ID: 999640133

View in Genome Browser
Species Human (GRCh38)
Location 5:153664144-153664166
Sequence AAATAGAGAATACAATGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 619
Summary {0: 1, 1: 0, 2: 1, 3: 66, 4: 551}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999640127_999640133 1 Left 999640127 5:153664120-153664142 CCTATCCCTCTTTTTAAGACAGA 0: 1
1: 0
2: 1
3: 21
4: 350
Right 999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 551
999640125_999640133 14 Left 999640125 5:153664107-153664129 CCTTGTTTCCTTACCTATCCCTC 0: 1
1: 0
2: 3
3: 30
4: 433
Right 999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 551
999640126_999640133 6 Left 999640126 5:153664115-153664137 CCTTACCTATCCCTCTTTTTAAG 0: 1
1: 0
2: 2
3: 21
4: 245
Right 999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 551
999640128_999640133 -4 Left 999640128 5:153664125-153664147 CCCTCTTTTTAAGACAGAAAAAT 0: 1
1: 0
2: 13
3: 183
4: 1120
Right 999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 551
999640129_999640133 -5 Left 999640129 5:153664126-153664148 CCTCTTTTTAAGACAGAAAAATA 0: 1
1: 1
2: 13
3: 142
4: 1019
Right 999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG 0: 1
1: 0
2: 1
3: 66
4: 551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999640133 Original CRISPR AAATAGAGAATACAATGGGA GGG Intronic
901191995 1:7418103-7418125 AAATAGAGAAACCAAGGGGTAGG - Intronic
902243668 1:15104717-15104739 AAGAAGAGAATCCACTGGGAGGG - Intronic
902882889 1:19384415-19384437 AAATAAAGAGGACAGTGGGAGGG - Intronic
904938277 1:34147285-34147307 AAATAAAGAATAAAAAGAGAAGG + Intronic
905096603 1:35477365-35477387 AAATAAAAACTACAATGAGATGG + Intronic
905479051 1:38248744-38248766 AAATAGAGAAGAGGATGGGGTGG - Intergenic
906913419 1:49982108-49982130 AAATAGTGAATACAGTTGAATGG + Intronic
907673337 1:56496091-56496113 CAGTACAGAATAGAATGGGATGG + Exonic
908807504 1:67946388-67946410 AAAGAGGGAATAAAATAGGAAGG - Intergenic
909297617 1:73970892-73970914 AGAGAAAGAATGCAATGGGAAGG + Intergenic
909298130 1:73977515-73977537 GAATAGAGAATACAAGAGGCTGG - Intergenic
909747342 1:79113742-79113764 AAATAAGGAATAGAAGGGGAGGG + Intergenic
910157629 1:84237525-84237547 AAATAGAGAGTAAAATGGAATGG - Exonic
910906065 1:92180145-92180167 AAATCAAGAACACAATGGAAGGG - Intronic
911479162 1:98415262-98415284 AAAAAGAGAATTCCAAGGGAAGG - Intergenic
911695638 1:100887997-100888019 ACATAGAAAATACAATGTGGCGG - Intronic
911887136 1:103317558-103317580 AAATAGAGAAGACAAGAGGAAGG - Intergenic
914936564 1:151986618-151986640 AACTAAAGAATAGAATGGGCTGG - Intronic
915538926 1:156555229-156555251 AAACAGAGAAGAAAATAGGAAGG - Intronic
915542893 1:156579924-156579946 AAAAAAAGGATAAAATGGGAGGG + Intronic
915967415 1:160323169-160323191 AGATCGAGAGTAGAATGGGAAGG + Intronic
916316763 1:163457316-163457338 AAATAGGGAATATAATTGGTTGG + Intergenic
917245255 1:172994070-172994092 AAAGAGAAAAAAGAATGGGATGG - Intergenic
917304140 1:173609474-173609496 AAATATAAAACAGAATGGGAGGG + Intergenic
917506461 1:175631752-175631774 ACATAGAGAAAACCATGGAAAGG + Intronic
917779546 1:178378048-178378070 AAATAGAAAATACAGTAAGATGG + Intronic
919090388 1:192971752-192971774 AAATAGAAAATACTATGGGTTGG + Intergenic
919384634 1:196904921-196904943 AAATAGTGAAAACACAGGGAAGG - Intronic
920789825 1:209079262-209079284 AATTACAGAATTCCATGGGAAGG - Intergenic
921354685 1:214274973-214274995 AAATAGAGAATACACTAGAAGGG - Intergenic
922439043 1:225636685-225636707 AAATAAAGAATAAAATGAGAAGG + Intronic
922673651 1:227534979-227535001 AAATAAAGACTAGAATAGGAAGG - Intergenic
922793673 1:228325615-228325637 AAAACAAGAATAAAATGGGAAGG + Intronic
923516525 1:234702405-234702427 AAATGGAGAAGCCAATGAGAAGG + Intergenic
923593012 1:235336979-235337001 AAATGGAGAATTCAAAGGGAAGG + Intronic
923806648 1:237265064-237265086 AAAGAGAAAATACAATGTTATGG + Intronic
924793723 1:247276891-247276913 AAGAATAGAATAAAATGGGATGG + Intergenic
924906480 1:248458672-248458694 AAATAGAGAATACAGTTGTAAGG + Intergenic
924921407 1:248633355-248633377 AGATAGAGAATACAGTTGTAAGG - Intergenic
1063075600 10:2713316-2713338 TAATGGAGAATGCAATGGGCGGG + Intergenic
1063137343 10:3229209-3229231 AAATAGAGGCTAGACTGGGAAGG - Intergenic
1063863553 10:10339793-10339815 ATATAGAGCATTAAATGGGAAGG - Intergenic
1064340755 10:14483366-14483388 AAATATATAATACAATGTCAGGG + Intergenic
1064753215 10:18553170-18553192 GAATGGAGAATGCAATGGAATGG - Intronic
1064753218 10:18553192-18553214 GAATGGAGAATGCAATGGAATGG - Intronic
1064753229 10:18553265-18553287 GAATAGAGAATGGAATGGTATGG - Intronic
1064753343 10:18554041-18554063 AAATGGAGAATGGAATGGAATGG + Intronic
1064753395 10:18554408-18554430 GAATAGAGAATGGAATGGAACGG + Intronic
1064753416 10:18554544-18554566 GAATAGAGAATTGAATGGAATGG + Intronic
1064753524 10:18555334-18555356 GAATAGAGAATGGAATGGTATGG + Intronic
1064753555 10:18555552-18555574 GAATAGAGAATGGAATGGAATGG + Intronic
1064753563 10:18555608-18555630 GAATAGAGAATGGAATGGAATGG + Intronic
1064753605 10:18555883-18555905 GAATGGAGAATAGAATGGAATGG + Intronic
1064753686 10:18556459-18556481 AAATGGAGAATGGAATGGAATGG + Intronic
1064753691 10:18556493-18556515 GAATAGAGAATGGAATGGAACGG + Intronic
1064753792 10:18557121-18557143 AAGTAGAGAATGGAATGGAATGG + Intronic
1064753846 10:18557498-18557520 GAATGGAGAATAGAATGGAAGGG + Intronic
1064753884 10:18557745-18557767 GAATGGAGAATAGAATGGAATGG + Intronic
1064754046 10:18558843-18558865 GAATGGAGAATGCAATGGAATGG + Intronic
1064754065 10:18558979-18559001 GAATGGAGAATGCAATGGAATGG + Intronic
1064754090 10:18559166-18559188 GAATGGAGAATAGAATGGAATGG + Intronic
1064754119 10:18559357-18559379 GAATAGAGAATGGAATGGAAGGG + Intronic
1064754152 10:18559576-18559598 CAATAGAGAATGGAATGGAATGG + Intronic
1064754326 10:18560776-18560798 GAATAGAGAATGGAATGGTATGG + Intronic
1064754364 10:18561017-18561039 GAATGGAGAATAGAATGGAATGG + Intronic
1064754410 10:18561357-18561379 GAATGGAGAATACAATGGAATGG + Intronic
1064754467 10:18561782-18561804 GAATGGAGAATACAATGGAATGG + Intronic
1064754511 10:18562124-18562146 GAATGGAGAATAGAATGGAATGG + Intronic
1064754619 10:18562866-18562888 GAATAGAGAATGGAATGGCATGG + Intronic
1064754658 10:18563157-18563179 AAATGGAGAATGGAATGGAATGG + Intronic
1064754725 10:18563625-18563647 GAATGGAGAATGCAATGGAATGG - Intronic
1064754855 10:18564544-18564566 GAATAGAGAATGGAATGGAATGG - Intronic
1064754911 10:18564975-18564997 AAATGGAGAATGGAATGGAATGG - Intronic
1064755016 10:18565701-18565723 TAATAGAGAATGGAATGGCATGG - Intronic
1064755037 10:18565841-18565863 GAATGGAGAATAGAATGGAATGG - Intronic
1064755158 10:18566644-18566666 GAATGGAGAATAGAATGGAATGG - Intronic
1064755160 10:18566661-18566683 AAATGGAGCATTCAATGGAATGG - Intronic
1064755255 10:18567336-18567358 GAATGGAGAATAGAATGGAATGG - Intronic
1064755359 10:18568068-18568090 AAATAGAGAATGGAATGGAATGG - Intronic
1064755403 10:18568401-18568423 AAATGGAGAATGGAATGGAATGG - Intronic
1064755465 10:18568819-18568841 GAATAGAGAATGGAATGGAATGG - Intronic
1064755475 10:18568909-18568931 AAATGGAGAATGGAATGGAATGG - Intronic
1064755495 10:18569016-18569038 GAATAGAGAATGTAATGGAAGGG - Intronic
1064755544 10:18569348-18569370 GAATGGAGAATGCAATGGAATGG - Intronic
1064755613 10:18569795-18569817 GAATAGAGAATGGAATGGAATGG - Intronic
1064755748 10:18570657-18570679 GAATGGAGAATAGAATGGAATGG - Intronic
1064755752 10:18570691-18570713 GAATAGAGAATGGAATGGAATGG - Intronic
1064755799 10:18571017-18571039 AAGTAGAGAATGGAATGGAATGG - Intronic
1064755886 10:18571582-18571604 GAATAGAGAATGGAATGGAATGG - Intronic
1064755904 10:18571701-18571723 GAATAGAGAATGGAATGGAATGG - Intronic
1064755926 10:18571864-18571886 GAATGGAGAATAGAATGGAATGG - Intronic
1064755959 10:18572078-18572100 AAATGGAGAATAGAAGGGAATGG - Intronic
1064755976 10:18572175-18572197 GAATAGACAATAGAATGGAATGG - Intronic
1064756155 10:18573285-18573307 GAATGGAGAATGGAATGGGATGG - Intronic
1064871618 10:19944225-19944247 AAATACAGAAGCCGATGGGATGG - Intronic
1065311502 10:24420317-24420339 AAATAGGCAATTCAATGAGAGGG - Intronic
1066018634 10:31273996-31274018 AAATAAATAAAGCAATGGGAAGG + Intergenic
1066265039 10:33768613-33768635 AAATAGAAAAGACAATGGCCAGG + Intergenic
1066377221 10:34868284-34868306 AAATAAAGAATATTATTGGAAGG + Intergenic
1066440946 10:35437907-35437929 AAATAGATAATAAACTGGAAAGG + Intronic
1066547101 10:36511617-36511639 AAATACAGAATACAATACAATGG + Intergenic
1066600791 10:37104807-37104829 AAAAAGAGAAAACAATAGAAAGG + Intergenic
1066660295 10:37732341-37732363 AAATAGACAATAAAGTGGAAGGG - Intergenic
1067424219 10:46191300-46191322 AAATAGAGAATAGAATGGTTAGG + Intergenic
1067983151 10:51110777-51110799 AAATAGAGAATGAACTGTGAGGG + Intronic
1068345970 10:55778444-55778466 AAATAGAGAGTAGAATGGTAAGG - Intergenic
1068781892 10:60928584-60928606 AAGTAGAGAATATAATAGAATGG + Intronic
1069322026 10:67183702-67183724 AAATAAAAAATAAAATGTGAGGG + Intronic
1070228657 10:74540301-74540323 AAATAGTGAATAAAATAGAAAGG - Intronic
1070860642 10:79656716-79656738 AAATAGAGAATAGAATGGTTAGG + Intergenic
1071082758 10:81831712-81831734 CAATAAAGAATAAAATGGGTTGG + Intergenic
1071117121 10:82234348-82234370 AAATGGAAAATACCATAGGAAGG - Intronic
1071604498 10:86975642-86975664 AAAAATAGAATATAATGGGCCGG - Intronic
1071705576 10:87994557-87994579 GAACAGAGAAAATAATGGGAGGG - Intergenic
1072049689 10:91690971-91690993 AAATAAAAAATACAATGGCTAGG - Intergenic
1072700668 10:97639257-97639279 AAATAAAGAAAAGAAAGGGAAGG - Intronic
1073021975 10:100452680-100452702 AAATAGAGAATAAAGTGTCAGGG + Intergenic
1073228602 10:101946525-101946547 AAATAAAGAATTCACTGGGTGGG + Intronic
1073375241 10:103028778-103028800 AAAGAAAGAAGAAAATGGGAGGG - Intronic
1074173501 10:110970783-110970805 AAATCGAAAGTACAATGAGAAGG - Intronic
1076079206 10:127563493-127563515 AATTAGAGAATACAATAGAATGG - Intergenic
1078883163 11:15473322-15473344 AAAAAAAGAAAACAATGAGATGG + Intergenic
1079019981 11:16901881-16901903 AAATAAAGTATACAATGCAATGG + Intronic
1079576164 11:22005460-22005482 AAATAGGAAGTACAAAGGGAAGG + Intergenic
1079887757 11:26009419-26009441 AAACAAAGAATAAAATAGGAAGG - Intergenic
1080202254 11:29686023-29686045 ACATACAGAATACACTTGGAAGG - Intergenic
1081904232 11:46656871-46656893 CAATATAGAATACATTGAGAGGG + Intronic
1083126423 11:60571701-60571723 AAATAGAGGTTACAAGGAGACGG + Intergenic
1083790970 11:64985626-64985648 AAATAGAGAATTCAAGGGAAGGG - Intergenic
1084748088 11:71185956-71185978 CAATGGAAAATACAATGGTACGG + Intronic
1085144730 11:74183952-74183974 TAATAGAGAAGTAAATGGGAGGG + Intronic
1085205577 11:74730386-74730408 AAAGAGAGAAAAGAATGGGAAGG + Intronic
1088144613 11:106660942-106660964 AAAAAGAGAATACATCGGCATGG - Intergenic
1088159092 11:106846826-106846848 AAATAGAGAATTCAATAGTAAGG + Intronic
1088324059 11:108584104-108584126 AAACAAAGAATAAAATCGGATGG + Intronic
1089455701 11:118624559-118624581 AAAGAGAGAAAACACTTGGAAGG - Intronic
1090306256 11:125693662-125693684 GAATAGAGAATACTATGATACGG - Intergenic
1090992682 11:131833950-131833972 AAATGGAGAATACCATAGGGTGG - Intronic
1091163672 11:133450700-133450722 AAACAGAGAACACAACGTGAAGG + Intronic
1091804319 12:3345056-3345078 AAAAAAAGAATACATTGGGTGGG - Intergenic
1093053417 12:14531214-14531236 TAATAAAGAATACAAAGAGATGG - Intronic
1093066487 12:14663673-14663695 TGATAGAGAATACAGTGTGAAGG - Intronic
1093374193 12:18404157-18404179 CAATAAAGAATACAATGGTTTGG - Intronic
1093484793 12:19641111-19641133 AAATAGAGAACACCAGGCGAAGG - Intronic
1093513350 12:19955108-19955130 AAATAGGGAATATAATGGCGAGG + Intergenic
1093779287 12:23115558-23115580 CAAGAGAGAAGACAAAGGGAAGG + Intergenic
1093821227 12:23620348-23620370 ATATGGAGAATAGATTGGGAGGG + Intronic
1093907449 12:24709945-24709967 ATAAAGAAAATAAAATGGGATGG - Intergenic
1093990046 12:25579885-25579907 CAATAGAGAATGCACTGGCAGGG - Intronic
1095680971 12:44975113-44975135 AAATTCAGAATCCAATCGGAGGG - Intergenic
1096158984 12:49360791-49360813 AAAAAAAGAAAAGAATGGGAAGG + Intergenic
1096992005 12:55812283-55812305 GAATAGGGAGTACAATGGGAAGG - Intronic
1097001966 12:55884520-55884542 AAAGAGAGAAGACAATGTGAAGG + Intergenic
1097784557 12:63744854-63744876 AAACTGAGAAAACTATGGGAGGG + Intergenic
1098274691 12:68801539-68801561 AAATAGAAAATAAAATGTTACGG + Intergenic
1099105285 12:78488433-78488455 AAAAAGAGAAGACACTGGAAAGG + Intergenic
1099561965 12:84190184-84190206 ACAAAGAGAATACAATAGGTAGG + Intergenic
1100909121 12:99338250-99338272 AAGGAGAGAAAAGAATGGGAAGG - Intronic
1101252177 12:102947322-102947344 AAATATAGAACACAAAAGGAGGG + Intronic
1101304855 12:103518326-103518348 CACTAGAGAATCCAATGGGATGG - Intergenic
1101368995 12:104107549-104107571 AAATAGAGGTCAAAATGGGAGGG + Intergenic
1102079876 12:110089451-110089473 AAATGGAGAAGCCAATGGAATGG + Intergenic
1102823227 12:115925678-115925700 AAATAGATCAAACCATGGGAGGG - Intergenic
1104287319 12:127435607-127435629 AGATAGAGAATAGAATAGAACGG - Intergenic
1105872002 13:24513326-24513348 GAGTAGAGAATACAGTGGAAAGG + Intergenic
1106627986 13:31440853-31440875 ACACAGAGAGTACAAAGGGAGGG - Intergenic
1106872922 13:34041260-34041282 AAGTAGAGACCACAGTGGGATGG + Intergenic
1106908869 13:34440658-34440680 AAATAAAGAATACAATAGATGGG + Intergenic
1107662951 13:42658384-42658406 GAAGAGAGAATACAAAAGGAGGG - Intergenic
1109451058 13:62514721-62514743 AAAGAGAGAATAGAAAGAGAAGG - Intergenic
1110116337 13:71820847-71820869 AAACAGAGAACAAAATGGGAAGG + Intronic
1110733763 13:78911020-78911042 ATACAGAAAATACAATAGGATGG + Intergenic
1110818440 13:79886675-79886697 AACTACAGAAGAAAATGGGAAGG + Intergenic
1112064643 13:95780315-95780337 AAGAAGAGAATACAGTGAGAGGG - Intronic
1112783560 13:102927723-102927745 GAATCGAGAATACAAAGGCAAGG - Intergenic
1113421557 13:110175055-110175077 AGGTAGTGAATACAAGGGGAAGG + Intronic
1114875280 14:26709878-26709900 AAATAAAGATTCCAATGTGAGGG - Intergenic
1115429121 14:33295852-33295874 ACAGTCAGAATACAATGGGATGG + Intronic
1116047846 14:39766003-39766025 ACAGATAGAATACAAAGGGAAGG - Intergenic
1116055155 14:39854738-39854760 AAAGAGAGAAAAAAATGGGAAGG - Intergenic
1116069942 14:40031284-40031306 AAATAGGACATACAATGGAAGGG + Intergenic
1116358624 14:43963656-43963678 AAATAAAAAATAAAAAGGGAGGG + Intergenic
1116647301 14:47545201-47545223 AAAAAGAGAACAAAATAGGAAGG + Intronic
1116895839 14:50313897-50313919 AAACAGAGAATAGATTGGGTGGG - Intronic
1117349233 14:54864633-54864655 CAATAGAGAATATTATGGGTGGG - Intronic
1118147866 14:63159525-63159547 AAATAGAGAATATAAAAGAAAGG - Intergenic
1119279115 14:73388799-73388821 TAATAAAAAATACAATGGGCCGG + Intronic
1120074524 14:80140443-80140465 AAAGAGAGAATACAATAGAGAGG - Intergenic
1120205202 14:81580331-81580353 ACAAAGAGGCTACAATGGGAAGG + Intergenic
1120290360 14:82561876-82561898 AAAGAGAGAATACAAGAAGAGGG + Intergenic
1121070261 14:91012986-91013008 AAGTAGAGCAAACAAGGGGATGG - Intronic
1121321247 14:92992893-92992915 AAAGGGAGAATACAAGGAGAAGG + Intronic
1121738871 14:96237579-96237601 AAAGAGAGAATTTAAGGGGAGGG + Intronic
1121930806 14:97970576-97970598 AAATAGAGAATAGACAGGAAGGG + Intronic
1122136198 14:99634296-99634318 AAATGGAAAATATAATGGAAAGG - Intergenic
1202831046 14_GL000009v2_random:30916-30938 AGAATGGGAATACAATGGGAGGG + Intergenic
1202874831 14_GL000225v1_random:197713-197735 AAGGATTGAATACAATGGGATGG + Intergenic
1123716503 15:23037098-23037120 AAATAGAAAAAACAATCGAAGGG - Exonic
1126757266 15:51936835-51936857 AAACAAAAAATACAAAGGGACGG - Intronic
1126969098 15:54089584-54089606 AAATAGAAAATAACATGGGAAGG - Intronic
1127491040 15:59463983-59464005 GAATAGAGAATACTAGAGGATGG - Intronic
1128141376 15:65303121-65303143 AAATAGAGTATACAATTCAATGG - Intergenic
1128860203 15:71063915-71063937 AAATTTAGAAGACAATGAGAGGG - Intergenic
1129078344 15:73017399-73017421 CAATAGAGTATACAATGAAAAGG - Intergenic
1129930998 15:79411308-79411330 AACTAGAGAATGCAAATGGAGGG + Intronic
1130641221 15:85677382-85677404 AGAAAGAGTACACAATGGGATGG - Intronic
1131245470 15:90788102-90788124 AAAAAGAGATTAAAATGGGGTGG + Intronic
1131817980 15:96242490-96242512 AAAAAAAGAATACAATTGTAGGG - Intergenic
1132197288 15:99925121-99925143 AAATAAGGAAAACAATGAGAGGG - Intergenic
1134556322 16:15168608-15168630 AAAAAGAGAATACCATGAAATGG - Intergenic
1134741408 16:16550398-16550420 AAATGCAGAAAACAATAGGAGGG - Intergenic
1134916904 16:18080314-18080336 AAAAAGAGAATACCATGAAATGG - Intergenic
1134926148 16:18162035-18162057 AAATGCAGAAAACAATAGGAGGG + Intergenic
1135187686 16:20329344-20329366 AAATAGATCATACAATGAGGAGG - Intergenic
1135476963 16:22785280-22785302 AGATAGAGAAAACCCTGGGAAGG + Intergenic
1135524364 16:23202818-23202840 AATTAGAGAATCCAAGGGCAGGG + Intronic
1137225485 16:46502720-46502742 AAAATGGGAATACAATGGGAAGG - Intergenic
1137419139 16:48316308-48316330 AAAAAAAGAATCCAATGGGCTGG - Intronic
1137496746 16:48975281-48975303 AAACAGAGAAGACAATGTGATGG - Intergenic
1137914770 16:52417497-52417519 AAATAAAAAATTCAATGGGTTGG - Intergenic
1139089152 16:63622679-63622701 AAAAAGAGAAGACAATGGAAAGG + Intergenic
1139151561 16:64387869-64387891 AAATAAAGAGGACAATGGAAAGG - Intergenic
1139823668 16:69740317-69740339 AAATACAGAATGAAATGGGTGGG + Intergenic
1140694188 16:77515878-77515900 ACACATAGAACACAATGGGATGG + Intergenic
1141868929 16:86771251-86771273 GGATAGAGAATCCAATGGAAAGG + Intergenic
1144140303 17:12341407-12341429 AAATAGAGAAGGAAATGGGAGGG + Intergenic
1144526024 17:15990566-15990588 AACTAGAAAATAAAATGGCAGGG + Intronic
1145126745 17:20307166-20307188 AAATATAAAATATAATGGTAAGG + Intronic
1145339771 17:21944118-21944140 AAGTATCGAATACAATGGAATGG + Intergenic
1145409078 17:22640245-22640267 AAATAGAGAGTAGAATGGTTAGG - Intergenic
1146244321 17:31265940-31265962 AAAAAGAAAAGACAATGGTAGGG - Intronic
1147432480 17:40381212-40381234 AAATAAAGAATACAAGGGTCGGG + Intergenic
1147512715 17:41085054-41085076 AAACACAGAATACAATTGGGTGG - Exonic
1147730596 17:42598521-42598543 AAATATAAAAAACAAAGGGAGGG - Intronic
1148045213 17:44739508-44739530 AAGTGGAGAGAACAATGGGATGG + Intronic
1148132034 17:45267765-45267787 AAACAGAGAGTACAATGGTGAGG + Intronic
1148616120 17:49000499-49000521 AAAGAGGCAATAAAATGGGAAGG + Intronic
1149180590 17:53931919-53931941 AAAGAGAGAAGAGAGTGGGAAGG - Intergenic
1149702994 17:58671049-58671071 AGATAGAGAATAGAATGAGAGGG - Intronic
1149836507 17:59917814-59917836 AAGAAGAGAAAACAGTGGGAAGG - Intronic
1150200688 17:63353941-63353963 AAATGGAGGAGAGAATGGGAAGG + Intronic
1150381470 17:64723613-64723635 AATTAGATATTACAATGGTATGG - Intergenic
1150822527 17:68446910-68446932 ACAGAGAGAAAACACTGGGAGGG + Intronic
1151447185 17:74174965-74174987 AAATAGCAAGTACAAAGGGAAGG + Intergenic
1152979184 18:257864-257886 AAACAGAGGATACAGTGAGAAGG + Intronic
1154274977 18:12950782-12950804 AAATATAGATTACAATAAGAAGG - Intronic
1155414965 18:25588058-25588080 AAATAAAAAATACAGTGGCAAGG - Intergenic
1155926487 18:31660962-31660984 GAAGAGAGAAGACAATGGCATGG + Intronic
1156518384 18:37700094-37700116 AAAGAGAGAAACAAATGGGAGGG + Intergenic
1158098311 18:53800712-53800734 AGACATAGAACACAATGGGAAGG + Intergenic
1158460259 18:57640140-57640162 AAAAAGGAAATACAATGGGGCGG - Intergenic
1159633503 18:70778101-70778123 AAATAGAGCAGAGAATAGGATGG - Intergenic
1159688193 18:71449873-71449895 ATAAAGAGACTACAATGGGGGGG - Intergenic
1161833388 19:6627147-6627169 AAGGAAAGAAGACAATGGGAGGG - Intergenic
1162234231 19:9293819-9293841 AAAGAGAAAATATAATAGGAGGG + Intergenic
1162669376 19:12242016-12242038 AAATAGAGATTACCAAGGGATGG + Intronic
1166565687 19:43764131-43764153 AAAATGAAAATACAATGTGATGG + Intergenic
1167406846 19:49315922-49315944 AAATATTTAATGCAATGGGAAGG - Intronic
1168131163 19:54320162-54320184 AAATAGAGGATGCAATGGTCTGG + Intergenic
1202641649 1_KI270706v1_random:96856-96878 AGAATGGGAATACAATGGGAGGG - Intergenic
925669420 2:6294768-6294790 AAATAGAGAATAGATTTGGAAGG - Intergenic
926309231 2:11662453-11662475 AAATAGAGAAAACAGAGGGGAGG + Intronic
926883357 2:17573651-17573673 CAATGGAGGATACAATGGGCAGG - Intronic
927604480 2:24474104-24474126 AAAGAGACAATACAATCAGAAGG + Intergenic
927663828 2:25015612-25015634 AAATAAAAAATAAAATGGGCTGG + Intergenic
927858908 2:26546531-26546553 AAATGGAGAAGAGAATTGGAGGG - Intronic
928066143 2:28166407-28166429 AAATAGTGAATACCACAGGAAGG + Intronic
928793964 2:34993045-34993067 AGATAGATAAAAAAATGGGAGGG + Intergenic
929293157 2:40215997-40216019 AAAAAAAGCATACACTGGGAAGG - Intronic
929371699 2:41232735-41232757 AAGTAGAGAGTAGAATGGCAAGG + Intergenic
929618317 2:43329964-43329986 AAATAGAGGAGACCAGGGGAGGG - Intronic
930855389 2:56010904-56010926 AAAGAAAGAATACAATGACATGG - Intergenic
930956894 2:57213658-57213680 AAATGGAGAATAAATTGGCAAGG + Intergenic
931151038 2:59573682-59573704 AAATAGAGAAGGCAATGCCAAGG + Intergenic
932117205 2:69062832-69062854 AAAAGGTGAATACAATGGGGGGG + Intronic
933487472 2:82941071-82941093 AAATTGAAAATACAAAGAGATGG - Intergenic
933699529 2:85244571-85244593 AAATGGAGAAGACTGTGGGAGGG + Intronic
934102815 2:88668970-88668992 AAGTGGAGAATACATTGGGGTGG - Intergenic
934497474 2:94820302-94820324 AGAATGGGAATACAATGGGAGGG - Intergenic
935108010 2:100063632-100063654 AAATGGAGAATACAATGAGAAGG + Intronic
935494029 2:103755905-103755927 AAATAGAGAATATTATAAGAAGG + Intergenic
935618457 2:105108985-105109007 AAACAGAGAAAACAATTAGAAGG + Intergenic
935764221 2:106349147-106349169 GAAAAGAGAATACAATGAAATGG - Intergenic
936242275 2:110798172-110798194 CAGAAGAGAAGACAATGGGAAGG - Intronic
936738439 2:115475100-115475122 CAATAGCCAAGACAATGGGAAGG + Intronic
937464295 2:122116785-122116807 AGATAGATAACACACTGGGAAGG - Intergenic
937688279 2:124722896-124722918 ACAGAGAGAAGACAATAGGAAGG - Intronic
938682292 2:133703911-133703933 AAATAGGAACTACAAGGGGAAGG + Intergenic
938785288 2:134623121-134623143 AGATAGAAAATAGCATGGGAGGG - Intronic
938869300 2:135456884-135456906 AAATAGAGAAGACTGTAGGAGGG + Intronic
939468762 2:142592467-142592489 ATATAGAAAATACAAGGTGATGG + Intergenic
939510723 2:143101256-143101278 AAATACAGAATACATAGGGATGG + Intronic
939648244 2:144728890-144728912 AAATAAAGACTTCAAAGGGATGG + Intergenic
939746913 2:145984301-145984323 GAAAAGAGAAGACAATGGAATGG - Intergenic
939796301 2:146648267-146648289 AAAAAGAGAACAAAATTGGAGGG + Intergenic
939954495 2:148515295-148515317 ATGTAAAGTATACAATGGGAGGG - Intronic
940307565 2:152243028-152243050 AAACATAAAATACAATGGGATGG - Intergenic
940446330 2:153782650-153782672 ACAAAGAGAAGACAATGTGAAGG + Intergenic
941052627 2:160751588-160751610 AAATAGAGGGCAAAATGGGACGG + Intergenic
941897207 2:170641176-170641198 AAATGGTGAATAAACTGGGAGGG + Intronic
942019352 2:171850882-171850904 AAGGAGAGAATAAATTGGGATGG - Intronic
943542677 2:189237289-189237311 AATAAAAGAATAAAATGGGAAGG - Intergenic
943820050 2:192310923-192310945 AAAAAGAGGGTAAAATGGGAAGG - Intergenic
944971476 2:204998122-204998144 AATTAGAGAAGACACGGGGAGGG + Intronic
945022658 2:205589658-205589680 CAATAGAGACAACAATGTGAGGG - Intronic
945464810 2:210156442-210156464 AAACAGAGAATAAAATGTGATGG + Intronic
945674709 2:212842067-212842089 AAATAGTAAATAAAATGGAAAGG + Intergenic
945720448 2:213411926-213411948 CTATAAAGAATACAAGGGGAAGG + Intronic
945789109 2:214281376-214281398 AAATTTAGAAGACAATGGGACGG - Intronic
946445565 2:219737265-219737287 GAATAAAGAAAACAAAGGGAAGG - Intergenic
947532344 2:230919019-230919041 AAATCAATAATACAAAGGGAAGG + Intronic
948092941 2:235310649-235310671 AAAGAGAGAAGACAATGGAATGG + Intergenic
948744043 2:240072609-240072631 AAATAAAGAAGAGATTGGGAAGG + Intergenic
1169236247 20:3932256-3932278 AAATAGAGAATGCAAAAAGACGG + Exonic
1169570788 20:6903012-6903034 AAAGAGAGAAAAAAAAGGGAGGG + Intergenic
1169625120 20:7557996-7558018 AAATAGATAACAGAATGGGAAGG - Intergenic
1171918985 20:31082890-31082912 AAAAACAGAATAGAATGGAATGG + Intergenic
1171919701 20:31088678-31088700 ACATATGGAATACAATGGAATGG + Intergenic
1171928197 20:31206832-31206854 ACATATGGAATACAATGGAATGG + Intergenic
1171953620 20:31442560-31442582 AAATAGTGAACACCAGGGGAAGG + Intronic
1172202275 20:33134918-33134940 AAAGAAAGACTACAGTGGGAAGG - Intergenic
1172256490 20:33522927-33522949 AAAAAGAAAATCCAATGGAAAGG + Intronic
1173073422 20:39792640-39792662 AAATAGAGAGAACAGTAGGATGG - Intergenic
1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG + Intronic
1174590131 20:51638564-51638586 AAAAAGAGAAAACAGAGGGATGG + Intronic
1174742004 20:53023950-53023972 AAACAGTGACTACAATGGAAAGG - Intronic
1174845711 20:53941239-53941261 AAATAGAAACCAAAATGGGAAGG - Intronic
1176527047 21:7927654-7927676 AAATACAGAATGGAATGGAATGG - Intergenic
1176610234 21:8875755-8875777 AGAATGGGAATACAATGGGAGGG + Intergenic
1176751494 21:10694670-10694692 AATAATAGAATAGAATGGGATGG - Intergenic
1177282660 21:19003910-19003932 AATTTGACAATACAATGGGCTGG + Intergenic
1177758127 21:25372074-25372096 AAGTAGTGAATAAGATGGGAAGG - Intergenic
1177931217 21:27286230-27286252 ATATATAGAAAACAATGTGAAGG - Intergenic
1178006410 21:28225704-28225726 GGATAGAGAATACAATGGAGAGG - Intergenic
1178354723 21:31901023-31901045 ACACAGAGAATGCCATGGGAAGG - Intronic
1179051198 21:37889793-37889815 TAAAAGAGGAGACAATGGGATGG - Intronic
1179200299 21:39212219-39212241 AAATAGATAATACAATTTGAAGG - Intronic
1180118521 21:45727984-45728006 AAAAAGAGAACAAAATGGGAGGG - Intronic
1180360292 22:11885002-11885024 AGAATGGGAATACAATGGGAGGG + Intergenic
1181262380 22:21607621-21607643 GAAAAGGGAGTACAATGGGAAGG + Intronic
1182114868 22:27750447-27750469 AAAAAGAAAATAAAAGGGGAGGG + Exonic
1183567668 22:38627569-38627591 AAATAAATAATAAAATGGAAAGG + Intronic
1183861069 22:40670522-40670544 AAATAAAAAATAAAATGGCAGGG + Intergenic
1184971097 22:48020583-48020605 CAAAAAAGAATCCAATGGGATGG + Intergenic
949433312 3:4001993-4002015 AAATAGGGAATATAGTGGCAAGG + Intronic
949551581 3:5116256-5116278 AATTAAAAAATACAAAGGGAAGG - Intergenic
950085055 3:10251379-10251401 AAAAAGAGAATACAATTCTAAGG - Intronic
950752771 3:15143952-15143974 AAAGAGAGAATTCAATGAGTTGG - Intergenic
950959316 3:17088410-17088432 AAATTGAGAACCCAAGGGGATGG + Intronic
951014819 3:17718768-17718790 AATTAGAGATTACCATGGGCTGG - Intronic
951230174 3:20169375-20169397 AAAAAGAGAATACCAAGGGGAGG + Intronic
952603900 3:35120577-35120599 AGATAGAGAAGACTATAGGAGGG + Intergenic
953240976 3:41149262-41149284 AACTAGGGCATAGAATGGGAAGG + Intergenic
953437375 3:42889123-42889145 AAAGGGAAAATACACTGGGATGG + Intronic
953553540 3:43923906-43923928 AAAGAGAGAATGAAAGGGGAAGG - Intergenic
955633351 3:60999172-60999194 ACATGGAGAATACAATGCTAGGG + Intronic
955954143 3:64271058-64271080 ATATGGAGAATATAATGAGAAGG + Intronic
956203358 3:66730573-66730595 CAATAGAGAATACAGTGAAACGG - Intergenic
956823506 3:72975086-72975108 AAATTGAGAAAACAATGAAAAGG + Exonic
958029634 3:88092411-88092433 AATTACAGAATGCAATGAGAGGG + Intronic
958050427 3:88336937-88336959 AATTAAAGAATTCAATGGGTAGG + Intergenic
958528695 3:95295380-95295402 AAATGTATATTACAATGGGATGG + Intergenic
959250738 3:103940682-103940704 AAACACAGAAAGCAATGGGATGG - Intergenic
959496976 3:107062910-107062932 AAAGAGAGAAGACAATGTCATGG + Intergenic
959762333 3:109980959-109980981 AAATACATAAAACAATGTGAGGG + Intergenic
959869298 3:111308465-111308487 AAATAGAAAATAAAATAGGCTGG + Intronic
959911123 3:111764751-111764773 TAATGGAGAACACAATAGGATGG + Intronic
960451399 3:117813332-117813354 AACTAGGGAAAAAAATGGGAAGG - Intergenic
961434305 3:126906135-126906157 ACATAGAGGAGACAATGGGTGGG - Intronic
962062397 3:131943948-131943970 AAACAGAGAGAACAATGGTATGG - Intronic
962620754 3:137175782-137175804 AGAAAGAGAATACAATTAGAAGG + Intergenic
963421849 3:145071128-145071150 AAATAGACATTGCAATGGGAAGG - Intergenic
963423756 3:145096437-145096459 ATAGAGAGAAAAGAATGGGAGGG - Intergenic
963538037 3:146552763-146552785 AAATATAGAATACATAAGGAGGG + Intergenic
964005059 3:151817155-151817177 AAAGAGGGAATACACTGTGAAGG - Intronic
964034085 3:152174759-152174781 AAATTGAGAATGCCATGGCAAGG - Intergenic
965393727 3:168136183-168136205 AAAAAGAGAATCCAAAAGGATGG + Intergenic
965403875 3:168247899-168247921 AAATAGAAAATACTATAGGGTGG + Intergenic
966318125 3:178671556-178671578 AAATACAGAATACAGAGAGAAGG + Intronic
966646395 3:182250469-182250491 GGATAGAGAAAACAATGGGGTGG - Intergenic
968016474 3:195338838-195338860 AAATACAGAATTCAGTGGGAAGG - Intronic
1202736916 3_GL000221v1_random:10542-10564 AGAATGGGAATACAATGGGAGGG + Intergenic
969164074 4:5289840-5289862 AAAAAGAGAATAAAATAGGCCGG - Intronic
970514580 4:16815504-16815526 AAATAGAGGATTCACTGGAAAGG - Intronic
970564160 4:17315136-17315158 ACATAGACAATCAAATGGGAAGG + Intergenic
970725452 4:19038861-19038883 CAAAAGAGAATAAAATGGAAGGG - Intergenic
970861741 4:20712174-20712196 AAAGAGAAAATAAAATAGGAAGG - Intronic
971560027 4:28067263-28067285 AAATTGAGAATTCAATGGCTGGG + Intergenic
972141709 4:35968663-35968685 ACAAAGGGAATACAATGGTAGGG + Intronic
972224046 4:36991303-36991325 AAATAGAGAAAACTATAAGATGG + Intergenic
973053062 4:45618546-45618568 AAAATGAGAATAAAAAGGGAAGG + Intergenic
973701536 4:53542322-53542344 TAATTAAGAATACAAAGGGATGG + Intronic
974113332 4:57550796-57550818 AAATAAAGAGTACAGTGGGATGG - Intergenic
974369965 4:61003261-61003283 ATATATAATATACAATGGGATGG + Intergenic
974447502 4:62005198-62005220 AAATAAAGGATACAATGAGATGG - Intronic
974829412 4:67171947-67171969 AAAAAAAGAAAACAATGGAAGGG + Intergenic
975997217 4:80330039-80330061 AAATAAGAAATACAATGGCATGG - Intronic
976908847 4:90275041-90275063 AGAAAGAGATTACAATGGAAGGG - Intronic
977020474 4:91752883-91752905 AAATAAAGAATGCAATGGAGTGG + Intergenic
977175312 4:93812882-93812904 AAATGCAGAATACAAGGGAATGG - Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
980344359 4:131593638-131593660 AAATAGAGCAAGGAATGGGATGG - Intergenic
981680448 4:147391660-147391682 AAACAGCAAATACAAAGGGAAGG + Intergenic
981845827 4:149167617-149167639 GAATAGAGAATACAAGGAAAAGG + Intergenic
983122253 4:163901058-163901080 ATATAAAATATACAATGGGATGG - Intronic
983634994 4:169888594-169888616 AAATAGAAAAAACAAAGGCAGGG - Intergenic
983866167 4:172769396-172769418 AAATATAGAATACAAGGGAGAGG + Intronic
984132207 4:175891863-175891885 AAATAAAGAATAAAATGAAAAGG + Intronic
984253527 4:177363550-177363572 ACATAGAGAGTACATTAGGAAGG + Intergenic
984516562 4:180748680-180748702 AAATAGAAGATAGAATGAGAAGG + Intergenic
1202769024 4_GL000008v2_random:182729-182751 AGAATGGGAATACAATGGGAGGG - Intergenic
985797982 5:1978378-1978400 AAAAAGAGAACAAAATTGGAGGG + Intergenic
986013353 5:3737075-3737097 AAATAGAGAATACAAAGAAACGG + Intergenic
986030966 5:3892209-3892231 GAATACAGAAGACAATGGGAAGG + Intergenic
987498589 5:18675656-18675678 CATTTGAGAATACAATGAGAAGG - Intergenic
987507945 5:18797778-18797800 AAATAGAGAAAAAGAGGGGAAGG - Intergenic
987715356 5:21561805-21561827 AATTAGAGAAGAGATTGGGAAGG + Intergenic
987852078 5:23368632-23368654 AATTAGAGAATATTATGGCACGG - Intergenic
987888211 5:23838650-23838672 AAATAGAAAATCCAAAGGGCAGG + Intergenic
987981554 5:25091673-25091695 AAATAGAGTTTACAAAGAGATGG + Intergenic
988167220 5:27609338-27609360 GAATTGAGAATAGAATGAGATGG + Intergenic
988260836 5:28883932-28883954 AAAAAGAGCATACCATGGGGTGG + Intergenic
988854676 5:35216375-35216397 AAATAGACAACAAAGTGGGAGGG + Intronic
988981645 5:36575479-36575501 AAATGAAGAATACAACTGGATGG + Intergenic
989271259 5:39536041-39536063 CAAAAGAGAATCCAATGGCAAGG + Intergenic
990054574 5:51556125-51556147 AAAAACAGAATAAAGTGGGAAGG + Intergenic
990124820 5:52501313-52501335 AAATAGAGCAGACAATGTGTTGG + Intergenic
990652040 5:57911701-57911723 AGATAGAGATTACAATAGGTTGG - Intergenic
990705513 5:58524592-58524614 AAATAGAGAAATAAATGGGAGGG - Intergenic
990774929 5:59295649-59295671 AAAAACAGAATACACAGGGAAGG - Intronic
990844070 5:60117513-60117535 AAAAAGGGAATATAAAGGGAAGG - Intronic
990906439 5:60808015-60808037 AAAAAAAGAATAAAATGGAATGG + Intronic
993129974 5:83884033-83884055 AACCATAGAAAACAATGGGATGG - Intergenic
993153130 5:84186161-84186183 AAATAGAGAAGACTATGGAATGG - Intronic
993390465 5:87314429-87314451 GAATAGAGAACATAATGGGTGGG + Intronic
993433211 5:87857724-87857746 AAAAAGAGAACACAATTGGAGGG + Intergenic
993482357 5:88439376-88439398 AAATACAGAATACAAAAGGGAGG - Intergenic
993636682 5:90352814-90352836 AAATAGATATTACAGTTGGAAGG + Intergenic
993965735 5:94358292-94358314 AACTAGAGAATAAGGTGGGAAGG + Intronic
994336980 5:98578510-98578532 ACATAGATAATAAAAAGGGAAGG - Intergenic
994840402 5:104917347-104917369 AAATCAAGGATATAATGGGAAGG + Intergenic
996292722 5:121872636-121872658 AATTAGAAAAAAAAATGGGAGGG - Intergenic
996425276 5:123307298-123307320 ACATAGATAATACTATAGGAGGG + Intergenic
996575560 5:124973472-124973494 AAATAAATAATAAAATGAGAAGG - Intergenic
996715628 5:126585548-126585570 AAATAGATAAAACAAAGGGTAGG - Intronic
996948993 5:129102289-129102311 CCATAGAGAATACAGTGGCAAGG - Intronic
997798850 5:136839708-136839730 CAATAGAGAAAAGAAAGGGAAGG + Intergenic
998875190 5:146592053-146592075 AAATAAATAATAAAATGAGAGGG + Intronic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
999640133 5:153664144-153664166 AAATAGAGAATACAATGGGAGGG + Intronic
1000378325 5:160605225-160605247 ATATAGAATATAAAATGGGAGGG + Intronic
1000644298 5:163742247-163742269 AAAAAGAAAATAGATTGGGAAGG - Intergenic
1001637535 5:173222426-173222448 AGAAAGAAAATGCAATGGGAAGG - Intergenic
1002872692 6:1181471-1181493 GAATCCAGAAGACAATGGGATGG + Intergenic
1003308382 6:4948205-4948227 ACATAGATCATACAGTGGGAGGG - Intronic
1004278400 6:14258259-14258281 TAAAAGAGAATAAACTGGGAGGG + Intergenic
1004611215 6:17241553-17241575 ACATAGAGCATACAGTGAGAAGG - Intergenic
1005158008 6:22829955-22829977 AACTAGTGAATATAATGAGATGG - Intergenic
1005630589 6:27703856-27703878 CAAGAGAGAATACAAGGTGAAGG - Intergenic
1005756158 6:28926576-28926598 AAATAGAGAAATTAATGGGAAGG - Intergenic
1005783938 6:29222695-29222717 AAATAGAGAAGAACAAGGGATGG + Intergenic
1006234331 6:32615245-32615267 AACTAGAGAATAAAATAGGTGGG + Intergenic
1007016025 6:38467719-38467741 AAATAGAGAAGTCAAGAGGAAGG - Intronic
1007120525 6:39377057-39377079 AAAAAGAGAAAACAACGGAAGGG - Intronic
1007334633 6:41145357-41145379 AAATAAAGAATGAAATTGGAGGG - Intergenic
1007455028 6:41970371-41970393 AAATAAAAAACAAAATGGGATGG + Intronic
1007862471 6:44927088-44927110 AAATAAAGAACAAAATGGAATGG + Intronic
1008090696 6:47291002-47291024 AAATACAGAATCCTATGAGAGGG + Intronic
1008589390 6:52977888-52977910 AAATATAGAATACATTTGCACGG - Intergenic
1009295106 6:61937194-61937216 AAATAAAAAACTCAATGGGATGG - Intronic
1009906097 6:69871603-69871625 AAATAGAAAATAATATGGAAAGG - Intronic
1010358682 6:74966180-74966202 AAATAGAGGAAGCAATGGGAAGG - Intergenic
1010385516 6:75275358-75275380 AAATATAGAGTTCAAGGGGAAGG - Intronic
1010489310 6:76454212-76454234 AAATGGAGAATACAGTAGGAAGG - Intergenic
1011070650 6:83378180-83378202 AAATAATTAATACAATGGGGGGG + Intronic
1011757779 6:90522210-90522232 AGAAAAAGAAAACAATGGGACGG + Intronic
1011840703 6:91494796-91494818 AAATAGAGAAAAAATTGGGGTGG - Intergenic
1011865882 6:91826384-91826406 AAATTATGAAGACAATGGGAGGG - Intergenic
1012252995 6:96999955-96999977 GAATAGAGACTACATGGGGAGGG + Intronic
1012498709 6:99864266-99864288 AATTGGAGAATTCTATGGGAAGG + Intergenic
1014050448 6:116946731-116946753 GAATAGAGAGTGCCATGGGAAGG - Intergenic
1014050988 6:116954141-116954163 AAATAAAGAGTATAATTGGATGG - Intergenic
1014190499 6:118490353-118490375 AAAGAGAAAATATAATGGGATGG + Intronic
1015211725 6:130706104-130706126 TAATAGAGGATACAAAGGAATGG + Intergenic
1015606426 6:134959902-134959924 GAATAGAGACTAGAATGAGAAGG - Intergenic
1015929099 6:138339035-138339057 TTATAGAGAAGACAATGGGAAGG - Exonic
1016206965 6:141479950-141479972 AAATTGAGAATACATAAGGAAGG + Intergenic
1016453040 6:144203175-144203197 AAAAAGGGAAGAAAATGGGAAGG + Intergenic
1018022025 6:159770507-159770529 AAATTAAGAATTCACTGGGATGG + Intronic
1018181802 6:161229696-161229718 AAAAAGAGAATACAGTAGAAAGG - Intronic
1021758806 7:23882973-23882995 AAATAGAAAATACCTTGAGAAGG - Intergenic
1022177824 7:27889060-27889082 ACATAGATACTACAATGAGATGG + Intronic
1022838967 7:34144448-34144470 AGATAGAGAATAAATTGGAAGGG + Intronic
1023482980 7:40654885-40654907 AAATAGACAATACAATTAGAGGG + Intronic
1023953124 7:44863623-44863645 AAATAGATAATACATTTGCATGG - Intergenic
1024760671 7:52593432-52593454 AATTAGAGAAAACAAAGGAATGG + Intergenic
1026056456 7:66988627-66988649 CAATAGATAAGACAATGGGTAGG + Intronic
1026721641 7:72836434-72836456 CAATAGATAAGACAATGGGTAGG - Intergenic
1027530010 7:79318484-79318506 AAATATAGAATTCAAAAGGATGG - Intronic
1027742733 7:82032492-82032514 AAATAGAGAAATCAAAGGAATGG - Intronic
1028111041 7:86941735-86941757 AAAATTAGACTACAATGGGAAGG + Intronic
1028646672 7:93105639-93105661 AAATAGATTATACAAAGGAAAGG - Exonic
1029193318 7:98787000-98787022 TAATAGAAAATGCAATGGGCTGG - Intergenic
1029909488 7:104130313-104130335 ATATAGAGACTACAGTGGAAAGG - Intronic
1030000579 7:105055744-105055766 AAATAGAGAAGGCAAAGAGATGG - Intronic
1030489664 7:110215763-110215785 AACTAGAAAATACAATGAGAAGG + Intergenic
1030733295 7:113015104-113015126 ATATAGAGAAGACAACAGGAAGG + Intergenic
1031180319 7:118405962-118405984 AATTACAGAACTCAATGGGAAGG - Intergenic
1031338121 7:120563293-120563315 AGATAGAAAATACAAGAGGAAGG - Intronic
1031404506 7:121368529-121368551 GAATAGAGAGGACAATTGGAAGG - Intronic
1031472486 7:122183014-122183036 AAGTGGAGAAAAGAATGGGAAGG + Intergenic
1032411043 7:131693524-131693546 AAATAAATAATAAAATGGGAGGG - Intergenic
1032918594 7:136520055-136520077 AAAAATAGAATACAATGGAAAGG - Intergenic
1032992619 7:137410678-137410700 ATATAGAAAATAAAATGGAAGGG + Intronic
1033117632 7:138639636-138639658 AAGAAGAGAAAAGAATGGGAAGG + Intronic
1033273535 7:139954164-139954186 AGATAAAGAATAAAGTGGGATGG + Intronic
1034247746 7:149661740-149661762 AAATACAAAATACACTGGGAAGG - Intergenic
1034483100 7:151338468-151338490 AAATCCAGAAGACAATGGAATGG - Intergenic
1034893931 7:154863202-154863224 AAATAGAAAAGACAAAGGAAAGG - Intronic
1036154729 8:6330707-6330729 AAATACTGAATACATTGGAAGGG + Intergenic
1036477718 8:9108877-9108899 AAAAAGAGAATACCATAGAAGGG - Intronic
1037085917 8:14850411-14850433 AGATGGAGAAAACAAAGGGATGG + Intronic
1038147567 8:24913132-24913154 AAAGAGGGAATGCAAGGGGAAGG + Exonic
1038658190 8:29473307-29473329 TAATAGAGGATACTATGGTATGG + Intergenic
1038828933 8:31035240-31035262 AAATAGAGATTAAAAAGGAAAGG + Intronic
1039982121 8:42416634-42416656 AAGAAGAGACTCCAATGGGATGG + Exonic
1041725729 8:61015755-61015777 AATTAGAATATAAAATGGGATGG + Intergenic
1041856494 8:62461607-62461629 AAATAGAGAATATCAAGAGATGG + Intronic
1041945732 8:63440167-63440189 AAATAGAGAATACCTTGCTAAGG - Intergenic
1042485885 8:69345305-69345327 AATAAGAGAATTCAGTGGGAGGG + Intergenic
1042493989 8:69435529-69435551 AAAAAGAAAATACAACAGGATGG + Intergenic
1042730925 8:71934099-71934121 AAACAGAAAAGACAAAGGGAAGG - Intronic
1043325088 8:79040265-79040287 AAGTACATAATTCAATGGGAGGG - Intergenic
1043332232 8:79131612-79131634 AAATACACAAAACAATGGGATGG - Intergenic
1044062420 8:87654377-87654399 AGATACAGAATATACTGGGAAGG + Intergenic
1044256292 8:90066633-90066655 AAATAGAGATTAATGTGGGAAGG + Intronic
1044541916 8:93417844-93417866 AATTGCATAATACAATGGGAAGG - Intergenic
1044962444 8:97543950-97543972 AAATGGAGAAGACAGTGAGAAGG - Intergenic
1045092803 8:98764222-98764244 AAGTAAAGAATACAATGAGAAGG - Intronic
1045134166 8:99195149-99195171 AAAAAGAGAATACCATTGGTGGG - Intronic
1046186519 8:110728413-110728435 AAATATAGAATAGAATGGAATGG - Intergenic
1046200237 8:110917169-110917191 AAATAGATATTACAATGACAGGG - Intergenic
1046708386 8:117480802-117480824 AAATAAAAAATAAAATGGAATGG + Intergenic
1047711210 8:127554236-127554258 AAAGAGAGAAGGCAATGGCAGGG - Intergenic
1049924494 9:395344-395366 AAACAGAAAAAACAAAGGGAAGG - Intronic
1050447602 9:5741979-5742001 AAACAGAGAATACAATGCAAAGG - Intronic
1050650312 9:7768752-7768774 AAATAGATAATGAAAAGGGATGG + Intergenic
1050728263 9:8676868-8676890 AAATATAGATGACAATGGGCCGG - Intronic
1051617165 9:19017229-19017251 CACTGGAGAATACAAGGGGAGGG + Intronic
1051745158 9:20288465-20288487 AACTATAGAATACAGTGGAAAGG + Intergenic
1052614213 9:30817293-30817315 AAAGAGGAAATACAATGGTAAGG + Intergenic
1052643163 9:31195222-31195244 AATTATAGAATACATTGTGAAGG - Intergenic
1053659671 9:40260167-40260189 AGAATGGGAATACAATGGGAGGG + Intronic
1053910041 9:42889519-42889541 AGAATGGGAATACAATGGGAGGG + Intergenic
1054371799 9:64406467-64406489 AGAATGGGAATACAATGGGAGGG + Intronic
1054524927 9:66116049-66116071 AGAATGGGAATACAATGGGAGGG - Intronic
1054679418 9:67896183-67896205 AGAATGGGAATACAATGGGAGGG + Intronic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055134351 9:72809896-72809918 AAATAGAGAAATCAATTGTATGG + Intronic
1055996959 9:82170571-82170593 ATACAGAGAAGACAATGGAAAGG - Intergenic
1056304049 9:85271652-85271674 AAATATAGAATAAAGTGGTATGG - Intergenic
1056516296 9:87353575-87353597 AAATAAAGAAAACAATAAGATGG - Intergenic
1057224355 9:93281542-93281564 ATATAGAGATTACAGTGAGATGG + Intronic
1057680809 9:97182521-97182543 AAAATGGTAATACAATGGGAGGG - Intergenic
1058400090 9:104605619-104605641 AAATAGAGAGTAAAATGGAATGG - Exonic
1058633857 9:107017723-107017745 TAATAGAGAAGACAGTGAGATGG - Intergenic
1059382636 9:113938869-113938891 AATCAGAAAATATAATGGGACGG - Intronic
1059805632 9:117797396-117797418 AAATGGAGAAAACACTGAGAAGG - Intergenic
1059849805 9:118325163-118325185 AAATAGAAAATAAAAGGGGAGGG - Intergenic
1202785477 9_KI270719v1_random:12791-12813 AAATTAAAAATACAATGAGAGGG + Intergenic
1203693905 Un_GL000214v1:76445-76467 AGAATGGGAATACAATGGGAGGG - Intergenic
1203729530 Un_GL000216v2:78196-78218 AAGGATTGAATACAATGGGATGG - Intergenic
1203390121 Un_KI270438v1:89849-89871 AAATACAGAATAGAATGGAATGG + Intergenic
1203390772 Un_KI270438v1:95402-95424 AAATATCGAATAGAATGGAATGG + Intergenic
1203642368 Un_KI270751v1:27618-27640 AGAATGGGAATACAATGGGAGGG + Intergenic
1203674972 Un_KI270756v1:14252-14274 AAAGAGAGAATGGAATGGAATGG - Intergenic
1186967955 X:14809168-14809190 AAATAGAAAAAACAATATGAGGG + Intergenic
1187273064 X:17796081-17796103 ATACAGAGAATACATTTGGATGG + Intergenic
1187406778 X:19011541-19011563 AAAAAGAGAATATTATGGGCTGG + Intronic
1187421574 X:19138664-19138686 ATATGCAGAATCCAATGGGAGGG - Intergenic
1187500376 X:19833719-19833741 AAAGAGAGAAGACCCTGGGAAGG - Intronic
1187588605 X:20691090-20691112 AAATGGTGAATACAATGGCGAGG + Intergenic
1187802086 X:23075116-23075138 AGATAGAGAATAGCAAGGGAAGG - Intergenic
1187923196 X:24225868-24225890 ACATACAGGATACAATGTGAAGG - Intergenic
1188697301 X:33210771-33210793 AAATAAAGAATAAAATGAGTTGG - Intronic
1189091890 X:38092332-38092354 AAAGAGAGAAGACAGTAGGATGG + Intronic
1189901164 X:45707830-45707852 AAATAGAGAATACCAGAGGCTGG + Intergenic
1189926052 X:45956691-45956713 AAATATAGCATTCACTGGGAGGG - Intergenic
1190588266 X:51968795-51968817 AAATATAGAATAGGATGGGTTGG - Intergenic
1192088254 X:68123848-68123870 AAACAAATAATAAAATGGGACGG + Intronic
1192457318 X:71287675-71287697 AAATAGAGAAAAAAATAGGCTGG - Intronic
1192779456 X:74279113-74279135 AAATAGAAAATGCAAGGGGCAGG + Intergenic
1193104475 X:77653523-77653545 AAATAGAGGTTACCAGGGGATGG + Intronic
1193396156 X:80986194-80986216 AATGAGAGAAGACAATGGAACGG - Intergenic
1193755844 X:85408138-85408160 AAGGAGAGAAAAGAATGGGAAGG - Intergenic
1194519750 X:94903550-94903572 AAATAGACAATACAATATGAAGG - Intergenic
1195600865 X:106746276-106746298 AAATACAAAATACAAGGTGAAGG - Intronic
1195601481 X:106753571-106753593 AAACAAATAATAAAATGGGAAGG + Intronic
1195769880 X:108339329-108339351 AAAAATCGAATACAATGAGAGGG - Intronic
1197189409 X:123629059-123629081 AAATTGTTAGTACAATGGGAGGG + Intronic
1197283864 X:124571567-124571589 AAATAGAGAAACCCATGGCAAGG + Intronic
1197416722 X:126184487-126184509 AAATGGAGTTTACAAAGGGATGG + Intergenic
1197696314 X:129554114-129554136 AAACAGAGAAATCAATGGGCTGG + Intronic
1197781783 X:130167029-130167051 CAAGAGAGAAGACTATGGGATGG + Intergenic
1197874880 X:131091917-131091939 AAATAGTGAAGACAAAAGGAAGG - Intergenic
1197962915 X:132024409-132024431 AAAATGAAAATATAATGGGAGGG - Intergenic
1197992081 X:132329194-132329216 CAAGTGAGAATACAATGAGAAGG - Intergenic
1198425641 X:136517169-136517191 ATAGAGAGAATAAAATGGCAGGG - Intergenic
1200270060 X:154674481-154674503 ATACACAGAATAAAATGGGATGG - Intergenic
1201104291 Y:10752008-10752030 AAATAAAGAATGGAATGGAATGG - Intergenic
1201104565 Y:10753863-10753885 AAATAAAGAATTAAATGGAATGG - Intergenic
1201112691 Y:10811925-10811947 AAATAAAGAATGGAATGGAATGG - Intergenic
1201119730 Y:10863660-10863682 AAATAAAGAATGGAATGGAATGG - Intergenic
1201120004 Y:10865661-10865683 AAATAAAGAATGGAATGGAATGG - Intergenic
1201199508 Y:11526659-11526681 AGATACCGAATACAATGGAATGG + Intergenic
1201210863 Y:11679268-11679290 AGATACAGAATGCAATGGAATGG + Intergenic
1201211308 Y:11683238-11683260 AAGAATAGAATACAATGGAATGG + Intergenic
1201214611 Y:11711437-11711459 AAAAAGAGAATAGAATGGAATGG + Intergenic
1202199155 Y:22328807-22328829 AAATAGAGAAAAAGATAGGAAGG - Intronic