ID: 999626175

View in Genome Browser
Species Human (GRCh38)
Location 5:153522619-153522641
Sequence GGATGGTCCCTCTTTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999626175_999626178 0 Left 999626175 5:153522619-153522641 CCAAGCTGAAAGAGGGACCATCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 999626178 5:153522642-153522664 TAACATGATCACAGTGTCAAAGG No data
999626175_999626179 26 Left 999626175 5:153522619-153522641 CCAAGCTGAAAGAGGGACCATCC 0: 1
1: 0
2: 0
3: 8
4: 132
Right 999626179 5:153522668-153522690 TTATGTAATAAGCCACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999626175 Original CRISPR GGATGGTCCCTCTTTCAGCT TGG (reversed) Intronic
900689171 1:3969474-3969496 GAAAGTTCCCTCTTTCAGTTTGG + Intergenic
902092363 1:13913641-13913663 GCATGGCCCTGCTTTCAGCTAGG + Intergenic
902205840 1:14867459-14867481 GGATGGTGCATCCTCCAGCTGGG + Intronic
903116316 1:21181314-21181336 GAAGGGTCCCTAGTTCAGCTTGG - Intergenic
904256698 1:29259184-29259206 GGAGGTGCCCACTTTCAGCTCGG - Intronic
905871878 1:41409048-41409070 GGATGGAGCCTCCTTCAGCCTGG + Intergenic
907803656 1:57796789-57796811 GTCTGGTCCCTCCCTCAGCTTGG + Intronic
910748211 1:90597363-90597385 GGCTAGTTCCTCTATCAGCTGGG + Intergenic
911659418 1:100484333-100484355 GGATGGTCGATTTTTCAGTTTGG - Exonic
1063688852 10:8264366-8264388 GGATGGACCCTGTTTAGGCTTGG + Intergenic
1069255175 10:66323624-66323646 GGATTCTCCCTCTTTCACCCAGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074988704 10:118682162-118682184 TTATGGTGCCTCTTTTAGCTTGG - Exonic
1076058156 10:127392299-127392321 GGATGGTCCCTGGAGCAGCTGGG - Intronic
1076576591 10:131473884-131473906 GGCTGCTCCTTCTTTCAGGTGGG - Intergenic
1082167637 11:48966209-48966231 GGATGACCCTTCTTTCAGTTGGG + Intergenic
1082235912 11:49820441-49820463 GGATGACCCTTCTTTCAGTTGGG - Intergenic
1082239373 11:49854997-49855019 GGATGACCCTTCTTTCAGTTGGG - Intergenic
1082242774 11:49889355-49889377 GGATGACCCTTCTTTCAGTTGGG + Intergenic
1082657267 11:55870164-55870186 GGATGACCCTTCTTTCAGTTGGG + Intergenic
1087232702 11:95683992-95684014 GGCTGGCCTCACTTTCAGCTGGG - Intergenic
1091532179 12:1369555-1369577 GCATGCTGCCTCTTCCAGCTTGG + Intronic
1091696157 12:2629682-2629704 GTATGCTGCCTCTTTCAACTTGG + Intronic
1095601335 12:44016378-44016400 GGATGGTCCCGTTTCCACCTGGG - Intronic
1102964398 12:117114730-117114752 GGTTGGTCTCTTTTGCAGCTGGG - Intergenic
1106183214 13:27385823-27385845 GCATGGTCCCTCTTACAGTTCGG + Intergenic
1109309832 13:60679351-60679373 GCATGGTCCCTCTTCCACCCCGG - Intergenic
1110376089 13:74795163-74795185 GCAAGGTCCCTCTTTCAACAGGG + Intergenic
1110955889 13:81551457-81551479 GGTTGCTTCCTCTTTCACCTAGG - Intergenic
1111423786 13:88052526-88052548 GGGTGGTCACTCTCTCAGCATGG + Intergenic
1112495471 13:99900520-99900542 GGATGGTGCCCCCTTCAGCCAGG - Intergenic
1116572150 14:46531987-46532009 GGAGTCTCCCTCTTTCAGCCAGG + Intergenic
1119849518 14:77857099-77857121 GGATGGGCCCTCTGGCTGCTGGG + Intronic
1123939664 15:25210749-25210771 CCATGGTGCCTCTTTGAGCTTGG + Intergenic
1125003217 15:34793149-34793171 GGATTATCCCTTTTTCAACTGGG + Intronic
1126757932 15:51942310-51942332 GGATGGTTCCTGTAACAGCTAGG + Intronic
1132319507 15:100915234-100915256 GAATGGTCCCACCTTCACCTCGG - Exonic
1135135333 16:19882942-19882964 GGAGGGCCCCTCTTCTAGCTGGG + Intronic
1136545067 16:30949939-30949961 GGACGGGCCCACCTTCAGCTGGG - Intronic
1138048779 16:53754073-53754095 TTATGATCCCTCTTTTAGCTAGG + Intronic
1138582568 16:57951105-57951127 GGGTGGTCCCAATTTCAGATGGG + Intronic
1140225321 16:73071970-73071992 GGATGATACCCCTTTTAGCTTGG + Intergenic
1147958068 17:44148646-44148668 GAATGGTCCCTCTAGCAGCTTGG - Exonic
1149046696 17:52254883-52254905 GGGGATTCCCTCTTTCAGCTTGG - Intergenic
1150130908 17:62668427-62668449 GGATGGTGCCTGTTGCAGTTTGG + Intronic
1151506675 17:74532405-74532427 CGAGGTTCCCTCTTTCAGCTTGG + Intergenic
1157613412 18:48973354-48973376 GGCTGGGCCCTCTTTCAGGTTGG + Intergenic
1158568210 18:58573919-58573941 GGATGGTCCATCTTTCTGTCTGG - Intronic
1161463409 19:4412959-4412981 GGATGGAGTCTCTCTCAGCTGGG - Intronic
1164503038 19:28835404-28835426 GGATGGTCTCTGTTTCCTCTGGG - Intergenic
1167272035 19:48511337-48511359 GGACGGTGCCTCTGTCAGCAGGG - Intronic
1167624368 19:50577805-50577827 GGGTGGTTCCTCTTTAAGATGGG - Intergenic
926445426 2:12935951-12935973 TAAAGGTCCCTTTTTCAGCTTGG + Intergenic
935322491 2:101902485-101902507 GGAGGCTCACTCTTTCACCTTGG - Intergenic
936267042 2:111018616-111018638 GAATGGTCACTCTCTCAGCACGG - Intronic
936549532 2:113424479-113424501 GGAAGTTTTCTCTTTCAGCTGGG + Intergenic
942133066 2:172899655-172899677 GGATGATCCGTTTTTCTGCTGGG + Intronic
1168845221 20:939963-939985 GGATGGTTCCTGCTTCAGATGGG - Intergenic
1171256624 20:23693485-23693507 GAATGGTTCCTCTTCCTGCTTGG + Intergenic
1171416041 20:24981076-24981098 GGATGGTCGCTCTTCCAGTCTGG + Intronic
1173252227 20:41370079-41370101 GGCTGGACCCTGTTTGAGCTTGG + Intergenic
1177825088 21:26074022-26074044 GGATGGTATCTTTATCAGCTGGG - Intronic
1177849224 21:26326643-26326665 GGAAGGTACCTCTTTTAGATGGG + Intergenic
1177849245 21:26326945-26326967 GGAGGGTACCTCTTTTAGATGGG - Intergenic
1179624765 21:42642670-42642692 GGAAGACCCCTCATTCAGCTTGG + Intergenic
1183804266 22:40194785-40194807 GGCTGGTCCCTCCACCAGCTTGG + Intronic
950753715 3:15154487-15154509 GGATAGACCCTCCTTCAGCCTGG + Intergenic
957611531 3:82473034-82473056 GCTTAGTCCCTATTTCAGCTAGG - Intergenic
959117369 3:102194232-102194254 GGATCGTCTTTCTTTCAGCTTGG - Intronic
961264048 3:125625965-125625987 GGATGGACCCTCTATCTTCTGGG + Intergenic
961338226 3:126198365-126198387 GGAGGGTCCCTCCTGCAGCCAGG + Intergenic
961432654 3:126894081-126894103 TGATTGTCCTTCCTTCAGCTGGG + Intronic
962978042 3:140463407-140463429 GGATGGTCCCCCTGCCTGCTAGG + Intronic
967937844 3:194743273-194743295 AAATGGCCCCGCTTTCAGCTGGG + Intergenic
969144774 4:5113026-5113048 AGATGGAGCCTCTGTCAGCTGGG + Intronic
970037813 4:11758280-11758302 GGATTCTCCCTCTGTCACCTAGG - Intergenic
972065638 4:34939716-34939738 GGATGGTCTCTCTTGCAGTGTGG + Intergenic
972245284 4:37240753-37240775 TGATGGGCACTCTTTCTGCTGGG + Intergenic
975418911 4:74139303-74139325 GGATGGTACTTCTTACAGCATGG + Intronic
977431591 4:96937206-96937228 GGAGAGTCCATCTTTGAGCTTGG - Intergenic
977804417 4:101279752-101279774 GGCTCTTCCCTCTTTCAGCTTGG - Intronic
981228089 4:142320270-142320292 AGATGATCTCTCTTTCAACTAGG + Intronic
982898303 4:160963101-160963123 GAATTGTCCATCCTTCAGCTTGG - Intergenic
982999173 4:162390157-162390179 GGATGATCCCTATTTCAGTTGGG - Intergenic
984340857 4:178454221-178454243 AGATGGTGGCTCTGTCAGCTCGG - Intergenic
984897016 4:184549906-184549928 GGATGGTCTCTCTCTCAACATGG - Intergenic
986748352 5:10762864-10762886 GGCTGCTCACTCTGTCAGCTTGG + Intergenic
986753028 5:10807203-10807225 TGATGATGCCTGTTTCAGCTTGG + Intergenic
988883985 5:35535150-35535172 GGTTGGTCTCTCTTTCACATAGG + Intergenic
989142895 5:38219640-38219662 GGAGTGTCCCTCTGTCACCTAGG - Intergenic
990012477 5:51017030-51017052 GGATGGTTCCTCTTTTGGCTTGG - Intergenic
995540541 5:113182025-113182047 TCATGCTCCCTCTGTCAGCTCGG + Intronic
997801503 5:136867266-136867288 TTTTGGTCCCTCTCTCAGCTTGG - Intergenic
999626175 5:153522619-153522641 GGATGGTCCCTCTTTCAGCTTGG - Intronic
1000289313 5:159855333-159855355 GGATGGTCCCTTGTTCTTCTTGG + Intergenic
1000757563 5:165180693-165180715 GGATTTTCCCTCTTTCTTCTTGG + Intergenic
1007514703 6:42401725-42401747 GCATGTTCCCTCTTGCAGGTGGG - Intronic
1007515011 6:42404054-42404076 GCATGTTCCCTCTTGCAGGTGGG - Intronic
1007808513 6:44469784-44469806 GGTAGGTCCCTCTTTCATCAGGG - Intergenic
1013604911 6:111738751-111738773 AGATGTTTCCTCTTTCAGCCAGG - Intronic
1015705830 6:136086450-136086472 GGGGGTTCCCTCATTCAGCTTGG - Intronic
1016191014 6:141264236-141264258 GGATGGTGCCTCACTCAGGTTGG - Intergenic
1020152455 7:5693570-5693592 TGAAGTTCCCTCTTTAAGCTTGG - Intronic
1022329241 7:29361972-29361994 GTCTGATCCCTCTTTCAGCAAGG + Intronic
1022362454 7:29675221-29675243 GTATGGGCCTTCTTTAAGCTGGG - Intergenic
1022428834 7:30295132-30295154 GTATGGGCCTTCTTTAAGCTGGG + Intronic
1022698946 7:32738574-32738596 GTATGGGCCTTCTTTAAGCTGGG + Intergenic
1024283517 7:47738125-47738147 GGCTGGTCCATCTTTCACTTGGG + Intronic
1025144380 7:56491997-56492019 GGATGGTTGCTCTTTGAGCCTGG + Intergenic
1025259988 7:57412476-57412498 GGATGGTTGCTCTTTGAGCCTGG + Intergenic
1026832927 7:73621412-73621434 GGCTGGTCCCTGATTCAGGTGGG + Intronic
1034951420 7:155298970-155298992 GGAAGGGCCCTCAGTCAGCTTGG - Intronic
1037309077 8:17535875-17535897 GGAGTGTCCCTCTTTCACCCAGG - Intronic
1038807112 8:30804434-30804456 GGATGATCCCACTATCAGTTTGG + Intronic
1039441691 8:37599428-37599450 GGCTGGCCCCTCCTTCACCTTGG - Intergenic
1040124537 8:43722013-43722035 GGATAGTCCCTTTTTCACCATGG - Intergenic
1041511579 8:58659543-58659565 GGCTGGGCCCTTCTTCAGCTGGG + Intronic
1043473678 8:80585382-80585404 AGATGGAGCCTCTGTCAGCTGGG + Intergenic
1044360394 8:91276676-91276698 GGACTGTCCCTCTTTCTACTTGG + Intronic
1044836996 8:96305554-96305576 GGTTGGTCCAAGTTTCAGCTGGG - Intronic
1045803823 8:106133314-106133336 GCATGGTGCCTCCTTCTGCTCGG - Intergenic
1046406234 8:113776092-113776114 GGAAAGTCCCTCGTTTAGCTGGG - Intergenic
1047757231 8:127927991-127928013 AGATGGCCCCTCTACCAGCTTGG - Intergenic
1049903414 9:192349-192371 GGAAGTTTTCTCTTTCAGCTGGG - Intergenic
1053600080 9:39601905-39601927 GGGTGGTCTCTCTCTCAGCGTGG - Intergenic
1053746421 9:41202643-41202665 GGAAGTTTTCTCTTTCAGCTGGG - Intergenic
1054253445 9:62740479-62740501 GGGTGGTCTCTCTCTCAGCGTGG + Intergenic
1054480845 9:65662579-65662601 GGAAGTTTTCTCTTTCAGCTGGG + Intergenic
1054681922 9:68228635-68228657 GGAAGTTTTCTCTTTCAGCTGGG + Intergenic
1060165510 9:121410948-121410970 ATTTGCTCCCTCTTTCAGCTGGG + Intergenic
1060980770 9:127790410-127790432 GGATGGTCCCTCAGACTGCTGGG + Exonic
1061907479 9:133706065-133706087 GTATGGTGCATCTTTCTGCTAGG - Intronic
1061972568 9:134052927-134052949 GGATGGCCCATCTGCCAGCTTGG - Intronic
1062075416 9:134585998-134586020 CGCTGGTCTCTCTTTAAGCTGGG + Intergenic
1202782553 9_KI270718v1_random:13418-13440 GGAAGTTTTCTCTTTCAGCTGGG - Intergenic
1186376312 X:9005377-9005399 GGATTCTCCCTCTGTCACCTAGG - Intergenic
1186421877 X:9433078-9433100 GGATGGATCTTCTTTCAGATGGG - Intergenic
1190147797 X:47912785-47912807 TGATGGTGCCACTTTCAGATGGG - Intronic
1190641429 X:52484579-52484601 GGATGGTTGCTCTTTGAGCCTGG - Intergenic
1190646243 X:52528286-52528308 GGATGGTTGCTCTTTGAGCCTGG + Intergenic
1192679383 X:73235937-73235959 GAATGGACCCTCTTTCGGCCAGG + Intergenic