ID: 999628409

View in Genome Browser
Species Human (GRCh38)
Location 5:153544310-153544332
Sequence GACCCATTGCCTGTTGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 123}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999628409 Original CRISPR GACCCATTGCCTGTTGCCAG AGG (reversed) Intronic
902712486 1:18249878-18249900 GCCTCATTTCCTGCTGCCAGGGG + Intronic
905321572 1:37120888-37120910 CACCCTTTGCCTGTTGCCATAGG - Intergenic
906177911 1:43791896-43791918 TACCCCTTGCCTCCTGCCAGAGG - Intronic
906704072 1:47881973-47881995 GACGCATTGCCTGTGGGGAGAGG + Intronic
907091478 1:51729712-51729734 GACCCATGGCCAATCGCCAGGGG + Intronic
915036177 1:152927252-152927274 GCCACATGGCCTCTTGCCAGAGG - Intergenic
915447436 1:155981962-155981984 GACCCATGGCCTGTGGTGAGAGG + Intronic
916106125 1:161433721-161433743 GATTCATTGGCTGTGGCCAGTGG - Intergenic
918775623 1:188626254-188626276 GACCCATAGGATGTAGCCAGTGG + Intergenic
922780939 1:228251776-228251798 GACCCATTGGGTGATGACAGGGG + Intronic
923994493 1:239477646-239477668 CACCCATTGACTTTTTCCAGTGG + Intronic
1068468276 10:57425208-57425230 GAGCCATTGCATGTGGCCATTGG - Intergenic
1068757652 10:60672397-60672419 AGCCCATTGCCTCTTCCCAGAGG - Intronic
1069057601 10:63860947-63860969 TACCCATTGGCTGTTACCATTGG + Intergenic
1073918400 10:108431755-108431777 GACTCATGGGCTGTAGCCAGTGG - Intergenic
1074153106 10:110776068-110776090 GAGCCAATCACTGTTGCCAGAGG + Intronic
1075178066 10:120184198-120184220 GCTCCATTGCCTCTTGGCAGGGG + Intergenic
1076014382 10:127015795-127015817 TACCCATTCCCTGTAGCCACAGG + Intronic
1076362697 10:129900579-129900601 GACTCACTGCCTGATGCCAAAGG + Intronic
1078296515 11:10076637-10076659 CTCCCATGGCCTGCTGCCAGTGG - Intronic
1078322791 11:10351949-10351971 GTGTCATTGCCTGTTGACAGTGG + Intronic
1078839885 11:15068667-15068689 GAGCCATTAGCTGATGCCAGAGG + Intronic
1081532421 11:43971489-43971511 GTTCCATTGCTTGTTGCCTGGGG - Intergenic
1082760678 11:57124133-57124155 GACCCATGTCCTGTTGATAGAGG - Intergenic
1084554192 11:69865944-69865966 GGGGCATTGCCTGTTCCCAGAGG - Intergenic
1089203496 11:116739846-116739868 TACCCATTGCCCCTTGTCAGGGG - Intergenic
1092578148 12:9812471-9812493 GACAGATTGCCTGATGCCAGCGG - Intergenic
1096629223 12:52914962-52914984 GAACCAATCCCTGTGGCCAGGGG + Intronic
1097103326 12:56604741-56604763 GACACATTGTCTCTTGTCAGTGG + Exonic
1103555963 12:121766601-121766623 GAGCCAGTCACTGTTGCCAGAGG + Intronic
1104032882 12:125078115-125078137 CACTCACTGCCTGTTTCCAGTGG - Intronic
1104553456 12:129778885-129778907 AACCCAGTGTCTGTTGCCACAGG - Intronic
1106244766 13:27939781-27939803 GACCAATAGCCCGTTGCCAAAGG - Intergenic
1106765703 13:32911623-32911645 GACCAATTGCCTGTGCCCATGGG + Intergenic
1107147395 13:37073255-37073277 GGCCAATTGCCTGATGGCAGGGG + Intergenic
1114842582 14:26282625-26282647 GAACTATTGCCTATTACCAGTGG + Intergenic
1120210510 14:81629336-81629358 GACCCATTGCCTGAGGTCTGAGG + Intergenic
1120555920 14:85929888-85929910 GATTCATGGCCTGTAGCCAGTGG - Intergenic
1124477339 15:30045879-30045901 AAGCCATTCCCTGCTGCCAGGGG - Intergenic
1124688600 15:31803236-31803258 GACACATTGCCTGCTGCCCAGGG + Intronic
1124829805 15:33137275-33137297 TCCCCATTCCCTGTTGCCATGGG + Intronic
1137494999 16:48962734-48962756 GAAGCATGGCCTGGTGCCAGTGG + Intergenic
1139908144 16:70380727-70380749 CACCCATCGCCTCTTGCCTGGGG - Exonic
1142212099 16:88813178-88813200 GACCCATCGTCTGATGCCAAGGG + Intergenic
1150235156 17:63586932-63586954 GACACATTACCTGTTGATAGAGG - Intronic
1152918644 17:83054571-83054593 GACTCAGTACCAGTTGCCAGGGG + Intergenic
1157950256 18:52028799-52028821 GACCCCTTATCTGTTGACAGAGG - Intergenic
1160290552 18:77589491-77589513 GAGCCATTGCCTGTGGCCGTAGG - Intergenic
1162018135 19:7856624-7856646 AACCCACTTCCTGTGGCCAGTGG - Intronic
1163535108 19:17872399-17872421 GACCCACAGCCCGATGCCAGTGG - Exonic
1166360273 19:42250243-42250265 GACCCAATGCTTGTTCCCACAGG + Intronic
926579886 2:14623419-14623441 GACACATTCCCTGTTCTCAGTGG - Intergenic
927694439 2:25230619-25230641 GACCCAATACCTGTCCCCAGAGG + Exonic
930798456 2:55418879-55418901 GTCCCATTTCCTGCGGCCAGAGG + Exonic
931336501 2:61349554-61349576 GACCCACTGCATCTGGCCAGTGG - Intronic
931776928 2:65548922-65548944 GACCCAGTCCCAGTTACCAGAGG - Intergenic
933185069 2:79269420-79269442 GACCCACTGCGGGTTGCCTGAGG - Intronic
940289869 2:152068013-152068035 GACTCATTGCCTGCAGCCATGGG + Intronic
941201592 2:162517887-162517909 GTCCCATTGCCTTTTGGGAGAGG + Exonic
942459409 2:176159199-176159221 GCCCCCTAGCCTCTTGCCAGAGG - Intronic
944911799 2:204317812-204317834 GACCCACGGCCTGCTGGCAGAGG - Intergenic
1171987571 20:31671132-31671154 TAGCCATTGCCTGTCGCCAGTGG - Intronic
1173839246 20:46146390-46146412 TCCCCCTTGCCTGGTGCCAGGGG - Intergenic
1174038195 20:47680964-47680986 GAACCATTCACTGTAGCCAGAGG - Intronic
1174506437 20:51020680-51020702 TCAACATTGCCTGTTGCCAGAGG - Intronic
1175045804 20:56104015-56104037 ATCCCATTGCAGGTTGCCAGAGG - Intergenic
1176685463 21:9844934-9844956 GACCCATTGGTTGTAGACAGTGG - Intergenic
1178400605 21:32281778-32281800 GAGCCAATCCCTATTGCCAGGGG - Intergenic
1181762593 22:25068307-25068329 GACCCAGTGCCTGCTGGGAGTGG + Intronic
1183663530 22:39234887-39234909 GCCCCATTGTGTGTGGCCAGGGG + Intronic
951738860 3:25898153-25898175 GACCCATTTCCACTTCCCAGAGG + Intergenic
951754724 3:26077459-26077481 CACCCATTGGCTGATCCCAGTGG + Intergenic
953358985 3:42278613-42278635 GATTCATTGCCTGTGGACAGGGG - Intergenic
961360595 3:126364876-126364898 GACCCATTTGCTGTGGCCAGGGG + Intergenic
965226684 3:166000215-166000237 GATTCATTGGCTGTAGCCAGTGG - Intergenic
966862497 3:184238408-184238430 GAGACAGTGCCTGTTCCCAGTGG - Exonic
969835951 4:9841735-9841757 AACCCATTCCATGTTGTCAGGGG + Intronic
977591473 4:98832179-98832201 CATCTAGTGCCTGTTGCCAGAGG - Intergenic
978594752 4:110365138-110365160 GTTCCACAGCCTGTTGCCAGAGG + Intergenic
978643614 4:110901547-110901569 GGCCCAGTGCTTGGTGCCAGGGG - Intergenic
980348919 4:131663404-131663426 GACCCATTGGTTGTAGACAGTGG - Intergenic
981051107 4:140310386-140310408 TACCAGCTGCCTGTTGCCAGTGG + Intronic
983096291 4:163566240-163566262 GACCCATTGGATGTTATCAGAGG + Intronic
984969562 4:185175558-185175580 GACCCACTGCATCTGGCCAGTGG + Intronic
990159627 5:52923341-52923363 GACCCTTTGCCAATTACCAGAGG - Intronic
990292100 5:54362732-54362754 GTCCCATGCCCTTTTGCCAGAGG + Intergenic
990582541 5:57179527-57179549 CACCCATAGCCTGTTTCCACAGG + Intronic
991428008 5:66511507-66511529 GATTCATTCCCTGGTGCCAGTGG - Intergenic
991946215 5:71900689-71900711 GACTCATGGGCTGTAGCCAGTGG + Intergenic
992243063 5:74790651-74790673 GACCCATTGGGTGATGACAGGGG - Intronic
993367398 5:87050416-87050438 GATTCATTGGCTGTAGCCAGTGG - Intergenic
994917021 5:105994024-105994046 GACTCATGGGCTGTAGCCAGTGG + Intergenic
996346006 5:122489342-122489364 GATCCAGTGCCTGTTACCTGAGG - Intergenic
998895195 5:146791476-146791498 GAACCAATCACTGTTGCCAGGGG - Intronic
999628409 5:153544310-153544332 GACCCATTGCCTGTTGCCAGAGG - Intronic
1001445067 5:171776526-171776548 GACCCTTTGCCTGGTGCATGTGG - Intergenic
1001569499 5:172720963-172720985 GAACCAATGCCTGTGGCCAAGGG + Intergenic
1001791762 5:174463779-174463801 TACCCTGTGCCAGTTGCCAGGGG - Intergenic
1005870511 6:29971511-29971533 GACCCACTGTCTTTTTCCAGTGG + Intergenic
1013162185 6:107555499-107555521 GAGGCAGTGCCTGTTTCCAGAGG + Intronic
1019622315 7:1998608-1998630 GACCCTTTTCCTGTTGCCTCTGG - Intronic
1023192628 7:37599081-37599103 GACCAAGTCCCTGTTGTCAGGGG + Intergenic
1031474379 7:122204809-122204831 GATTCATGGCCTGTAGCCAGTGG - Intergenic
1032546887 7:132751292-132751314 GACCCATTGCCTGTCCCCTTTGG - Intergenic
1037108211 8:15136271-15136293 AACTCATTGCCTGTTACAAGGGG - Intronic
1039038508 8:33384888-33384910 GACCCATTGCATGGTGAGAGAGG + Intronic
1039546167 8:38413076-38413098 GACCAAATGCCTGGTACCAGAGG - Exonic
1040139545 8:43894377-43894399 GAGCCATTAGCTGATGCCAGAGG - Intergenic
1040661971 8:49584042-49584064 GACACACTGGCTGCTGCCAGGGG - Intergenic
1040752284 8:50725631-50725653 GAAAGATTGCCTGATGCCAGAGG + Intronic
1042017055 8:64325500-64325522 GACCCCTTGCATGTTGTCTGGGG - Intergenic
1046733519 8:117751330-117751352 GAACCATTTACTGTGGCCAGAGG + Intergenic
1049476005 8:142797300-142797322 GACCCTTTGCCAGCTGCGAGTGG - Intergenic
1050162259 9:2731037-2731059 GACCCATTTCCTGTGGGCACTGG - Intronic
1050601708 9:7259527-7259549 GACCCATTGCTTGTTGTTTGTGG + Intergenic
1052119915 9:24701404-24701426 GAACCAATGCTTGTGGCCAGTGG - Intergenic
1052368759 9:27641635-27641657 GACCCATTGGGTGATGACAGGGG - Intergenic
1053096773 9:35335327-35335349 GATCCATGGCCTCTTGCAAGTGG + Intronic
1053783846 9:41636673-41636695 GACCCATTGGTTGTAGACAGTGG + Intergenic
1054171801 9:61846812-61846834 GACCCATTGGTTGTAGACAGTGG + Intergenic
1054446662 9:65375825-65375847 GACCCATTGGTTGTAGACAGTGG + Intergenic
1054665734 9:67734000-67734022 GACCCATTGGTTGTAGACAGTGG - Intergenic
1055999611 9:82201100-82201122 GACCCAATGCATGTTGGCTGGGG + Intergenic
1057447105 9:95124288-95124310 GACACATTGCCTGTCGAGAGTGG - Intronic
1062254048 9:135612814-135612836 GTCCCTGTGCCTGTGGCCAGGGG + Intergenic
1185768987 X:2750388-2750410 AGCACATTGCCGGTTGCCAGGGG - Intergenic
1186211528 X:7254933-7254955 GACCCATTGCCAAGTGCCATGGG + Intronic
1191658691 X:63629011-63629033 GACCCATTGGGTGATGACAGGGG + Intergenic