ID: 999637224

View in Genome Browser
Species Human (GRCh38)
Location 5:153635463-153635485
Sequence GGCTGCACAAAGGCAGAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 1, 3: 43, 4: 359}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999637224 Original CRISPR GGCTGCACAAAGGCAGAGCT AGG Intronic
900145241 1:1156376-1156398 GGCTGCCCACAGGCTGGGCTGGG + Intergenic
900145259 1:1156448-1156470 GGCTGCCCACAGGCTGGGCTGGG + Intergenic
900826785 1:4933358-4933380 GGCTGCACAAAGGCCCTACTGGG - Intergenic
900964304 1:5947199-5947221 GGCTTCTCAAAACCAGAGCTTGG + Exonic
901223021 1:7594632-7594654 GACTGCACCAGGGCAGAGCAGGG + Intronic
901429429 1:9203904-9203926 GGCTGCACCCAGGCTGAGGTGGG + Intergenic
902536468 1:17121754-17121776 GGCGGCACAAAAGCAGAGCTGGG - Intergenic
902758618 1:18566353-18566375 GGATTCCCAAGGGCAGAGCTGGG - Intergenic
904252079 1:29232161-29232183 GGCTGGAAAATGGCAGAGCTAGG - Intergenic
904824687 1:33266611-33266633 GGCTCCCCAAAAGCAGGGCTTGG - Intronic
904894197 1:33801865-33801887 GGCTGCCCAAAGGGAGAGATGGG + Intronic
905922704 1:41729938-41729960 GGAGGCACAAAGGCAGGGCAGGG + Intronic
906186904 1:43869238-43869260 AGCTGCAGAAAGGCAGATTTTGG - Intronic
908299876 1:62753381-62753403 GGCTGGCCAAGGCCAGAGCTGGG + Intergenic
908919507 1:69172339-69172361 GGCTTCAGAAGGGCAGAGATAGG - Intergenic
911768098 1:101703175-101703197 TGCTGCCCAGAGGTAGAGCTAGG + Intergenic
912546116 1:110452954-110452976 GGCTGGAGACAGGCACAGCTGGG + Intronic
912706809 1:111920777-111920799 GGTTACACAAAGGAAGAGGTTGG - Intronic
914450454 1:147786948-147786970 AGTTGCTCAAAGGCAGAGCATGG + Intergenic
915269646 1:154744647-154744669 ACCTGGACAAAGGCAGAGCTGGG - Intronic
915400121 1:155615986-155616008 GGCTGCCCTCAAGCAGAGCTAGG - Intergenic
915417327 1:155752181-155752203 GGCTGCCCTCAAGCAGAGCTCGG - Exonic
915594422 1:156888082-156888104 GGCAGGCCAAAGGCAGAGCTGGG + Intergenic
915649821 1:157301560-157301582 GGGTGCATAAAGGCAGGGGTTGG - Intergenic
916335339 1:163664814-163664836 CGCGACACAAAGCCAGAGCTGGG - Intergenic
918463246 1:184796938-184796960 GTCTACACAAAGGAAGGGCTCGG - Intronic
919847700 1:201651881-201651903 GGCTGTAGCAAGGCAGAGCCTGG + Intronic
920986414 1:210894537-210894559 GGCTGCACAAAGAGAAAACTAGG - Intronic
921362309 1:214341345-214341367 GGCTGCAATAATGCAGAGATGGG - Intergenic
922901533 1:229140812-229140834 AGCTGCTCAATGGCAGAGCTGGG - Intergenic
923543343 1:234905857-234905879 GGATGCACTAAGCCAGAGCCGGG - Intergenic
923950409 1:238945141-238945163 GGTAGGAGAAAGGCAGAGCTGGG - Intergenic
924219838 1:241862634-241862656 GTCTTCATAAAGGCAGAACTTGG + Intronic
1062834240 10:625476-625498 GCCTGCAGAAAGGCAGAGCCCGG - Intronic
1063072691 10:2682024-2682046 TTTTGCACAAAGACAGAGCTGGG + Intergenic
1067219625 10:44334621-44334643 GTCTCCACAAAGACAGAGCGAGG - Intergenic
1067358123 10:45550015-45550037 TACTGCAAACAGGCAGAGCTGGG + Intronic
1068236174 10:54235308-54235330 GGCTCCACAAAGTCAGTGATAGG + Intronic
1069755863 10:70774178-70774200 GGCTGCAGAAGGGCAGGGCGGGG + Intronic
1071807972 10:89145174-89145196 TGCTGGAAAATGGCAGAGCTAGG - Intergenic
1071986378 10:91055251-91055273 GGTTGCCCAAGGGCAGAGCAAGG + Intergenic
1073756865 10:106590151-106590173 GGTTGCACAAAGGCACAGAAAGG - Intronic
1074438991 10:113458602-113458624 GGCTAATCAAAGGCAGAGCTGGG + Intergenic
1075734512 10:124655597-124655619 GACTGCTTAATGGCAGAGCTGGG + Intronic
1077214973 11:1391408-1391430 GGCTGCACAGAGGAGGAGCTGGG + Intronic
1077232922 11:1466398-1466420 GTCAGCACAGAGGCAGAGTTGGG - Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1078000835 11:7494164-7494186 GGCAGCACAAAGGCATAATTGGG + Intronic
1078056449 11:8012903-8012925 GGCAGCAAATAGGAAGAGCTGGG - Intergenic
1079060392 11:17243691-17243713 GGTTACACAGAAGCAGAGCTAGG + Intronic
1079249928 11:18779961-18779983 GGCTGTACATAGGGAGAGCTTGG + Intronic
1079452473 11:20609323-20609345 GGCTGCACAAAGAAAGAGTGTGG - Intronic
1079452796 11:20611795-20611817 GGCTGCACAAAGAAAGAGTGGGG - Intronic
1080355083 11:31434105-31434127 GCCTGTACAAAGGCAGAACAGGG - Intronic
1081792408 11:45797592-45797614 GGCTGACAAATGGCAGAGCTGGG - Intergenic
1084683985 11:70682970-70682992 GGCTGGAGAAGGGCAAAGCTGGG + Intronic
1084793015 11:71486703-71486725 GGATGGACAAAGGGAGAGATGGG - Intronic
1086330523 11:85749476-85749498 GGTTGCACACAGGCATACCTGGG + Intronic
1087922087 11:103877848-103877870 AGCTGGGAAAAGGCAGAGCTTGG - Intergenic
1088010251 11:104992268-104992290 GGCTTCATAAAGCCTGAGCTGGG - Intergenic
1088764612 11:112963027-112963049 GGCGGCACAAGAGCAGCGCTCGG + Intronic
1088961455 11:114670024-114670046 AACTGCACAAAGACATAGCTAGG + Intergenic
1089121615 11:116139658-116139680 GGCTGCAGAAAGGCAGTGATGGG + Intergenic
1089392499 11:118111720-118111742 GGCTGGACACAGGCAGAGGCAGG - Exonic
1089680007 11:120114098-120114120 GGCTGCAGAGAAGCTGAGCTGGG - Intronic
1090182915 11:124716635-124716657 GGCTTGACAGAGGCAGAGGTGGG + Intergenic
1090441020 11:126725758-126725780 GTCTGCACAAAGGCAGGGCCAGG + Intronic
1091044635 11:132314742-132314764 GGGTGCAGAACGGGAGAGCTGGG + Intronic
1091331385 11:134733794-134733816 GGCTGATTAAAGGCAGAGCCAGG + Intergenic
1091545775 12:1500519-1500541 GGCCCCACAAAGGCTGTGCTCGG - Intergenic
1091822251 12:3484385-3484407 GGCTGCTAAATGACAGAGCTGGG + Intronic
1093522588 12:20067551-20067573 GGCTGGAGAAAAGCAAAGCTGGG - Intergenic
1095739875 12:45594999-45595021 GGCTACACAGTGGCAGAGTTTGG - Intergenic
1095832552 12:46603470-46603492 AGCTGATCAAAGGCTGAGCTGGG - Intergenic
1097919992 12:65061588-65061610 GGCTGGTCAATGGCAGAGCCTGG + Intronic
1101421638 12:104555847-104555869 AGCCGCACAAAGGCAGCCCTGGG + Intronic
1102200721 12:111055910-111055932 GGCTGCTTCACGGCAGAGCTAGG - Intronic
1102399424 12:112615576-112615598 GGCTGCAGAAAGGCAGGTCCAGG + Intronic
1104294161 12:127496435-127496457 GGGTGCTGCAAGGCAGAGCTGGG - Intergenic
1104500549 12:129281764-129281786 GGCTGGCCAAAGGCAGGTCTTGG - Intronic
1104977414 12:132558317-132558339 GGCTGCTCTGTGGCAGAGCTGGG - Intronic
1105700592 13:22933136-22933158 TGCTGAACAAGGGCTGAGCTTGG - Intergenic
1105853361 13:24355185-24355207 TGCTGAACAAGGGCTGAGCTTGG - Intergenic
1107889604 13:44902833-44902855 GGCTTCTCAGAGGCAAAGCTGGG - Intergenic
1108642530 13:52395951-52395973 GGCTGGATACAGGCAGAGCTGGG + Intronic
1110264713 13:73524171-73524193 GGCTGAACAAGGGGAAAGCTGGG + Intergenic
1111201664 13:84945775-84945797 AGCTGGACAGAGGCAGAGCTGGG + Intergenic
1111208317 13:85041557-85041579 GACTGCAGAAAGGCCGAGCATGG - Intergenic
1111974900 13:94955827-94955849 GGCTGCACAAAGGTAAACTTTGG + Intergenic
1112209460 13:97361421-97361443 TGTTGTACAAAGGCAGAGATGGG + Intronic
1113602784 13:111582597-111582619 GGCTGCAGAAAGGATGAGATGGG - Intergenic
1113766525 13:112884349-112884371 ATCTCCACACAGGCAGAGCTGGG - Exonic
1113817281 13:113182010-113182032 GGCTTCACTAAGGCTGAGTTTGG + Intronic
1114647598 14:24264214-24264236 GGCGGCCCATGGGCAGAGCTGGG - Intronic
1117971315 14:61253637-61253659 GGCACAGCAAAGGCAGAGCTTGG + Intronic
1120543409 14:85779621-85779643 GGCTGCTCATAAGCAAAGCTTGG - Intergenic
1121441446 14:93952282-93952304 GGCAGCCCACAGCCAGAGCTTGG - Intronic
1121604665 14:95231689-95231711 AGCTGAAGAGAGGCAGAGCTGGG + Intronic
1122604838 14:102941193-102941215 GCTTGCAGAAACGCAGAGCTGGG + Intronic
1122693659 14:103542815-103542837 GGCTCCTCCAAGGCTGAGCTGGG + Intergenic
1122842132 14:104471139-104471161 TGCTGAACAAAGGCTGAGCTTGG - Intergenic
1122859902 14:104577837-104577859 GGCTGAACAGTGACAGAGCTGGG + Intronic
1124222764 15:27864242-27864264 GCTTGCACAATGGCAGAGTTGGG + Intronic
1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG + Intronic
1125717296 15:41826642-41826664 GCCTCCTCAAAGGCAGTGCTGGG + Exonic
1126000582 15:44205767-44205789 GGCTGCACAGAGTCAGAGAAGGG - Intergenic
1126849186 15:52787241-52787263 GGGCGAACGAAGGCAGAGCTGGG + Intronic
1128359940 15:66954915-66954937 GGCTGCACAGAGGCTGAGACTGG - Intergenic
1129631053 15:77260963-77260985 GGCTGCACAACAGCAGATATTGG - Intronic
1129697251 15:77747685-77747707 GGCTGCACCAATGCAGAGCCAGG + Intronic
1130197038 15:81789571-81789593 GGCTCCACAAGGGCAGGACTTGG - Intergenic
1130870909 15:87971549-87971571 GGCAGCAAGAGGGCAGAGCTTGG + Intronic
1131241404 15:90746936-90746958 TTCTGCACAAGGGCAGAACTGGG - Intronic
1131315690 15:91334912-91334934 GCCTGCACCTAGGAAGAGCTAGG - Intergenic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1132700650 16:1220722-1220744 AGCGGCTCAAAGGCAAAGCTGGG - Exonic
1132713495 16:1279399-1279421 AGCTGCTCAGGGGCAGAGCTGGG + Intergenic
1133314229 16:4872363-4872385 GGCTGCCCAAAGGCTGAGTCTGG - Intronic
1134048773 16:11122124-11122146 GGCTGCGGCAAGGCAGAGGTGGG - Intronic
1134336456 16:13304131-13304153 GGAAGCACAAAGACAGAGGTTGG - Intergenic
1134903010 16:17955644-17955666 GGCTGCATGAAGCCAGAGGTGGG + Intergenic
1135359225 16:21797152-21797174 GGCTGCAGAAAGACAGAGTGGGG - Intergenic
1135822384 16:25695390-25695412 GTCTTCCCAAAAGCAGAGCTGGG - Intronic
1137322638 16:47400789-47400811 GGGAGCACAAAGGAAGAGATGGG + Intronic
1138212953 16:55178570-55178592 GACTGCAGAATGGCAGAGCTGGG - Intergenic
1138538938 16:57676607-57676629 GGCTGGTGAAGGGCAGAGCTGGG - Intronic
1138645365 16:58420690-58420712 GGCTCCAAAATGGCAAAGCTGGG - Intergenic
1138680483 16:58680344-58680366 GTCTGCACAGAGGCATACCTGGG - Intronic
1139374710 16:66489730-66489752 GTCTGCACAGAGGCAGAGGCTGG + Intronic
1140057208 16:71536020-71536042 GTCTCCTCAAAGGCAGAGCCAGG - Intronic
1140710087 16:77669616-77669638 GGAGGCAGAAGGGCAGAGCTAGG + Intergenic
1140871499 16:79110797-79110819 AGCTGATAAAAGGCAGAGCTGGG - Intronic
1140977263 16:80072029-80072051 GGGTGCTCCAGGGCAGAGCTGGG + Intergenic
1141222908 16:82088466-82088488 GGCTAATCAATGGCAGAGCTAGG + Intronic
1141838686 16:86560038-86560060 GGATGCACACAGGCAGAGGTGGG + Intergenic
1142800996 17:2345690-2345712 GGCTGCACACTGGCAGAGGCTGG - Intronic
1143615435 17:8046639-8046661 GGCAGGAAAATGGCAGAGCTAGG - Intronic
1144330244 17:14216770-14216792 GGGTGCTCAGAGGCAGAGATGGG - Intergenic
1145177693 17:20715680-20715702 GTCTGGACAAAGGAAGATCTGGG - Intergenic
1147245084 17:39114931-39114953 GGCTTCACAACTGCAGAGCGTGG - Intronic
1147381855 17:40061017-40061039 TGCATCACAAAGGCAGAACTAGG - Intronic
1147580028 17:41622921-41622943 GGCTGCCCAAGGCCACAGCTAGG + Intronic
1148153612 17:45410592-45410614 GGCTGCACAGAGGAAGATCACGG + Intronic
1148777267 17:50102586-50102608 GCCCGCACACAGGCAGTGCTAGG - Intronic
1149320516 17:55476529-55476551 GAAGGCACAAAGGCAGAGCCAGG - Intergenic
1149403643 17:56324842-56324864 GGGTGGCCAAAGGAAGAGCTTGG - Intronic
1149594867 17:57858955-57858977 CTCTGCAAAAATGCAGAGCTGGG - Intergenic
1149988865 17:61369224-61369246 GTCAGCACAAAAGCAGGGCTAGG - Intronic
1151293809 17:73168914-73168936 AACTGCAGAAAGGCAGAGCTTGG - Intronic
1151889874 17:76945733-76945755 GGCAGGATACAGGCAGAGCTGGG + Intronic
1151942576 17:77301865-77301887 GTCAGCACAAAGGCAGAGCAGGG + Intronic
1152290250 17:79436261-79436283 AGCTGCTCTAAGGCAGTGCTGGG + Intronic
1152509068 17:80772900-80772922 GGCTGTACAGGGGCAGAGCCAGG + Intronic
1152563181 17:81088860-81088882 GGCCGGACAAAGGCAGAGGCTGG + Intronic
1152723413 17:81933813-81933835 AGCTGGTCAAAGGCAGAGCCAGG - Intronic
1152822312 17:82443625-82443647 GGCTGCAGAAAGGCAGGCCCAGG + Exonic
1154181085 18:12140647-12140669 GGCTGCACAACAGCAGATATTGG + Intergenic
1154310603 18:13263580-13263602 GGCTGCCAATGGGCAGAGCTGGG - Intronic
1155692069 18:28636781-28636803 TGCTGCACAAATGCAGAGAAGGG + Intergenic
1156327224 18:36085405-36085427 GGCTGCATGGAGGCACAGCTGGG + Intergenic
1156688918 18:39682919-39682941 GTCTGCACTAAAGCAGAGGTAGG + Intergenic
1156832663 18:41513470-41513492 GTCTGCAAAATGGCAGTGCTGGG + Intergenic
1158046751 18:53165224-53165246 GGCAGAACAAAGGCTGAACTAGG + Intronic
1158906246 18:62015031-62015053 GGCTAGTAAAAGGCAGAGCTAGG + Intergenic
1159894423 18:73982951-73982973 GGCTGCCCCAAGGCAGGGCTAGG - Intergenic
1160887945 19:1360737-1360759 GGCTGCCCAACGGCAGACCGGGG - Exonic
1162931640 19:13960569-13960591 CGCTGCACAAAGGTGGGGCTCGG + Exonic
1163233748 19:16019677-16019699 GTCAGCACAAAGGCAGAGGGAGG + Intergenic
1163340354 19:16702342-16702364 GACTGCACAAAGACAGATGTTGG + Intergenic
1164743837 19:30596201-30596223 GACAGCAAAAGGGCAGAGCTTGG + Intronic
1165124447 19:33583749-33583771 TGCTGCCCAAGGGCTGAGCTAGG - Intergenic
1165486100 19:36097130-36097152 GGCTTCCAGAAGGCAGAGCTGGG - Intronic
1166391144 19:42409607-42409629 CCCTGCACCAAGGCAGAGCTGGG + Intronic
1166916548 19:46199355-46199377 AGTTCCACCAAGGCAGAGCTGGG + Intergenic
1167062404 19:47157857-47157879 GGCTGCACAAAGGCAAGGTTTGG - Intronic
1167385533 19:49160879-49160901 GGGGGCAGGAAGGCAGAGCTTGG + Intronic
1167609501 19:50500483-50500505 GGCTGCAGAAAGGGAGAGGGAGG - Intergenic
925452411 2:3980922-3980944 GGCTGGACAATGGCAGATCCAGG + Intergenic
926012835 2:9422613-9422635 CGCTGGTCAAAGGCGGAGCTCGG + Exonic
926350022 2:11985663-11985685 GGTGGGTCAAAGGCAGAGCTGGG - Intergenic
926679185 2:15651037-15651059 GCCTGCACAAGGACAGTGCTTGG - Intergenic
927242979 2:20934885-20934907 GGCTGCACCTACCCAGAGCTGGG + Intergenic
927311950 2:21641481-21641503 TGCTTGACAAAAGCAGAGCTTGG + Intergenic
927948188 2:27149895-27149917 GGCTGCAGGATGGCAGAGCTTGG - Intronic
929455720 2:42063600-42063622 GGCTCCTGAAAGGCAGAGCATGG - Intergenic
929597378 2:43184778-43184800 GGCTGCACAAAAGCAGACAGTGG - Intergenic
929990831 2:46784779-46784801 AGCTGGTCACAGGCAGAGCTGGG - Intergenic
932365574 2:71150892-71150914 GGCTGCAGCAGGGTAGAGCTAGG + Intergenic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
935138866 2:100333448-100333470 GCATGCACAAAGGCAGATCATGG - Intergenic
935238170 2:101155191-101155213 AGCTGCTCAAAGGCTGAGGTGGG + Intronic
935735694 2:106105230-106105252 GACTGCCCAACAGCAGAGCTGGG + Intronic
936284622 2:111172759-111172781 GGCTCCTCAATGGCAGAGCGAGG + Intergenic
936935001 2:117830928-117830950 GGTTGCCCAAGGGCAGAGCAAGG + Exonic
937078303 2:119123231-119123253 AGCTACAGAATGGCAGAGCTGGG + Intergenic
937803883 2:126115021-126115043 GTCTGCACAATGACAGAACTTGG + Intergenic
938085281 2:128395878-128395900 GGCTGGAGAAAGGCAGGGCTGGG - Intergenic
939627496 2:144495897-144495919 TCCTGCACAATGGCAGAGGTGGG - Intronic
941881868 2:170489070-170489092 AGGTGCACACAGGAAGAGCTAGG + Intronic
942251522 2:174051353-174051375 AGCTGAAAAGAGGCAGAGCTAGG - Intergenic
946105266 2:217363628-217363650 GGCTGCAAAAAGGGGAAGCTGGG + Intronic
946548661 2:220776132-220776154 GGCTGGACAAAGCCAGAGAGGGG - Intergenic
947982044 2:234418803-234418825 GGGAGCACACAGGCGGAGCTGGG - Intergenic
948157303 2:235793631-235793653 TGCTGCTCAAAGGCTGAGCAGGG - Intronic
948462530 2:238137254-238137276 GGCTGGACTATGGCTGAGCTGGG + Intergenic
948886140 2:240885878-240885900 GGCTGCAGGCAGGCAGTGCTGGG + Intergenic
1170781522 20:19430006-19430028 GGCTGCACAAAGGCATCTCTGGG + Intronic
1171311232 20:24146414-24146436 GGCTGCAAAAATCCAGGGCTTGG - Intergenic
1171362996 20:24603374-24603396 CCCTGCTCAATGGCAGAGCTTGG - Intronic
1171985017 20:31654105-31654127 ATCTACACTAAGGCAGAGCTTGG + Intergenic
1172022752 20:31925857-31925879 GGATGTACTAAGGCAGAGGTGGG - Intronic
1172935395 20:38616417-38616439 AGCTGATCAGAGGCAGAGCTGGG + Intronic
1173770502 20:45652274-45652296 GGCTGCACAACAGCGGAGATTGG - Intronic
1174035064 20:47663769-47663791 TGCTGCTCCAAGGCAGAGCCGGG + Intronic
1174275502 20:49400888-49400910 TGCTGCTCAGAGGCAGAACTAGG + Intronic
1174696492 20:52564912-52564934 AGCTAGAAAAAGGCAGAGCTGGG - Intergenic
1175605492 20:60308938-60308960 GGCTGGACAAAGGCTGATGTTGG - Intergenic
1176032088 20:63017542-63017564 GGCTCCACAGTGGCAGGGCTGGG + Intergenic
1177348309 21:19901032-19901054 GGGTTCACTAAGGCAGAGGTTGG - Intergenic
1178246569 21:30958588-30958610 GGCTCCTAAGAGGCAGAGCTGGG - Intergenic
1178492023 21:33058505-33058527 GGCGGCATAAAGGCGGGGCTGGG + Intergenic
1179718527 21:43302471-43302493 AGCAGCGCAAAGGCAGAGCGCGG - Intergenic
1180713743 22:17857713-17857735 GTCTGCAGCAAGGCGGAGCTGGG + Intronic
1182273344 22:29169752-29169774 GGCTCCAGGAAGGCAGGGCTGGG + Intergenic
1182392359 22:30009314-30009336 GGCAGCACAGAGGAAGAGTTGGG + Intronic
1183371542 22:37435420-37435442 GGCAGAACTAAGGCACAGCTAGG - Intergenic
1183430855 22:37764908-37764930 GGCTGCCCAGAGACAGAGCTAGG + Intronic
1183671067 22:39273180-39273202 GGCTCCCCAAGGGCAGGGCTAGG + Intergenic
1185037646 22:48488378-48488400 ACCTGCAGGAAGGCAGAGCTTGG + Intergenic
1185040332 22:48500787-48500809 GGATGCACACAGACAGGGCTGGG + Intronic
950131852 3:10552690-10552712 TGCTGCCCTGAGGCAGAGCTGGG + Intronic
950425715 3:12923800-12923822 GGCTGCACATGGGCAGGGCTGGG + Intronic
950497922 3:13345344-13345366 GGCTTTGAAAAGGCAGAGCTGGG + Intronic
950549214 3:13656023-13656045 GCCTGGAAAATGGCAGAGCTGGG - Intergenic
950977292 3:17261583-17261605 GGCTGCAATGAGGCAGAGGTGGG - Intronic
951530502 3:23694162-23694184 GGCTGCAGAAGGGGAGAGATGGG - Intergenic
952342223 3:32456122-32456144 GGCTAGTCAATGGCAGAGCTGGG - Intronic
952433009 3:33244056-33244078 GACTACAAAAAGGCAGAGCAAGG + Intergenic
952745333 3:36771566-36771588 GGCTGCACAGCGGCAGAGTATGG - Intergenic
952773850 3:37025918-37025940 GGCTGCCAAAAATCAGAGCTTGG + Exonic
954445922 3:50546865-50546887 GGCTGAGCGAAGGCTGAGCTGGG + Intergenic
954576998 3:51681793-51681815 GGCTGCAGAAAGGGAGTGCAAGG + Intronic
954651360 3:52165523-52165545 GACTGCACAAACTCAGGGCTGGG + Intergenic
955192817 3:56777675-56777697 GGCTGCAAAAAGGAAGTGCAGGG - Intronic
956396925 3:68835824-68835846 GGCTGCAGAAAGGCTGAAGTTGG - Intronic
956475746 3:69618418-69618440 AGCTGAAAAAAGGCAGACCTAGG + Intergenic
956634815 3:71353270-71353292 GGCAGCACAAGGGCTGATCTAGG + Intronic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
958904063 3:99922800-99922822 GGCTGCAAAAAAGGAGAGTTTGG - Intronic
958905293 3:99935485-99935507 GGCTAATTAAAGGCAGAGCTGGG - Intronic
959631615 3:108513466-108513488 GAATGTTCAAAGGCAGAGCTAGG - Intronic
960389265 3:117056934-117056956 GTCTGTGCAAAGGGAGAGCTTGG - Intronic
960620506 3:119632382-119632404 GGCAGAACAAAAGCAGAACTTGG + Intergenic
961105797 3:124240300-124240322 AGCTGCAGAAAGGTAGAGCTGGG - Intronic
961402622 3:126657830-126657852 GGCTTTGAAAAGGCAGAGCTGGG - Intergenic
961648750 3:128407106-128407128 CGGTGCACAAAGGCAGAGAGTGG + Intronic
962354985 3:134686089-134686111 GGCTGCACAAGGGAAGAAGTGGG + Intronic
962852959 3:139321676-139321698 GGCTGCTCAGAGGCAAGGCTGGG + Intronic
963321549 3:143814481-143814503 GGCTGCAGAAAGCCAGAGAGAGG + Intronic
963350166 3:144141762-144141784 AGCAACACAATGGCAGAGCTGGG + Intergenic
963924682 3:150938876-150938898 GCCTGGCCAAAGGCAGAGATAGG + Intronic
965116711 3:164499699-164499721 GGCTCCACAAAGGGAGAGGGTGG - Intergenic
966111653 3:176409431-176409453 AGCTGGAAAATGGCAGAGCTGGG + Intergenic
966468173 3:180256035-180256057 GGCTGCACAAAGACAGTGTAGGG + Intergenic
966813530 3:183869668-183869690 AGCTCCTCAAAAGCAGAGCTCGG + Intronic
967144981 3:186598906-186598928 GGGTGCACAAGGGCAGAGCCAGG - Intergenic
967865543 3:194187073-194187095 CCCTGCACACAGGCGGAGCTGGG + Intergenic
969058303 4:4415589-4415611 GGCTGCCCAAAGGCAAGGCTGGG - Intronic
969289750 4:6231012-6231034 GGCTGCCCCAGGGCAGAGGTAGG + Intergenic
969457725 4:7309752-7309774 AGCTACACAAGGGCACAGCTGGG - Intronic
970303280 4:14703689-14703711 CCCTGAAAAAAGGCAGAGCTTGG + Intergenic
973094158 4:46176410-46176432 GGCTGTACAAAAGCATGGCTGGG - Intergenic
973945082 4:55947578-55947600 CCCTGAACAAAGACAGAGCTTGG - Intergenic
975751959 4:77533334-77533356 GGCTGCACAACAGCAGATATTGG + Intronic
976546375 4:86340348-86340370 GGCTGCACAGAAGCATGGCTGGG + Intronic
977100350 4:92803999-92804021 GGCTTCACAGAGGCAGAGATTGG + Intronic
977722949 4:100262196-100262218 GGCTGCCCACAGTCAGAGCTGGG - Intergenic
979488570 4:121297609-121297631 AGCTACACAGTGGCAGAGCTAGG - Intergenic
979682593 4:123478173-123478195 GTCTGCACATAGGGAGCGCTCGG + Intergenic
983100346 4:163618314-163618336 GGCTGCACACAGGCACAACCTGG + Intronic
984814628 4:183825112-183825134 TGCTGAAAAGAGGCAGAGCTAGG + Intergenic
985720307 5:1485379-1485401 GGCTGCACAAGGGCCAGGCTGGG + Intronic
985809894 5:2075231-2075253 GGCTGGCGGAAGGCAGAGCTGGG + Intergenic
987561318 5:19525209-19525231 AGCTGCAACAAGGCAGAGGTAGG - Intronic
987710731 5:21498500-21498522 GGCTGCAACAGGGCAGAGCACGG - Intergenic
987923141 5:24309270-24309292 GGATGCACAAACAAAGAGCTGGG - Intergenic
988548141 5:32176438-32176460 GGGTGAACAGGGGCAGAGCTGGG - Intergenic
988916687 5:35901452-35901474 AGCTTTTCAAAGGCAGAGCTGGG - Intergenic
988977457 5:36529103-36529125 GGCTGGCCTGAGGCAGAGCTGGG - Intergenic
991037663 5:62144334-62144356 GGCTCCTCAAAGGCAGATGTAGG - Intergenic
991761068 5:69917562-69917584 GGCTGCAACAGGGCAGAGCACGG - Intergenic
991786261 5:70200538-70200560 GGCTGCAACAGGGCAGAGCACGG + Intergenic
991840296 5:70792613-70792635 GGCTGCAACAGGGCAGAGCACGG - Intergenic
991878705 5:71200923-71200945 GGCTGCAACAGGGCAGAGCACGG + Intergenic
992149881 5:73892420-73892442 GGGTGCACACAGGCAGAGGGAGG - Intronic
992863659 5:80937117-80937139 GGCTGGACCCAGGCAGAGCTGGG - Intergenic
995183912 5:109252510-109252532 GTGTGCAGCAAGGCAGAGCTGGG - Intergenic
996407825 5:123123908-123123930 GGGTGGAGAAAGGGAGAGCTGGG + Intronic
996852444 5:127967518-127967540 CGCTGCACAAAGACAGACCATGG - Intergenic
997403217 5:133618723-133618745 GGCTGGCAAATGGCAGAGCTAGG + Intergenic
997426981 5:133809927-133809949 TGATGCACAAAGGCAGACCAGGG + Intergenic
997439046 5:133896407-133896429 GGCTTCACATAGGGAGAGCAGGG - Intergenic
997641733 5:135452855-135452877 GCATGCAAATAGGCAGAGCTCGG - Intergenic
997877708 5:137564143-137564165 GCCTGCAGAAAGGCTGAGCCTGG - Intronic
997901767 5:137773435-137773457 TGCTGCCCGAAGACAGAGCTAGG + Intergenic
998319206 5:141213801-141213823 GGGTGCATACAGGCAGAGTTGGG + Intergenic
999637224 5:153635463-153635485 GGCTGCACAAAGGCAGAGCTAGG + Intronic
1000164189 5:158631363-158631385 TTTTGCACAAAGGCAGACCTTGG + Intergenic
1000640470 5:163696391-163696413 GGCTGCCCAGGGGCAGAGTTGGG + Intergenic
1001607420 5:172971744-172971766 GACTGCCCAGTGGCAGAGCTAGG - Intergenic
1001634027 5:173197048-173197070 GCCTTCATAATGGCAGAGCTGGG + Intergenic
1001945310 5:175773271-175773293 GGCAGGGCAGAGGCAGAGCTGGG + Intergenic
1002712443 5:181203693-181203715 GGCTCCAGGAAGGCAGAGGTGGG - Intronic
1004682376 6:17908914-17908936 GGCTAGATCAAGGCAGAGCTAGG - Intronic
1004771153 6:18783866-18783888 AGCTTCACAAAGACAGAGCTTGG + Intergenic
1005347812 6:24907911-24907933 GGCTCCCCAAAGGCAAACCTAGG - Intronic
1005546956 6:26882010-26882032 GGCTGCAACAGGGCAGAGCATGG + Intergenic
1005921154 6:30402997-30403019 GGCTGCAGCAATGCAGAGATAGG + Intergenic
1005946510 6:30599700-30599722 GGCTGTAGAGAGGTAGAGCTGGG + Intergenic
1005974835 6:30790120-30790142 TGCTGCCAAAAGGCTGAGCTCGG + Intergenic
1006901168 6:37502656-37502678 GGCTGCTAAGAAGCAGAGCTGGG - Intergenic
1007556105 6:42767857-42767879 GGAAGAACACAGGCAGAGCTGGG + Intronic
1008008661 6:46439690-46439712 GGCTGGGCAAAGGTAGGGCTAGG + Intronic
1008361156 6:50620683-50620705 GGCTGCAGAACAGCAGATCTTGG - Intergenic
1009017713 6:57923087-57923109 GGCTGCAACAGGGCAGAGCACGG + Intergenic
1011555895 6:88571341-88571363 GGCTGTACAGAGGCATGGCTGGG + Intergenic
1012508336 6:99974873-99974895 GGCTGTACAACAGCAGATCTTGG + Intronic
1012523692 6:100151581-100151603 GACTACACAAAGGCAGAGCAGGG - Intergenic
1014751810 6:125265550-125265572 GGCTGCAGAAGGGGAGAGGTTGG - Intronic
1014754434 6:125287883-125287905 GGCAGCACACAGGCAGAGCGGGG + Intronic
1014931705 6:127343665-127343687 TGCAGCACAAAGGTAGGGCTGGG + Intergenic
1015493285 6:133853367-133853389 AGCAGCACAAAGACAGAGCCAGG + Intergenic
1015565548 6:134566887-134566909 CGCTGCAGAAAGACAAAGCTTGG + Intergenic
1015600130 6:134903616-134903638 GGTTGCAGAAAGGCCAAGCTAGG + Intergenic
1015708309 6:136111985-136112007 GGCTGCAGGGATGCAGAGCTGGG - Intronic
1018252993 6:161891131-161891153 GGCTGCTCCAAGTCAGAACTTGG + Intronic
1018454360 6:163939160-163939182 GGCTGCACAGAAGCATGGCTAGG + Intergenic
1019903262 7:4041200-4041222 TGCTGCAGAAAGGCACAGGTTGG - Intronic
1020353898 7:7255937-7255959 GGCTGGACAAAGGGACTGCTGGG - Intergenic
1022824882 7:33998723-33998745 GGCTGCACAAAGCCATGGTTAGG - Intronic
1024045520 7:45582886-45582908 TTCAGCACAAAGCCAGAGCTAGG - Intronic
1026512289 7:71037545-71037567 GGCTGGCCAAGGCCAGAGCTTGG + Intergenic
1028351694 7:89857520-89857542 GGCTGCAAAAAGGGAGAATTGGG - Intergenic
1030024490 7:105309963-105309985 GTCTGCACAATGACAGAGGTAGG + Intronic
1030112193 7:106036472-106036494 GGCTGCTCAAGGGCAGGGATGGG - Intergenic
1031016539 7:116582043-116582065 GGCTACACAGAGGCCGAGCATGG + Intergenic
1032021350 7:128408694-128408716 GGCTTGACAGAGGCAGTGCTTGG - Intronic
1035134859 7:156692747-156692769 GGCTGCACAAAGGAAGAACCTGG + Intronic
1035613889 8:988531-988553 GGCTGAACAGAGGCCGAGCCGGG - Intergenic
1036694795 8:10967510-10967532 GGCAGCACTGAGGCAGAGGTCGG + Intronic
1036805474 8:11829460-11829482 AGCTGCTGAAAGGCATAGCTGGG - Intronic
1038735857 8:30168812-30168834 GGCTGTTCAGAGACAGAGCTTGG + Intronic
1039240745 8:35553786-35553808 GGGTTCTCCAAGGCAGAGCTGGG + Intronic
1039962406 8:42259651-42259673 TGCTGCACAAATGAAGAGCATGG + Intergenic
1040388540 8:46931180-46931202 AGCTGAACAGAGGCAGGGCTGGG - Intergenic
1042672963 8:71284203-71284225 GGCTGCCCACAACCAGAGCTTGG + Intronic
1044743896 8:95354010-95354032 GGCAGCACCATGGCTGAGCTTGG - Intergenic
1046771803 8:118123988-118124010 AGCTGCACAAATGCAGGGCCTGG - Intergenic
1047187638 8:122648379-122648401 GGCTTATCCAAGGCAGAGCTGGG - Intergenic
1047481944 8:125292116-125292138 GGCTGGACAAAGGTATAGTTGGG + Intronic
1047873918 8:129114421-129114443 GTCTACACAAGGGCACAGCTTGG - Intergenic
1048509622 8:135050428-135050450 GGCTGCCCAAAGGGCGAGGTTGG - Intergenic
1048553147 8:135452604-135452626 AGCTGCAGAAAGACAGAGCCAGG + Intergenic
1048698261 8:137053659-137053681 GGCTGGAAAAAGGAAGAGATAGG - Intergenic
1048800304 8:138188677-138188699 GGCTGCAGGAAGGCAGGGCATGG - Intronic
1049298079 8:141854530-141854552 GGGTGTACAGAGGCAGAGGTGGG + Intergenic
1049355672 8:142186963-142186985 GGCTGCACGGAGGCACAGCCAGG + Intergenic
1049471766 8:142777884-142777906 GGCTGCAGGAGGGCGGAGCTGGG - Exonic
1050084667 9:1951935-1951957 GGCTTCACAAAGGGAGAGTTTGG - Intergenic
1050277479 9:4014839-4014861 GGCTGAATACTGGCAGAGCTAGG + Intronic
1051657596 9:19397839-19397861 GGCTGAACACAGGCAGAGTGAGG + Intergenic
1053484910 9:38445110-38445132 GGATTCACAAAGGCAGGGCAGGG + Intergenic
1055123964 9:72697261-72697283 GGTTGCACAAAAGTAGAGCTGGG - Intronic
1056794436 9:89647922-89647944 GGACACACCAAGGCAGAGCTTGG + Intergenic
1056928231 9:90853041-90853063 GGATGCACAAGGGCAGAGATGGG + Intronic
1057453271 9:95184550-95184572 GTCTGCATAAAGGAAGACCTTGG + Intronic
1057772778 9:97983183-97983205 GGCTGCACCAAGGCGGGGCGGGG - Intergenic
1057866639 9:98686888-98686910 GGCTGGGGAGAGGCAGAGCTTGG - Intronic
1058538766 9:105990708-105990730 GCCTGCACAAAGGTAGAGGATGG - Intergenic
1058645844 9:107130957-107130979 GGATGTGCAAAGGCAGACCTTGG - Intergenic
1059352046 9:113672445-113672467 GGCTGCATGAGGGTAGAGCTGGG + Intergenic
1060039230 9:120285424-120285446 GCCTGCACATTGGCTGAGCTTGG + Intergenic
1060089571 9:120731119-120731141 GGCTGCACAGAAGCAGAGGGTGG + Intergenic
1060242951 9:121920355-121920377 GGTAGCACAAAAGCAGAGCCAGG + Intronic
1060435207 9:123586898-123586920 AGCTGCCCAAAGTCAGAGCTAGG + Intronic
1060787870 9:126464795-126464817 AGCTGGTCAAGGGCAGAGCTGGG - Intronic
1060824086 9:126677575-126677597 GGCTGGTGAAATGCAGAGCTGGG - Intronic
1061291622 9:129653674-129653696 GGCTGGTGAGAGGCAGAGCTGGG + Intergenic
1061821272 9:133228302-133228324 GGGTGCAGAAGGGCAGGGCTAGG - Intergenic
1061834173 9:133318059-133318081 GGATGCAGAGGGGCAGAGCTGGG + Intergenic
1062443009 9:136579447-136579469 GCCTGGCCGAAGGCAGAGCTGGG - Intergenic
1185999801 X:4996011-4996033 GGCTGCACAGAAGCATGGCTGGG - Intergenic
1187927705 X:24265038-24265060 GGCTGTACAAAAGCATGGCTAGG + Intergenic
1188505973 X:30885522-30885544 GAGGGCAAAAAGGCAGAGCTGGG + Intronic
1189853610 X:45200871-45200893 GGCTGTACAGAGGCAGGGCTTGG + Exonic
1190060245 X:47206220-47206242 GGGAGCACAAAGCGAGAGCTAGG - Intronic
1190737098 X:53262808-53262830 GGCTGCACAGCAGCAAAGCTGGG - Intronic
1192100312 X:68257423-68257445 GGCTACAAAATGGCAGAGCCAGG - Intronic
1192234968 X:69289855-69289877 GCCTGGACATAGGCAGAGATGGG + Intergenic
1192578002 X:72258222-72258244 GGCCGATCCAAGGCAGAGCTGGG - Intronic
1196810020 X:119621414-119621436 GGCTGCAAAGAGTCACAGCTGGG + Intronic
1198177023 X:134166672-134166694 AGGTGAACAAAGGCGGAGCTGGG + Intergenic
1202374616 Y:24222715-24222737 GGCTGCAGAAAAGCAGATATTGG - Intergenic
1202496164 Y:25447405-25447427 GGCTGCAGAAAAGCAGATATTGG + Intergenic