ID: 999648966

View in Genome Browser
Species Human (GRCh38)
Location 5:153746949-153746971
Sequence GAGTGGAATCAGATGGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 191}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999648961_999648966 5 Left 999648961 5:153746921-153746943 CCCTTCTCAGCACAGTGAAAAAT 0: 1
1: 0
2: 1
3: 32
4: 362
Right 999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 191
999648959_999648966 22 Left 999648959 5:153746904-153746926 CCTGGTCTAAGCTGGACCCCTTC 0: 1
1: 0
2: 0
3: 7
4: 96
Right 999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 191
999648962_999648966 4 Left 999648962 5:153746922-153746944 CCTTCTCAGCACAGTGAAAAATC 0: 1
1: 1
2: 2
3: 35
4: 643
Right 999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 191
999648960_999648966 6 Left 999648960 5:153746920-153746942 CCCCTTCTCAGCACAGTGAAAAA 0: 1
1: 0
2: 2
3: 31
4: 267
Right 999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 191
999648958_999648966 23 Left 999648958 5:153746903-153746925 CCCTGGTCTAAGCTGGACCCCTT 0: 1
1: 0
2: 0
3: 14
4: 90
Right 999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG 0: 1
1: 0
2: 1
3: 13
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999648966 Original CRISPR GAGTGGAATCAGATGGATCT GGG Intronic
901928471 1:12582113-12582135 TAGAGAAATCAGTTGGATCTGGG - Intronic
903405761 1:23094286-23094308 GAGTGGAATTGGATGCCTCTAGG - Exonic
903572391 1:24315892-24315914 GAATGGAATCAGAAAGATGTGGG + Intergenic
904456336 1:30650403-30650425 GAGAGGCATCAGATGGAGCCAGG - Intergenic
904873214 1:33634818-33634840 GAGAGGAATGGGATGGAGCTGGG - Intronic
905813838 1:40932415-40932437 GATAGGACTCAAATGGATCTCGG - Intergenic
906273014 1:44496293-44496315 GATGGAAATCAGAGGGATCTGGG + Intronic
906721579 1:48009445-48009467 TAGTGAAATAACATGGATCTGGG - Intergenic
906795661 1:48694684-48694706 GAGTGGAAGCTGATGGATATTGG - Intronic
906820850 1:48928403-48928425 TAGTTGGGTCAGATGGATCTGGG + Intronic
907796222 1:57720516-57720538 GACTGTAATCAGATGGCCCTGGG + Intronic
907929097 1:58982463-58982485 TAGTGGAGTCAGACGCATCTGGG - Intergenic
910967045 1:92818337-92818359 TACTGGAAACAGATGAATCTTGG + Intergenic
911438255 1:97890976-97890998 GAGTTGAATTCAATGGATCTTGG + Intronic
911585443 1:99684892-99684914 CTGTGGAATCAGGTGGACCTGGG - Intronic
913268238 1:117066284-117066306 GTCTGGAATCAGTTGGACCTGGG - Intronic
913485082 1:119326892-119326914 CTGTGGAATCCGATGGACCTTGG - Intergenic
914459632 1:147871399-147871421 TATTGGAATCAGAGAGATCTTGG - Intergenic
919528637 1:198686780-198686802 TAGTGGAGTCAAATAGATCTGGG - Intronic
920347367 1:205314973-205314995 GAGTTGAAAGAGATGGATCTTGG - Intronic
920599583 1:207310185-207310207 GAGTGGAATTGGCTGGATCCTGG + Intergenic
921580054 1:216885863-216885885 GAGTGGAAGGAAATGGAACTGGG - Intronic
923643016 1:235784789-235784811 TAGTTAAATCAGATGGAGCTGGG - Intronic
1064753322 10:18553885-18553907 GAGTGGAATGAGATGGAGAATGG + Intronic
1065353501 10:24816611-24816633 GACTAGAATCAGAAGGCTCTGGG + Intergenic
1065513766 10:26505292-26505314 GAGTGGAACCAGACTAATCTGGG - Intronic
1066452814 10:35546933-35546955 GAGTGGAATCTCTGGGATCTGGG + Intronic
1068104396 10:52595122-52595144 GACTTGAATCAAATGGACCTGGG - Intergenic
1069630328 10:69893678-69893700 CAGTGGAAACAGCTGGACCTTGG + Intronic
1070257145 10:74822727-74822749 CACTGGAATCAGAATGATCTGGG - Intergenic
1075563695 10:123487554-123487576 GAGGGGAATGAGCTGGTTCTAGG + Intergenic
1075905532 10:126078411-126078433 GAGTGGAATTATATGGGCCTTGG - Intronic
1075907360 10:126093287-126093309 AAGTGGAAACAGATGCACCTTGG - Intronic
1076657360 10:132033603-132033625 GCGTGGAAACAGATGGATGATGG + Intergenic
1077869050 11:6246144-6246166 GGGTGGCATCTGATGGATTTAGG + Intergenic
1078104095 11:8347777-8347799 GGGTGGATTCAGATAGGTCTGGG - Intergenic
1081729547 11:45360483-45360505 CTGTGGAATCAGTTAGATCTGGG - Intergenic
1085249165 11:75130829-75130851 GAGCTGAATTAGTTGGATCTAGG + Intronic
1085477833 11:76798980-76799002 GAGAGGATTCAGATGGAGGTAGG + Intergenic
1085737427 11:79050985-79051007 GTGTGGAGTCAGATAGACCTGGG + Intronic
1087740544 11:101882325-101882347 GAGTGGAACCAAATGAATCTTGG - Intergenic
1089314122 11:117579077-117579099 GAGAGGAATTAGATGAGTCTGGG - Intronic
1089534606 11:119153282-119153304 GTTTGGAGTCAGGTGGATCTGGG - Intronic
1090967473 11:131611486-131611508 GTGTGGAATCAGATTGCTCTGGG + Intronic
1091403382 12:194453-194475 CAGTGGAGTCAGAGGGACCTGGG + Intronic
1092992419 12:13915750-13915772 GAGTGGCTTCAGATGGACTTTGG - Intronic
1093203754 12:16221881-16221903 GAGAGGAAAGAGATGGATCTAGG + Intronic
1093608750 12:21128133-21128155 CAGTGGAAGCATGTGGATCTAGG + Intronic
1094371036 12:29737700-29737722 TGGTGGAATCAGATGGATGTGGG + Intronic
1094602571 12:31922683-31922705 CAGAGGAACCAGATGGGTCTGGG + Intergenic
1094793682 12:33945278-33945300 GAGTGATAACAGATGGATCAGGG + Intergenic
1095104952 12:38222087-38222109 GAGTGATAACAGATGGATCCGGG + Intergenic
1095979819 12:47965553-47965575 GAATGGAATCAGAAGAAACTGGG + Intronic
1100337199 12:93642342-93642364 GAGTTGAACCAGATTGATCCAGG + Intergenic
1101752728 12:107596257-107596279 GGGTGGATTCAGTTGGATGTGGG + Intronic
1102073127 12:110038087-110038109 GAATGGAATCAGATAGATGGAGG - Exonic
1103149535 12:118624879-118624901 GCATGGAATCAGATGTGTCTGGG + Intergenic
1103218193 12:119219950-119219972 GAAGGGAATCAGATGGACCTGGG - Intronic
1103326956 12:120128101-120128123 TAAGGGAATCAGATGGATCCAGG + Intronic
1103971187 12:124673932-124673954 CAGTGGGAGCAGAAGGATCTGGG - Intergenic
1104833711 12:131772975-131772997 GAGAGGAAGCAGCTGGATGTTGG - Intronic
1106175708 13:27329417-27329439 CTTTGGAATCAGATGGATCTGGG + Intergenic
1107272157 13:38632526-38632548 ATTTGGAATCAGATGGACCTTGG - Intergenic
1109571338 13:64193989-64194011 GAGTAGCATGAGATGGATGTGGG - Intergenic
1111818456 13:93184442-93184464 GCCTGGTATCAGATGGATTTAGG - Intergenic
1112380261 13:98882295-98882317 GAGAGGAGTCAGAGGGAGCTGGG + Intronic
1113025547 13:105937281-105937303 GGGTGAAATCAAATGTATCTTGG + Intergenic
1113311544 13:109138119-109138141 CTTTGGAATCAGAGGGATCTGGG - Intronic
1115888626 14:38002399-38002421 TATTGCATTCAGATGGATCTAGG + Intronic
1117117209 14:52526566-52526588 GAATGGAAGCAGATGGCTCCTGG - Intronic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1118453159 14:65922433-65922455 TAATGAAATCAGATAGATCTGGG + Intergenic
1118711401 14:68522558-68522580 GCTTGAAATCAGATGGCTCTGGG - Intronic
1120790772 14:88579542-88579564 GAGTGGAATCAGATGGAGCAGGG + Intronic
1121244107 14:92450224-92450246 GAGTGGTCTCAGATGTGTCTGGG + Intronic
1121336140 14:93078582-93078604 CCGTGGAAGCAGATGGATATTGG - Intronic
1123774675 15:23566473-23566495 GAGAGGAAGCAGATGGCTGTGGG + Exonic
1124425863 15:29562075-29562097 GAGGATAATCAGATGGATCCAGG + Intronic
1124830381 15:33143142-33143164 GAGTAGAATTAAATGGAACTTGG - Intronic
1128274613 15:66342454-66342476 GAGGAGAATCACATGAATCTGGG - Intronic
1128797372 15:70475787-70475809 TACTGGAATCAGACAGATCTGGG - Intergenic
1128811410 15:70575555-70575577 AAGTGGAAACAGATGGATGGTGG - Intergenic
1128882225 15:71254409-71254431 GAGTGGAGTGAGATGGGGCTTGG + Intronic
1130314399 15:82782639-82782661 CAGTGGAATCAAATGGATGCTGG + Intronic
1131571771 15:93544793-93544815 GAGTGGAAACAGAGGGGACTAGG - Intergenic
1132985010 16:2761608-2761630 GAGTGGGAGCAGGTGGTTCTGGG - Exonic
1134597290 16:15506031-15506053 CATTGGGATCAGATAGATCTGGG + Intronic
1135464576 16:22674312-22674334 GACTGGAGAAAGATGGATCTGGG - Intergenic
1137554640 16:49462924-49462946 GATTGGAAGCAGAAGGCTCTGGG + Intergenic
1138171307 16:54852183-54852205 GACTGGAGGCAGATGGAACTAGG + Intergenic
1139915996 16:70428832-70428854 AGGTGGAATCAGACTGATCTGGG - Intronic
1141867241 16:86758969-86758991 GTGTTGAATCAGATGAAACTAGG + Intergenic
1146324439 17:31873553-31873575 GAGTGGCCTCAGGTGGTTCTGGG - Intronic
1147555295 17:41475333-41475355 ATGTGGAGTCAGATGGACCTGGG - Intergenic
1147880012 17:43647465-43647487 GGCTCTAATCAGATGGATCTGGG - Intronic
1148018542 17:44539067-44539089 GTGTGGCATCAGAGGGCTCTAGG + Intergenic
1148814568 17:50318224-50318246 CTGTGAAATCAGATGGCTCTGGG + Intergenic
1149186121 17:54000032-54000054 GAGTGGTATTAGATGGATACAGG + Intergenic
1149253184 17:54793936-54793958 GGGTGGAAAAAGTTGGATCTAGG - Intergenic
1149419801 17:56498899-56498921 GCGTGAAATGAGATGGATCATGG + Intronic
1150475969 17:65475432-65475454 GACTAGAATTTGATGGATCTTGG - Intergenic
1155416072 18:25601259-25601281 GAGTGGATTCTGGTGGAGCTGGG - Intergenic
1155740576 18:29283418-29283440 GAGTGGAGTCCAGTGGATCTAGG - Intergenic
1156516935 18:37688077-37688099 GAGAGGAAGCATTTGGATCTGGG + Intergenic
1160218054 18:76951272-76951294 TAGTGGAAGAAGATGGCTCTAGG - Intronic
1163475843 19:17525673-17525695 GAGTGGAGCCAGAGGGCTCTTGG + Intronic
1167212798 19:48143938-48143960 GATTGTAACCAGATGGATCCAGG + Exonic
1168632182 19:57965695-57965717 GAGTGTAATGGTATGGATCTTGG - Intronic
925655838 2:6148051-6148073 TTGTGGAATCACATGGTTCTTGG - Intergenic
926162078 2:10496151-10496173 GGGTGGGATCAGATGGAGGTGGG - Intergenic
927740763 2:25567759-25567781 GATGGGAATCAGATCTATCTTGG + Intronic
930844492 2:55887508-55887530 TACTGGAATCAGATTTATCTGGG + Intronic
931402762 2:61946072-61946094 GAGTGTATTCAGATGGTTGTGGG + Intronic
936277117 2:111108878-111108900 GAATGGAAGCAGATAGATGTAGG + Intronic
941075949 2:161007003-161007025 GACTGGCATGAGAGGGATCTAGG - Intergenic
944240045 2:197477391-197477413 GAGTGTTAACAAATGGATCTTGG + Intergenic
945040938 2:205743367-205743389 GAGTGGCTTCAGGTAGATCTGGG + Exonic
947596012 2:231412273-231412295 GGGTGGCATCCGATGGATCCCGG + Intergenic
947815408 2:233033353-233033375 GATTTGAAGCAGATGGACCTGGG + Intronic
1168919533 20:1519888-1519910 GAGTGAAATCTGATAGAACTTGG + Intergenic
1169713768 20:8593050-8593072 GCTTGGAATCAGATGAATCTAGG - Intronic
1174276870 20:49410222-49410244 CAGTGGAATCAGAAGGCCCTGGG + Intronic
1176668557 21:9710514-9710536 TTGTGGACTCACATGGATCTTGG + Intergenic
1179272273 21:39860719-39860741 CAGAGGCATCAGAGGGATCTGGG + Intergenic
1182200543 22:28564717-28564739 GAGAGGGATCAGAATGATCTGGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
1185410052 22:50677166-50677188 GCCTGGAATCAGACAGATCTGGG - Intergenic
950173124 3:10852944-10852966 GAGTGGAATGAGCAGGAGCTGGG + Intronic
950632864 3:14294739-14294761 GTGTGTACTCTGATGGATCTGGG + Intergenic
954144849 3:48629434-48629456 GAGTGGACAGAGATGGGTCTGGG - Intronic
955484311 3:59420235-59420257 GAGAGGAATGGGATGGATATAGG - Intergenic
956836766 3:73102172-73102194 GAATGGAGTCACATGGACCTGGG - Intergenic
960169968 3:114448452-114448474 GAGGGCAAACAGATGGATCAAGG + Intronic
962235099 3:133700633-133700655 CAGTGGAAAGGGATGGATCTGGG + Intergenic
962942430 3:140137886-140137908 GTTTGGAATCACATGGACCTGGG - Intronic
964392581 3:156213031-156213053 GAGTGGAAGCAGGGAGATCTGGG + Intronic
965382347 3:168005526-168005548 CAGTGGAATCAGACTGAGCTGGG + Intergenic
967310089 3:188097614-188097636 GAATGGAATCAGACAGACCTGGG + Intergenic
969951179 4:10837364-10837386 CATTGGAATCAGATGGCTCTGGG - Intergenic
973008315 4:45042015-45042037 GGTTGCCATCAGATGGATCTTGG + Intergenic
973636873 4:52869143-52869165 CAGTGGCATCAGACGGACCTGGG - Intergenic
973768948 4:54189146-54189168 GCATGGGATCAGGTGGATCTGGG + Intronic
974244307 4:59294084-59294106 ATGAGGAATCAGATGGAACTGGG + Intergenic
979002429 4:115241025-115241047 GAAAGGAATCAAATGGATTTAGG - Intergenic
980276938 4:130665181-130665203 GGGTGGAATCATAAGGCTCTAGG - Intergenic
980529656 4:134036569-134036591 CACTGGAATCAGATATATCTAGG + Intergenic
981840068 4:149101472-149101494 GAGTGGAATGAGTTGGAGCCAGG + Intergenic
985406225 4:189641013-189641035 TTGTGGACTCACATGGATCTTGG - Intergenic
986048353 5:4063115-4063137 GAGTGGAAGTATATGGATCATGG + Intergenic
990087898 5:52001465-52001487 GAGTGAAATCAGCTGGTTGTTGG + Intergenic
990193598 5:53288964-53288986 CAGTGGGATCGGATGGATCCTGG - Intergenic
993849250 5:92985473-92985495 CAGTGGAATCACTTGAATCTGGG + Intergenic
994403157 5:99308336-99308358 GAGTGGCTTCAGAGGGATATTGG + Intergenic
994805094 5:104436119-104436141 GTCTGGAATCAGATGGATGTTGG - Intergenic
999234836 5:150084277-150084299 GAGTGCAATGGCATGGATCTCGG - Intronic
999648966 5:153746949-153746971 GAGTGGAATCAGATGGATCTGGG + Intronic
1001021426 5:168186158-168186180 CTCTGGAATCAGATGGATTTGGG - Intronic
1001145473 5:169180297-169180319 GAGTGGCATGAGATGGCACTAGG + Intronic
1005665745 6:28052448-28052470 GACTTGAATCAGAGGGATCAGGG - Intergenic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1008571576 6:52821906-52821928 CAGTGGCCTCAGATGTATCTGGG + Intergenic
1009460651 6:63908864-63908886 GAGTGGAAAAAGATGTTTCTGGG + Intronic
1010498176 6:76561634-76561656 GAATGGAAGCAGATGGCTCCAGG + Intergenic
1013822658 6:114174075-114174097 GAGTGGGAACAGATGAAGCTGGG - Intronic
1015757218 6:136619868-136619890 GAGAGGAATCAAATGAATCCTGG + Intronic
1015924066 6:138292104-138292126 GACTGAAACCAGATGGATGTGGG - Intronic
1018155693 6:160983408-160983430 CAGTGGCCTCAGATGTATCTGGG - Intergenic
1019113793 6:169740274-169740296 GATTGCCAGCAGATGGATCTGGG - Exonic
1019138183 6:169925280-169925302 CATTGGAATCAGATAGGTCTGGG - Intergenic
1019496903 7:1345036-1345058 GAGGGGGCTCAGATGGCTCTGGG + Intergenic
1020800108 7:12722388-12722410 CACTGGAATCAGACAGATCTGGG + Intergenic
1020819989 7:12955284-12955306 CAGTGCAATGAGATGGACCTTGG + Intergenic
1027753280 7:82179174-82179196 GAGTGGAATTACATGGATTAGGG - Intronic
1034013195 7:147553335-147553357 GCATGGAATCACATGGTTCTGGG + Intronic
1034764148 7:153702090-153702112 GTGTGGATTCAGCTGGTTCTGGG + Intergenic
1035767428 8:2118607-2118629 GAGTGGGAAAAGATGGTTCTAGG + Intronic
1036175475 8:6533943-6533965 GACTGGTATCAGATGGTTTTAGG + Intronic
1038342920 8:26703063-26703085 GAGTGGAAACAGATGTTTCTGGG + Intergenic
1039784549 8:40821893-40821915 GAGTGGAATGAGAAAAATCTTGG - Intronic
1042628810 8:70792644-70792666 GAGTGGAAAGAGATGGGTGTGGG + Intergenic
1046564295 8:115878887-115878909 GAATGAAATCAGAGGGTTCTGGG + Intergenic
1047681286 8:127257165-127257187 GTGTGGAATGAGATGTATATAGG + Intergenic
1050019009 9:1264550-1264572 GGCTTGAGTCAGATGGATCTAGG - Intergenic
1050705322 9:8390291-8390313 GAGTGGAATGAGATGAGTTTGGG - Intronic
1051035188 9:12736053-12736075 GAGTGCAAGCAGATGGAATTGGG - Intergenic
1052467192 9:28843853-28843875 TAGTGGAATCAGAACGATTTAGG + Intergenic
1052540453 9:29804801-29804823 GAGGAGAAGCAGATGGATGTGGG - Intergenic
1055367027 9:75555633-75555655 TAGTGGAATCAGATGACTTTTGG + Intergenic
1055984002 9:82037017-82037039 GAAGGGAATCAGATTTATCTGGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1057954847 9:99399453-99399475 AAGTGGAGTCAGTTGGATCTGGG - Intergenic
1059348668 9:113649282-113649304 GAGTGGAAGCAGATGTGCCTGGG + Intergenic
1060271086 9:122142250-122142272 CTTTGGAATCAGATGTATCTGGG + Intergenic
1061446025 9:130638629-130638651 GAGTGTCATCGGATGGAGCTGGG + Intergenic
1203387331 Un_KI270438v1:67615-67637 GAGTGGTATCAAATGGATTGCGG + Intergenic
1203345005 Un_KI270442v1:27829-27851 GAATGGAATCAAATGGAATTTGG + Intergenic
1203657309 Un_KI270753v1:10427-10449 TTGTGGACTCACATGGATCTTGG - Intergenic
1186971856 X:14854742-14854764 GAGTGGAATTACATGGGTGTCGG - Intronic
1187475381 X:19606308-19606330 CTGTGGCATCAGATAGATCTGGG - Intronic
1188908981 X:35822543-35822565 GAGTCCATTCAGATGGATCCAGG - Intergenic
1191668491 X:63727237-63727259 CAGTGGAATCAGCCAGATCTGGG - Intronic
1192152468 X:68720682-68720704 GAGTAGAAAAAGGTGGATCTAGG - Intronic
1194399170 X:93421728-93421750 ACTTGGAATCAGATGCATCTGGG + Intergenic
1194799889 X:98259784-98259806 GACTGGAATCAGATACACCTGGG + Intergenic
1199376595 X:147118917-147118939 GAATGAGATCAGATGGAACTTGG + Intergenic
1199807194 X:151311950-151311972 TTTTGGAATCAGATAGATCTAGG + Intergenic