ID: 999631892

View in Genome Browser
Species Human (GRCh38)
Location 5:153580016-153580038
Sequence GGAAACAGAGGACCACAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999631883_999631892 15 Left 999631883 5:153579978-153580000 CCATGTAGCCTAGCCCTCTTCCC 0: 1
1: 0
2: 1
3: 12
4: 182
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data
999631885_999631892 2 Left 999631885 5:153579991-153580013 CCCTCTTCCCTCATGTCACATAC 0: 1
1: 0
2: 0
3: 26
4: 277
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data
999631886_999631892 1 Left 999631886 5:153579992-153580014 CCTCTTCCCTCATGTCACATACA 0: 1
1: 0
2: 2
3: 33
4: 346
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data
999631890_999631892 -6 Left 999631890 5:153579999-153580021 CCTCATGTCACATACAGGGAAAC 0: 1
1: 1
2: 9
3: 89
4: 707
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data
999631889_999631892 -5 Left 999631889 5:153579998-153580020 CCCTCATGTCACATACAGGGAAA 0: 1
1: 1
2: 3
3: 39
4: 306
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data
999631884_999631892 7 Left 999631884 5:153579986-153580008 CCTAGCCCTCTTCCCTCATGTCA 0: 1
1: 1
2: 1
3: 36
4: 381
Right 999631892 5:153580016-153580038 GGAAACAGAGGACCACAAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999631892 Original CRISPR GGAAACAGAGGACCACAAGT AGG Intronic
No off target data available for this crispr