTGCTGGG - Intergenic
1009799608 6:68518726-68518748 CTTATTTAATAAATGGTGCTGGG - Intergenic
1009910866 6:69925318-69925340 CCTATTTAACAAATGGTGCTGGG - Intronic
1009921332 6:70065366-70065388 CCTATTTAACAAATGGTGCTGGG + Intronic
1010307205 6:74338983-74339005 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010348073 6:74836664-74836686 CCTATTTAACAAATGGTGCTGGG + Intergenic
1010464483 6:76150941-76150963 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010475431 6:76281177-76281199 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010566814 6:77425817-77425839 CACAATGAACTAATGGAACTGGG + Intergenic
1010602714 6:77850544-77850566 CCTATTTAACAAATGGTGCTGGG + Intronic
1010637356 6:78277450-78277472 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010653805 6:78487801-78487823 CTCAATTTACCAATAGAGATAGG + Intergenic
1010677667 6:78763021-78763043 CCTATTTAACAAATGGTGCTGGG + Intergenic
1010684645 6:78839016-78839038 CTTATTTAATAAATGGTGCTGGG + Intergenic
1010728444 6:79362173-79362195 CCTATTTAACAAATGGTGCTGGG - Intergenic
1010827681 6:80493508-80493530 CTTATTTAATAAATGGTGCTGGG - Intergenic
1010876469 6:81113284-81113306 CCTATTTAACAAATGGTGCTGGG - Intergenic
1010959143 6:82125414-82125436 CTTATTTAATAAATGGTGCTGGG - Intergenic
1011082072 6:83500547-83500569 CTTATTTAATAAATGGTGCTGGG + Intergenic
1011086088 6:83542650-83542672 CTTGTTTAACAAATGGTGCTAGG - Intergenic
1011145164 6:84206478-84206500 CTTATTTAATAAATGGTGCTGGG + Intronic
1011147842 6:84238404-84238426 CTTATTTAATAAATGGTGCTGGG + Intergenic
1011171170 6:84505750-84505772 CCTATTTAACAAATGGTGCTGGG - Intergenic
1011563277 6:88645762-88645784 CCTATTTAACAAATGGTGCTGGG + Intronic
1011761158 6:90566971-90566993 CCCATTTAATAAATGGTGCTGGG + Intronic
1011803798 6:91048379-91048401 CCTATTTAACAAATGGTGCTGGG - Intergenic
1011926549 6:92652383-92652405 CCTATTTAACAAATGGTGCTGGG - Intergenic
1011992951 6:93546797-93546819 CCTATTTAACAAATGGTGCTGGG - Intergenic
1012134215 6:95535924-95535946 TTCAATAAATAAATGGTGCTGGG - Intergenic
1012208853 6:96495591-96495613 CCTACTTAACAAATGGTGCTGGG - Intergenic
1012587462 6:100941421-100941443 CCTATTTAACAAATGGTGCTGGG - Intergenic
1012740278 6:103007776-103007798 CCTATTTAACAAATGGTGCTGGG + Intergenic
1012757641 6:103252031-103252053 CCTATTTAACAAATGGTGCTGGG + Intergenic
1012770597 6:103428626-103428648 CTCTATTCAAAAATGGGGCTGGG + Intergenic
1012814268 6:104002337-104002359 CCTATTTAACAAATGGTGCTGGG + Intergenic
1012830997 6:104203244-104203266 CCTATTTAACAAATGGTGCTGGG + Intergenic
1012834323 6:104246096-104246118 CCTATTTAACAAATGGTGCTGGG + Intergenic
1012980653 6:105827180-105827202 CACATTTAATAAATGGTGCTGGG + Intergenic
1013397623 6:109758366-109758388 CTTATTTAATAAATGGTGCTGGG + Intronic
1013763689 6:113549750-113549772 CCCATTTAATAAATGGTGCTGGG + Intergenic
1013813723 6:114073052-114073074 CTTATTTAATAAATGGTGCTGGG + Intronic
1013930161 6:115521001-115521023 CTTACTTAATAAATGGTGCTGGG + Intergenic
1014059545 6:117054781-117054803 CTTATTTAATAAATGGTGCTGGG + Intergenic
1014065100 6:117115463-117115485 CCTAATTAATAAATGGTGCTAGG + Intergenic
1014146282 6:118001358-118001380 CCCATTTAATAAATGGTGCTGGG + Intronic
1014179487 6:118369334-118369356 CCTATTTAACAAATGGTGCTGGG + Intergenic
1014565210 6:122940589-122940611 CTTATTTAATAAATGGTGCTGGG - Intergenic
1014825394 6:126044287-126044309 CCTATTTAACAAATGGTGCTGGG - Intergenic
1016281409 6:142423398-142423420 TTTAATTAATAAATGGTGCTGGG - Intronic
1016345440 6:143108529-143108551 CTCACTTAACAACTTCAGCTGGG + Intronic
1016638647 6:146323824-146323846 CCTATTTAACAAATGGTGCTGGG - Intronic
1016656189 6:146521018-146521040 CCTATTTAACAAATGGTGCTGGG - Intergenic
1017280074 6:152613894-152613916 CCTATTTAACAAATGGTGCTGGG + Intronic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1019584010 7:1786686-1786708 CCCAAATAACAAATAGAACTTGG - Intergenic
1019985978 7:4656195-4656217 CTCAATTACCAAGTGGACATTGG + Intergenic
1020329914 7:7007040-7007062 CCTATTTAACAAATGGTGCTGGG - Intergenic
1020598530 7:10243048-10243070 CCTATTTAACAAATGGTGCTGGG - Intergenic
1020620020 7:10505848-10505870 CCTATTTAACAAATGGTGCTGGG + Intergenic
1021334701 7:19385287-19385309 CCTATTTAACAAATGGTGCTGGG - Intergenic
1021372028 7:19861098-19861120 CTAAATTATCAAATGGTCCTGGG + Intergenic
1021379462 7:19949955-19949977 CCTATTTAACAAATGGTGCTGGG - Intergenic
1021391106 7:20093849-20093871 CCTATTTAACAAATGGTGCTGGG + Intergenic
1021529095 7:21622726-21622748 CCCATTTAATAAATGGTGCTGGG + Intronic
1021943451 7:25702548-25702570 CCTAATTAATAAATGGTGCTGGG + Intergenic
1022229723 7:28402582-28402604 CTTATTTAATAAATGGTGCTGGG + Intronic
1022554748 7:31281597-31281619 CCTATTTAATAAATGGAGCTGGG + Intergenic
1022830153 7:34057629-34057651 CTCAATTAACTATTGGTGCTTGG + Intronic
1023143383 7:37125044-37125066 CCTATTTAACAAATGGTGCTGGG + Intronic
1023147313 7:37164570-37164592 CCTATTTAACAAATGGTGCTGGG - Intronic
1023240177 7:38136151-38136173 GTCAATTGAAAAATGGAGGTTGG + Intergenic
1023325175 7:39046933-39046955 GTCTGTTAACAAATGGTGCTGGG - Intronic
1024031417 7:45463658-45463680 CCTATTTAACAAATGGTGCTGGG - Intergenic
1024033938 7:45490701-45490723 CCCATTTAACAAATAGTGCTGGG - Intergenic
1024236025 7:47399581-47399603 CCTATTTAACAAATGGTGCTGGG + Intronic
1024796466 7:53027551-53027573 CCTATTTAACAAATGGTGCTGGG - Intergenic
1024840317 7:53578007-53578029 CTTATTCAACAAATGGTGCTGGG + Intergenic
1024875807 7:54021826-54021848 CCTATTTAACAAATGGTGCTAGG - Intergenic
1024900984 7:54318321-54318343 CCTATTTAACAAATGGTGCTGGG - Intergenic
1024909842 7:54434599-54434621 CTGATTTAAGAAATGGAGATTGG + Intergenic
1025501716 7:61309194-61309216 CCTATTTAACAAATGGTGCTGGG - Intergenic
1025516579 7:61655416-61655438 CCTATTTAACAAATGGTGCTGGG - Intergenic
1025540916 7:62084240-62084262 CCTATTTAACAAATGGTGCTGGG - Intergenic
1025545481 7:62160685-62160707 CTTATTTAATAAATGGTGCTGGG + Intergenic
1025736684 7:64155214-64155236 CCTATTTAACAAATGGTGCTGGG - Intronic
1025737607 7:64165388-64165410 CCTATTTAACAAATGGTGCTGGG + Intronic
1025931061 7:65994606-65994628 CCTATTTAACAAATGGTGCTGGG + Intergenic
1026251283 7:68673259-68673281 CTCAATTAAAAAAGGGAGGTTGG - Intergenic
1026333732 7:69375988-69376010 CTTATTTAATAAATGGTGCTGGG - Intergenic
1026521244 7:71119949-71119971 TTTAATTAAAAAATGGGGCTGGG + Intergenic
1026643352 7:72146876-72146898 CCTATTTAACAAATGGTGCTGGG + Intronic
1027608320 7:80328031-80328053 CCTATTTAACAAATGGTGCTGGG + Intergenic
1027812422 7:82921503-82921525 CTTATTCAACAAATGGTGCTAGG + Intronic
1027897798 7:84067180-84067202 CTTATTTAATAAATGGTGCTGGG + Intronic
1027918460 7:84358369-84358391 CCTATTTAACAAATGGTGCTGGG - Intronic
1027930083 7:84521268-84521290 CCTATTTAACAAATGGTGCTGGG + Intergenic
1028081744 7:86585892-86585914 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028143574 7:87297719-87297741 CTCATTCAATAAATGGTGCTGGG + Intergenic
1028159552 7:87470127-87470149 CCTATTTAACAAATGGTGCTGGG + Intronic
1028307017 7:89278583-89278605 CTTATTTAATAAATGGTGCTGGG - Intronic
1028489038 7:91390711-91390733 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028497427 7:91477904-91477926 CTTATTTAATAAATGGTGCTGGG - Intergenic
1028633332 7:92960160-92960182 CCCATTTAATAAATGGTGCTGGG + Intergenic
1028792514 7:94868764-94868786 CTAATTCAACAAATGGTGCTGGG - Intergenic
1028958817 7:96725344-96725366 CCCAATTTAAAAATGAAGCTAGG - Intergenic
1029830286 7:103249485-103249507 CCTATTTAACAAATGGTGCTGGG + Intergenic
1030007917 7:105136674-105136696 CGCACATAACACATGGAGCTAGG + Intronic
1030030137 7:105361733-105361755 CCCATTTAATAAATGGTGCTGGG + Intronic
1030200515 7:106898611-106898633 CCTATTTAACAAATGGTGCTGGG - Intronic
1030404781 7:109097123-109097145 CCTATTTAACAAATGGTGCTGGG + Intergenic
1030485623 7:110163642-110163664 CCTATTTAACAAATGGTGCTGGG - Intergenic
1030501781 7:110368336-110368358 CCTATTTAACAAATGGTGCTGGG + Intergenic
1030590041 7:111469632-111469654 CTTATTTAATAAATGGTGCTGGG + Intronic
1030698440 7:112612252-112612274 CCCATTTAATAAATGGTGCTGGG - Intergenic
1031179139 7:118392882-118392904 CCTATTTAATAAATGGAGCTGGG + Intergenic
1031247889 7:119340398-119340420 CCTATTTAATAAATGGAGCTGGG + Intergenic
1031259732 7:119503373-119503395 CTTATTTAATAAATGGTGCTGGG - Intergenic
1031501191 7:122519065-122519087 CTCTATTAGCAAATGGCCCTGGG + Intronic
1031539544 7:122976914-122976936 CCTATTTAACAAATGGTGCTGGG + Intergenic
1031550739 7:123109203-123109225 CCCATTTAAGAAATGGTGCTGGG - Intergenic
1031797472 7:126194595-126194617 CCTATTTAACAAATGGTGCTGGG + Intergenic
1031866452 7:127042521-127042543 CCTATTTAACAAATGGTGCTGGG + Intronic
1032350010 7:131153123-131153145 CTTAATGAACTAATGGATCTAGG - Intronic
1032562009 7:132902062-132902084 CCTATTTAACAAATGGTGCTGGG - Intronic
1032768072 7:135019824-135019846 CCTATTTAACAAATGGTGCTGGG + Intronic
1032857696 7:135849278-135849300 CCTATTTAACAAATGGTGCTGGG - Intergenic
1032860506 7:135873952-135873974 CTCATTTAATAAATGGTGCTGGG - Intergenic
1032939345 7:136770344-136770366 CCTATTTAACAAATGGTGCTGGG + Intergenic
1033083245 7:138318309-138318331 CCCATTTAATAAATGGTGCTGGG + Intergenic
1033496149 7:141898501-141898523 CCTATTTAACAAATGGAGCTGGG - Intergenic
1033522769 7:142178586-142178608 CTTTATTAATAAATGGTGCTGGG - Intronic
1033631375 7:143161447-143161469 CCTATTTAACAAATGGTGCTGGG - Intergenic
1033829657 7:145236777-145236799 CTTATTTAATAAATGGTGCTGGG - Intergenic
1033838315 7:145342629-145342651 CTTATTTAATAAATGGTGCTGGG + Intergenic
1033961183 7:146915050-146915072 CCTATTTAACAAATGGTGCTGGG - Intronic
1034363900 7:150528491-150528513 CCTATTTAACAAATGGTGCTGGG - Intergenic
1034705652 7:153140722-153140744 CCTAATTAATAAATGGTGCTGGG - Intergenic
1035840005 8:2801125-2801147 CCTATTTAACAAATGGTGCTGGG - Intergenic
1035980668 8:4367291-4367313 CCTATTTAAAAAATGGAGCTGGG - Intronic
1036624046 8:10451158-10451180 CCTATTTAACAAATGGTGCTGGG - Intergenic
1037410690 8:18592881-18592903 CCTATTTAACAAATGGTGCTGGG + Intronic
1037626606 8:20613049-20613071 CCCATTTAATAAATGGTGCTGGG - Intergenic
1037704634 8:21308997-21309019 CTCAATTAGCAAATGCATTTTGG - Intergenic
1038174261 8:25165977-25165999 CTCATTTAACAAATGGAGGCCGG + Intergenic
1038846269 8:31232497-31232519 CCTATTTAACAAATGGTGCTGGG - Intergenic
1038870188 8:31485356-31485378 CCTATTTAACAAATGGTGCTGGG - Intergenic
1038893971 8:31760282-31760304 CCTATTTAACAAATGGTGCTGGG - Intronic
1038986527 8:32817481-32817503 CCTATTTAACAAATGGTGCTGGG - Intergenic
1039348128 8:36730664-36730686 CCCATTTAATAAATGGTGCTGGG + Intergenic
1039882810 8:41636228-41636250 CCCAATTAAAAAATGGGCCTGGG + Intergenic
1040070662 8:43184869-43184891 CTTATTTAATAAATGGTGCTGGG - Intronic
1040326814 8:46349843-46349865 CTTATTTAATAAATGGCGCTGGG - Intergenic
1040364422 8:46700498-46700520 CTTATTTAATAAATGGTGCTGGG - Intergenic
1040401372 8:47052980-47053002 CCTATTTAACAAATGGTGCTAGG + Intergenic
1040438006 8:47411887-47411909 CTTATTTAATAAATGGTGCTGGG - Intronic
1040524703 8:48210774-48210796 CCTATTTAACAAATGGTGCTGGG + Intergenic
1040707701 8:50149624-50149646 CCTATTTAACAAATGGTGCTGGG - Intronic
1040712442 8:50205800-50205822 CCTACTTAACAAATGGTGCTGGG - Intronic
1040784642 8:51151055-51151077 CCTATTTAACAAATGGTGCTGGG - Intergenic
1040966874 8:53091330-53091352 CCTATTCAACAAATGGAGCTGGG - Intergenic
1041112354 8:54495782-54495804 CCCATTCAACAAATGGTGCTGGG - Intergenic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041412221 8:57569213-57569235 CCTATTTAACAAATGGTGCTGGG + Intergenic
1041434379 8:57821321-57821343 CCTATTTAACAAATGGTGCTGGG + Intergenic
1042027210 8:64436890-64436912 CCTATTTAACAAATGGTGCTGGG + Intergenic
1042073323 8:64960461-64960483 CCTATTTAATAAATGGAGCTGGG + Intergenic
1042167738 8:65962008-65962030 CTCATTTAAAAAATGGAGGGAGG - Intergenic
1042174470 8:66025660-66025682 CTTATTTAATAAATGGTGCTGGG - Intronic
1042188484 8:66161258-66161280 CATATTTAACAAATGGTGCTGGG - Intronic
1042332078 8:67591118-67591140 CTTATTTAATAAATGGTGCTGGG - Intronic
1042338378 8:67652972-67652994 CTTATTTAATAAATGGTGCTGGG - Intronic
1042591144 8:70400548-70400570 CTAAATTAACAAATGGTGGGGGG + Intronic
1042774069 8:72410085-72410107 CCTATTTAACAAATGGTGCTGGG + Intergenic
1042780375 8:72484207-72484229 CCTATTTAACAAATGGTGCTGGG + Intergenic
1042821089 8:72931030-72931052 CCTATTTAACAAATGGTGCTGGG - Intronic
1042967698 8:74372999-74373021 CCTATTTAACAAATGGTGCTGGG - Intronic
1042990205 8:74630929-74630951 CTCAATAAATATATGAAGCTGGG - Intronic
1042995899 8:74698265-74698287 CTTATTTAACAAATGGTGCTGGG + Intronic
1043027915 8:75094215-75094237 CCCATTTAATAAATGGTGCTCGG - Intergenic
1043237496 8:77886833-77886855 CCCATTCAACAAATGGTGCTGGG + Intergenic
1043279854 8:78449752-78449774 CTTATTTAATAAATGGTGCTGGG + Intergenic
1043378775 8:79680410-79680432 CTTATTTAATAAATGGTGCTGGG + Intergenic
1043693278 8:83184654-83184676 GTAAATTAAAAAATGGAGGTGGG + Intergenic
1043853137 8:85236827-85236849 CTCAATGAATAAAGGAAGCTGGG + Intronic
1043938445 8:86169710-86169732 CTTATTTAATAAATGGTGCTGGG - Intergenic
1044114250 8:88314903-88314925 CTGAGTTAAGGAATGGAGCTGGG - Intronic
1044196152 8:89378820-89378842 CTTATTTAATAAATGGTGCTGGG + Intergenic
1044221661 8:89677026-89677048 CCTATTTAACAAATGGTGCTGGG + Intergenic
1044273014 8:90269002-90269024 CCTATTTAACAAATGGTGCTGGG + Intergenic
1044315399 8:90744814-90744836 CCCTATTAATAAATGGAGCTGGG - Intronic
1044794505 8:95883187-95883209 CCTATTTAACAAATGGTGCTGGG - Intergenic
1045010609 8:97955555-97955577 CTCAATTAATAAATGTCACTGGG - Intronic
1045152801 8:99428045-99428067 CCCATTTAATAAATGGTGCTGGG + Intronic
1045365114 8:101468915-101468937 CTCTATTTACAAATGGAAATTGG - Intergenic
1045615099 8:103899952-103899974 CCTATTTAACAAATGGTGCTGGG - Intronic
1045633792 8:104159128-104159150 CTTATTTAATAAATGGTGCTGGG - Intronic
1045715463 8:105038427-105038449 CTTATTTAATAAATGGTGCTGGG + Intronic
1045716898 8:105057437-105057459 CTTATTTAATAAATGGTGCTGGG + Intronic
1045787102 8:105934563-105934585 CCTATTTAACAAATGGTGCTGGG + Intergenic
1045794631 8:106028203-106028225 CCTATTTAACAAATGGTGCTGGG + Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1045933087 8:107649437-107649459 CTCATTCAATAAATGGTGCTGGG - Intergenic
1046153723 8:110260691-110260713 CCTATTTAACAAATGGTGCTGGG + Intergenic
1046209553 8:111051135-111051157 TTCAATTAAAAAATAGATCTAGG + Intergenic
1046217053 8:111162334-111162356 CTCAGAAAACAAATGGATCTTGG + Intergenic
1046274362 8:111938180-111938202 CCTATTTAACAAATGGTGCTGGG + Intergenic
1046368454 8:113269721-113269743 CCTATTTAACAAATGGTGCTGGG + Intronic
1046467551 8:114626052-114626074 CTTATTCAACAAATGGTGCTGGG + Intergenic
1046520566 8:115319899-115319921 CCTATTTAACAAATGGTGCTGGG - Intergenic
1046554472 8:115757920-115757942 CCTATTTAACAAATGGTGCTGGG + Intronic
1046985766 8:120386804-120386826 CTTATTTAATAAATGGTGCTGGG - Intronic
1047170595 8:122488905-122488927 CCTATTTAACAAATGGTGCTGGG + Intergenic
1047579206 8:126194156-126194178 CCTATTTAACAAATGGTGCTGGG + Intergenic
1047939135 8:129810979-129811001 CTCTATTCATAAATGGTGCTAGG - Intergenic
1048122338 8:131595929-131595951 CCTATTTAATAAATGGAGCTGGG - Intergenic
1048373578 8:133802017-133802039 CCTATTTAACAAATGGTGCTGGG + Intergenic
1048597385 8:135880634-135880656 CCTATTTAACAAATGGTGCTGGG + Intergenic
1048675777 8:136777968-136777990 CTCAATTTAAAAATGCAGATAGG + Intergenic
1048792947 8:138120939-138120961 CCCATTTAATAAATGGTGCTGGG + Intergenic
1048858892 8:138708545-138708567 CCTATTTAACAAATGGTGCTGGG + Intronic
1049074844 8:140387075-140387097 CCTATTTAACAAATGGTGCTGGG + Intronic
1049160310 8:141093566-141093588 TTCAAATAAGAAATGGGGCTGGG - Intergenic
1050013564 9:1209620-1209642 CCTATTTAACAAATGGTGCTGGG + Intergenic
1050015481 9:1228646-1228668 CCTATTTAACAAATGGTGCTGGG + Intergenic
1050143728 9:2543463-2543485 CCTATTTAACAAATGGTGCTGGG - Intergenic
1050387447 9:5105821-5105843 CTTATTTAATAAATGGTGCTGGG + Intronic
1050468870 9:5963813-5963835 CCCATTTAATAAATGGTGCTGGG + Intronic
1050477835 9:6058885-6058907 CCTATTTAACAAATGGTGCTGGG - Intergenic
1050509688 9:6381182-6381204 CCTATTTAACAAATGGTGCTGGG + Intergenic
1050750456 9:8931194-8931216 CCTATTTAACAAATGGTGCTGGG - Intronic
1050882448 9:10719917-10719939 CCTATTTAACAAATGGTGCTGGG + Intergenic
1050954268 9:11635180-11635202 CCTATTTAACAAATGGTGCTAGG - Intergenic
1050985736 9:12079721-12079743 CCTATTTAACAAATGGTGCTGGG - Intergenic
1051090651 9:13403810-13403832 CCTATTTAACAAATGGTGCTGGG - Intergenic
1051143131 9:13999675-13999697 CCTATTTAACAAATGGTGCTGGG + Intergenic
1051327950 9:15993352-15993374 CCCTATTAATAAATGGTGCTGGG + Intronic
1051329367 9:16007665-16007687 CCCTATTAATAAATGGTGCTGGG - Intronic
1051645772 9:19266735-19266757 CTTATTTAATAAATGGTGCTGGG + Intronic
1051723296 9:20062399-20062421 CCCTATTAATAAATGGTGCTGGG + Intergenic
1051725045 9:20080385-20080407 CTTATTTAATAAATGGTGCTGGG + Intergenic
1051822627 9:21185407-21185429 CTTATTTAATAAATGGTGCTGGG - Intergenic
1051867578 9:21698415-21698437 CCTATTTAACAAATGGTGCTGGG - Intergenic
1051958370 9:22727100-22727122 CCTATTTAACAAATGGTGCTGGG - Intergenic
1052082585 9:24225882-24225904 CCCATTTAATAAATGGTGCTGGG - Intergenic
1052087170 9:24282248-24282270 CTTATTTAATAAATGGTGCTGGG + Intergenic
1052117227 9:24664065-24664087 CTTATTTAATAAATGGTGCTGGG - Intergenic
1052150321 9:25106889-25106911 CCTATTTAACAAATGGTGCTGGG + Intergenic
1052176313 9:25467256-25467278 CTTATTTAATAAATGGTGCTGGG - Intergenic
1052200186 9:25768782-25768804 CTTATTTAATAAATGGTGCTGGG + Intergenic
1052315573 9:27113287-27113309 CTCTCTTAATAAATGAAGCTTGG + Intronic
1052469570 9:28877484-28877506 CCTATTTAATAAATGGAGCTGGG - Intergenic
1052483059 9:29056820-29056842 CTTATTCAACAAATGGTGCTGGG - Intergenic
1052499862 9:29275094-29275116 CCTATTTAACAAATGGTGCTGGG + Intergenic
1052533804 9:29722687-29722709 CCTATTTAACAAATGGTGCTGGG - Intergenic
1052597926 9:30585448-30585470 CCTAATTAATAAATGGTGCTAGG + Intergenic
1052696381 9:31884390-31884412 CCTATTTAACAAATGGTGCTGGG - Intergenic
1053400566 9:37816637-37816659 CTCAATTAACATCTGCACCTGGG + Intronic
1053521463 9:38784262-38784284 CCTATTTAACAAATGGTGCTGGG + Intergenic
1054193629 9:62008255-62008277 CCTATTTAACAAATGGTGCTGGG + Intergenic
1054425877 9:65066766-65066788 CCCATTTAATAAATGGTGCTGGG + Intergenic
1054644778 9:67580436-67580458 CCTATTTAACAAATGGTGCTGGG - Intergenic
1055378577 9:75680080-75680102 CTCAATTAAAAAAGGGACCAAGG + Intergenic
1055385754 9:75760461-75760483 CCTATTTAACAAATGGTGCTGGG - Intergenic
1055677681 9:78681414-78681436 CCTAATTAAAAAATGGAGATGGG - Intergenic
1055760999 9:79607605-79607627 CCCATTTAATAAATGGTGCTGGG - Intronic
1056076893 9:83050775-83050797 CCTATTTAACAAATGGTGCTGGG - Intronic
1056885479 9:90439355-90439377 CTTATTTAATAAATGGTGCTGGG - Intergenic
1057697182 9:97332121-97332143 CCCATTTAATAAATGGTGCTGGG - Intronic
1058085546 9:100744388-100744410 CCTATTTAACAAATGGTGCTGGG - Intergenic
1058088717 9:100780048-100780070 CCTATTTAACAAATGGTGCTGGG + Intergenic
1058090487 9:100800440-100800462 CCTATTTAACAAATGGTGCTGGG + Intergenic
1058224405 9:102342104-102342126 CTTATTTAACAAATGGTGCTGGG + Intergenic
1058354114 9:104062512-104062534 CCCTATTAATAAATGGTGCTGGG + Intergenic
1058443095 9:105028599-105028621 TTAAATTCACAAAGGGAGCTTGG + Intergenic
1058494780 9:105544659-105544681 CCTATTTAACAAATGGTGCTGGG - Intronic
1058496883 9:105568050-105568072 CCTATTTAACAAATGGTGCTGGG + Intronic
1058554180 9:106148830-106148852 CCTATTTAACAAATGGTGCTGGG - Intergenic
1058595381 9:106609872-106609894 CTTATTTAACAAACGGTGCTGGG + Intergenic
1058909965 9:109511971-109511993 ATAAATGAACAAATGGATCTTGG + Intergenic
1059126969 9:111698425-111698447 CTTATTTAATAAATGGTGCTGGG - Intronic
1059131181 9:111751077-111751099 CTTATTTAATAAATGGTGCTGGG - Intronic
1059363025 9:113761998-113762020 ATAATTTAACAAATGGTGCTAGG + Intergenic
1059594967 9:115709928-115709950 CCCATTCAACAAATGGTGCTGGG - Intergenic
1059673098 9:116510239-116510261 CCTATTTAACAAATGGTGCTGGG - Intronic
1059675271 9:116532594-116532616 CTTATTTAACAAATGGTGCTGGG - Intronic
1059792786 9:117658797-117658819 CCTATTTAACAAATGGTGCTGGG - Intergenic
1060415836 9:123429602-123429624 CCTATTTAACAAATGGTGCTGGG + Intronic
1202804082 9_KI270720v1_random:34102-34124 CTTATTTAATAAATGGTGCTGGG + Intergenic
1185951112 X:4435317-4435339 CACATTTAACAAATACAGCTTGG - Intergenic
1185954125 X:4470577-4470599 ATCAGTTAATAAATGGAGGTAGG + Intergenic
1186219636 X:7335841-7335863 CCTATTTAACAAATGGTGCTGGG - Intronic
1186531924 X:10305559-10305581 CCTATTTAACAAATGGTGCTGGG - Intergenic
1186594656 X:10967804-10967826 CCCATTTAATAAATGGTGCTGGG - Intergenic
1186644683 X:11493992-11494014 TTCATTTCAGAAATGGAGCTGGG - Intronic
1187316269 X:18197960-18197982 CCTATTTAACAAATGGTGCTGGG + Intronic
1187635151 X:21219849-21219871 CCTATTTAACAAATGGTGCTGGG - Intergenic
1187636061 X:21229680-21229702 CCTATTTAACAAATGGTGCTGGG - Intergenic
1187647103 X:21359159-21359181 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188075887 X:25774707-25774729 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188176565 X:26998002-26998024 CTTATTCAACAAATGGTGCTGGG + Intergenic
1188198135 X:27264284-27264306 CTTATTTAATAAATGGTGCTGGG + Intergenic
1188296985 X:28461622-28461644 CCCATTTAATAAATGGTGCTGGG + Intergenic
1188370853 X:29367872-29367894 CTCTATTAATAAGTGGTGCTGGG - Intronic
1188388935 X:29595967-29595989 CCTATTTAACAAATGGTGCTGGG - Intronic
1188397865 X:29706706-29706728 CCTATTTAACAAATGGTGCTGGG + Intronic
1188730572 X:33640787-33640809 CCTATTTAACAAATGGTGCTGGG + Intergenic
1188935570 X:36171530-36171552 CTTATTTAATAAATGGTGCTGGG - Intergenic
1188940369 X:36230843-36230865 CTTATTTAATAAATGGTGCTGGG - Intronic
1189018146 X:37305907-37305929 CCTATTTAACAAATGGTGCTGGG - Intergenic
1189722639 X:43936253-43936275 CTTAGTTAATAAATGGTGCTGGG + Intergenic
1189733554 X:44046969-44046991 CCTAATCAACAAATGGTGCTGGG - Intergenic
1191002724 X:55678301-55678323 CCTATTTAACAAATGGTGCTGGG - Intergenic
1191023032 X:55883208-55883230 CTTATTTAATAAATGGTGCTGGG + Intergenic
1191032356 X:55988434-55988456 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191037997 X:56048500-56048522 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191042711 X:56102183-56102205 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191047468 X:56154362-56154384 CCTATTTAACAAATGGTGCTGGG + Intergenic
1191050746 X:56188778-56188800 CGTATTTAACAAATGGTGCTGGG + Intergenic
1191076007 X:56454115-56454137 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191100693 X:56724219-56724241 CCTAATCAACAAATGGTGCTGGG + Intergenic
1191127401 X:56972409-56972431 CCTATTTAACAAATGGTGCTGGG + Intergenic
1191131799 X:57021710-57021732 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191165323 X:57384082-57384104 CCTATTTAACAAATGGTGCTGGG + Intronic
1191261434 X:58326320-58326342 CCTATTTAACAAATGGTGCTGGG + Intergenic
1191579732 X:62747090-62747112 CTTATTTAATAAATGGTGCTGGG + Intergenic
1191765227 X:64691197-64691219 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191792832 X:64988951-64988973 CTTATTTAATAAATGGTGCTGGG - Intronic
1191827832 X:65384881-65384903 CCTATTTAACAAATGGTGCTGGG - Intronic
1191931513 X:66378428-66378450 CTTATTTAATAAATGGTGCTGGG - Intergenic
1191966304 X:66762312-66762334 CACAGTTAACAAGTGGTGCTGGG - Intergenic
1191997300 X:67109322-67109344 CTTATTCAACAAATGGTGCTGGG - Intergenic
1192475913 X:71442894-71442916 CTAATTTAATAAATGGTGCTGGG - Intronic
1192701334 X:73477481-73477503 CTTATTTAATAAATGGTGCTGGG - Intergenic
1192767040 X:74151182-74151204 CTCATTCAATAAATGGTGCTGGG + Intergenic
1192929860 X:75794676-75794698 CTTATTTAACAAATGGCGCTGGG - Intergenic
1192945486 X:75962422-75962444 CCTATTTAACAAATGGTGCTGGG - Intergenic
1193110553 X:77725380-77725402 CCTATTTAACAAATGGTGCTGGG + Intronic
1193231845 X:79056618-79056640 CCTATTTAACAAATGGTGCTGGG - Intergenic
1193384950 X:80858749-80858771 CCCTATTAATAAATGGTGCTGGG - Intergenic
1193409998 X:81151180-81151202 CCTATTTAACAAATGGTGCTGGG - Intronic
1193464588 X:81832876-81832898 CCTATTTAACAAATGGTGCTGGG + Intergenic
1193530996 X:82654260-82654282 TTCAATTTACACATGGGGCTGGG - Intergenic
1193572060 X:83156071-83156093 CTTATTTAATAAATGGTGCTGGG + Intergenic
1194012170 X:88575770-88575792 CTTATTCAACAAATGGTGCTGGG - Intergenic
1194014602 X:88603772-88603794 CTCATTTAATAAATAGTGCTGGG - Intergenic
1194078746 X:89431710-89431732 CCTATTTAATAAATGGAGCTGGG - Intergenic
1194145572 X:90257621-90257643 CCCTATTAATAAATGGTGCTGGG + Intergenic
1194164708 X:90501009-90501031 CCCAATTAACAAATGGTCCCTGG + Intergenic
1194588731 X:95770491-95770513 CCCATTTAATAAATGGTGCTGGG + Intergenic
1194625223 X:96219423-96219445 CTTATTTAATAAATGGTGCTGGG + Intergenic
1194630260 X:96274274-96274296 CTTATTTAATAAATGGTGCTGGG + Intergenic
1194909250 X:99618970-99618992 CCTATTTAACAAATGGTGCTGGG + Intergenic
1195148246 X:102040111-102040133 CCTATTTAACAAATGGTGCTGGG + Intergenic
1195248702 X:103021694-103021716 CCTATTTAACAAATGGTGCTGGG - Intergenic
1195436320 X:104847425-104847447 CCTATTTAACAAATGGTGCTGGG - Intronic
1195507467 X:105674401-105674423 CTCATTTAATAAATGGTGCTGGG - Intronic
1195523767 X:105861596-105861618 GTCTTTTAACAAATGGAGCTGGG - Intronic
1195543088 X:106085612-106085634 CCTATTTAACAAATGGTGCTGGG + Intergenic
1195648436 X:107259389-107259411 GTCAGGTAACAAATGGTGCTTGG - Intergenic
1195722742 X:107882114-107882136 CCTATTTAACAAATGGTGCTGGG + Intronic
1195820451 X:108939630-108939652 CTTATTTAATAAATGGTGCTAGG - Intergenic
1195957213 X:110344252-110344274 CGTATTTAACAAATGGTGCTGGG + Intronic
1195970529 X:110468329-110468351 CCTATTTAACAAATGGTGCTGGG - Intergenic
1195986996 X:110641244-110641266 CCTATTTAACAAATGGTGCTGGG - Intergenic
1196204516 X:112924130-112924152 CCTATTTAACAAATGGTGCTGGG - Intergenic
1196204845 X:112927750-112927772 CTTATTCAACAAATGGTGCTGGG + Intergenic
1196228918 X:113198383-113198405 CCCATTTAATAAATGGTGCTGGG - Intergenic
1196356157 X:114795597-114795619 CTTATTTAATAAATGGTGCTGGG - Intronic
1196467409 X:115986765-115986787 CCCATTTAATAAATGGTGCTGGG + Intergenic
1196472807 X:116048138-116048160 CTTATTTAATAAATGGTGCTGGG - Intergenic
1196541726 X:116918362-116918384 CATATTTAACAAATGGTGCTGGG - Intergenic
1196559637 X:117129883-117129905 CATATTTAACAAATGGTGCTGGG + Intergenic
1196697484 X:118628897-118628919 CTCAATTTACAAATGAAAATTGG + Intronic
1196901314 X:120386297-120386319 CCTATTTAACAAATGGTGCTGGG - Intergenic
1196945171 X:120817057-120817079 CTTATTTAATAAATGGTGCTGGG + Intergenic
1196946122 X:120828303-120828325 CCTATTTAACAAATGGTGCTGGG - Intergenic
1196993950 X:121360145-121360167 CTTATTTAATAAATGGTGCTGGG + Intergenic
1197007939 X:121525622-121525644 ATCATTTAATAAATGGTGCTGGG + Intergenic
1197469521 X:126850309-126850331 CCTATTTAACAAATGGTGCTGGG + Intergenic
1197510798 X:127366998-127367020 CCTATTTAACAAATGGTGCTGGG + Intergenic
1197527995 X:127586201-127586223 CTTATTTAATAAATGGTGCTGGG + Intergenic
1197569894 X:128136540-128136562 CTTATTTAATAAATGGTGCTGGG + Intergenic
1198183373 X:134231630-134231652 CACAATTAGTAAGTGGAGCTGGG - Intergenic
1198547186 X:137704809-137704831 TTCAATAAAAAAATTGAGCTGGG - Intergenic
1198644615 X:138792616-138792638 TTCAGTGAACAAATGGACCTAGG + Intronic
1198695831 X:139336518-139336540 CTTATTCAACAAATGGTGCTAGG - Intergenic
1199022061 X:142892704-142892726 CCTATTTAATAAATGGAGCTGGG - Intergenic
1199026938 X:142950704-142950726 CTTATTTAATAAATGGTGCTGGG - Intergenic
1199080851 X:143575425-143575447 CTTATTTAATAAATGGTGCTGGG - Intergenic
1199359605 X:146903513-146903535 CCCATTTAATAAATGGTGCTGGG + Intergenic
1199376288 X:147113644-147113666 CCCATTTAATAAATGGTGCTGGG + Intergenic
1199397341 X:147354522-147354544 CCTATTTAACAAATGGTGCTGGG + Intergenic
1199542527 X:148973007-148973029 CCTATTTAACAAATGGTGCTGGG - Intronic
1199641156 X:149863393-149863415 CCCATTCAACAAATGGTGCTGGG + Intergenic
1199739857 X:150724819-150724841 CTTATTCAACAAATGGTGCTGGG - Intronic
1199839330 X:151628438-151628460 CCTATTTAACAAATGGTGCTGGG - Intronic
1199842819 X:151667613-151667635 CCTATTTAACAAATGGTGCTGGG - Intronic
1199929216 X:152501688-152501710 CCCATTTAATAAATGGTGCTGGG - Intergenic
1200321121 X:155190901-155190923 CCCATTTAATAAATGGTGCTGGG - Intergenic
1200389708 X:155931940-155931962 CCTATTTAACAAATGGTGCTGGG - Intronic
1200431366 Y:3087048-3087070 CCTATTTAATAAATGGAGCTGGG - Intergenic
1200491325 Y:3826920-3826942 CCCTATTAATAAATGGTGCTGGG + Intergenic
1200510968 Y:4078803-4078825 CCCAATTAACAAATGGTCCCTGG + Intergenic
1200530731 Y:4333440-4333462 CCCATTCAACAAATGGTGCTGGG + Intergenic
1200604773 Y:5249495-5249517 CCTATTTAACAAATGGTGCTGGG + Intronic
1200704668 Y:6431869-6431891 CCTATTTAACAAATGGTGCTGGG - Intergenic
1200771628 Y:7131052-7131074 CCTATTTAACAAATGGTGCTGGG - Intergenic
1200870944 Y:8097695-8097717 CCTATTTAACAAATGGTGCTGGG - Intergenic
1200889386 Y:8306926-8306948 CCCTATTAATAAATGGTGCTGGG - Intergenic
1201029443 Y:9732839-9732861 CCTATTTAACAAATGGTGCTGGG + Intergenic
1201245443 Y:11998810-11998832 CTTATTTAAGAAATGGTGCTGGG - Intergenic
1201246447 Y:12008612-12008634 CCTATTTAACAAATGGTGCTGGG - Intergenic
1201314005 Y:12625249-12625271 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201582714 Y:15527482-15527504 CCCATTTAATAAATGGTGCTGGG - Intergenic
1201615271 Y:15890207-15890229 CCCATTTAATAAATGGTGCTGGG + Intergenic
1201679183 Y:16623526-16623548 CCTATTTAACAAATGGTGCTGGG + Intergenic
1201761871 Y:17549241-17549263 CCTACTTAACAAATGGTGCTGGG - Intergenic
1201787875 Y:17805556-17805578 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201795688 Y:17894450-17894472 CTTATTTAATAAATGGTGCTGGG + Intergenic
1201796240 Y:17899534-17899556 CCTAATTAATAAATGGTGCTGGG + Intergenic
1201805315 Y:18006451-18006473 CCTAATTAATAAATGGTGCTGGG - Intergenic
1201805867 Y:18011535-18011557 CTTATTTAATAAATGGTGCTGGG - Intergenic
1201813678 Y:18100432-18100454 CTTATTTAATAAATGGTGCTGGG + Intergenic
1201839681 Y:18356749-18356771 CCTACTTAACAAATGGTGCTGGG + Intergenic
1201913991 Y:19162896-19162918 CTTATTTAATAAATGGTGCTGGG + Intergenic
1202034303 Y:20616093-20616115 CCTATTTAACAAATGGTGCTGGG - Intergenic
1202069977 Y:20981099-20981121 CCTATTTAACAAATGGTGCTGGG - Intergenic
1202357111 Y:24063542-24063564 CTTATTTAATAAATGGTGCTGGG + Intergenic
1202513666 Y:25606572-25606594 CTTATTTAATAAATGGTGCTGGG - Intergenic