ID: 999652093

View in Genome Browser
Species Human (GRCh38)
Location 5:153777681-153777703
Sequence CAGTGTGTGTGAGGGGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1142
Summary {0: 1, 1: 0, 2: 4, 3: 120, 4: 1017}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999652093_999652099 17 Left 999652093 5:153777681-153777703 CCTCATCCCCCTCACACACACTG 0: 1
1: 0
2: 4
3: 120
4: 1017
Right 999652099 5:153777721-153777743 ATATCTCTGAGAACAATTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999652093 Original CRISPR CAGTGTGTGTGAGGGGGATG AGG (reversed) Intronic
900116350 1:1029301-1029323 CAGTGTATGGGTGGGGGTTGAGG + Intronic
900467972 1:2835046-2835068 CAGAGAGTGGGAGGGGGAGGTGG + Intergenic
900834125 1:4986874-4986896 CCGTGTGTCTGTGGGGGATGGGG - Intergenic
900938888 1:5784924-5784946 AAGTGTGTGTGTGGGGGGGGGGG + Intergenic
901000037 1:6144339-6144361 CAGCGAATGAGAGGGGGATGTGG + Intronic
901398890 1:9002592-9002614 CTGTCTTGGTGAGGGGGATGTGG - Intergenic
901678381 1:10899800-10899822 CTGGGTGTGTGATGGGGATGTGG + Intergenic
901755070 1:11436578-11436600 CAGTGTGTGTGGTGGGGTTTGGG + Intergenic
901799911 1:11701994-11702016 CAGTGTGTGTCAGCTGGAGGAGG - Intronic
901844083 1:11971182-11971204 CAGTGTGGGGCAGGGGGATGGGG + Intronic
901902339 1:12375851-12375873 TTGTGTGTGTGGTGGGGATGGGG - Intronic
902942078 1:19807815-19807837 CAGGTTGTGTGATGGTGATGGGG + Intergenic
902985744 1:20153091-20153113 CTGTGAGTGTGAGGGGGAAAGGG + Intergenic
903283904 1:22265284-22265306 GAGTTGGGGTGAGGGGGATGTGG + Intergenic
903374637 1:22858216-22858238 CAGTGAGTGAGAGGAGGAGGGGG + Intronic
903506423 1:23838722-23838744 CAGGGCGTGCGAGGGGGGTGTGG - Intergenic
903771508 1:25767248-25767270 GTGTGTGTGTGAGGGGAGTGTGG - Intronic
903771572 1:25767614-25767636 GTGTGTGTGTGAGGGGAGTGTGG - Intronic
903771606 1:25767816-25767838 TAGTGTGTGTGAGGGGAGTGTGG - Intronic
903771632 1:25767960-25767982 TGGTGTGTGTGAGGGGAGTGTGG - Intronic
903771648 1:25768048-25768070 GTGTGTGTGTGAGGGGAGTGTGG - Intronic
903771689 1:25768278-25768300 GCGTGTGTGTGAGGGGAGTGTGG - Intronic
903771695 1:25768325-25768347 TGGTGTGTGTGAGGGGAGTGTGG - Intronic
903771716 1:25768451-25768473 GTGTGTGTGTGAGGGGAGTGTGG - Intronic
903771731 1:25768526-25768548 TGGTGTGTGTGAGGGGAGTGTGG - Intronic
903771748 1:25768613-25768635 TTGTGTGTGTGAGGGGAGTGTGG - Intronic
903771780 1:25768817-25768839 TGGTGTGTGTGAGGGGAGTGTGG - Intronic
904978983 1:34480465-34480487 CAGTGTGTGTTGGGGGGTGGGGG - Intergenic
905120886 1:35681037-35681059 TTGTGTGTGTGTGGGGGGTGGGG - Intergenic
905393059 1:37650521-37650543 CAGTGGGAGGGAGGGGGCTGGGG + Intergenic
906038116 1:42766012-42766034 CTGTGTGTGTGTGGGGGCGGGGG - Intronic
906705770 1:47894140-47894162 CAGTGTGGGTGGGGGTGTTGCGG + Intronic
906849391 1:49231672-49231694 ATGTGTGTGTGAGGTGAATGTGG - Intronic
907035823 1:51215332-51215354 CAGGTTGTGAGAGGGGGAAGAGG - Intergenic
907244160 1:53097072-53097094 CAGTGTGTGTGAGCGTACTGAGG - Intronic
907244654 1:53100918-53100940 CAGGGTGTGTGAGTGGACTGAGG - Intronic
907244686 1:53101102-53101124 CAGTGTGTGTGAGTGTAACGAGG - Intronic
907244727 1:53101382-53101404 CAGTGTGTGTGAGTGTAATGGGG - Intronic
907325066 1:53632400-53632422 GAGTGTGACTGAGGGGCATGTGG + Intronic
907460171 1:54601193-54601215 GAGTGTGTGTGTTGGGGAGGAGG + Intronic
907745573 1:57209824-57209846 GTGTGTGTGTGAGGGGGAGAGGG - Intronic
907940976 1:59087001-59087023 CAGTGTGTTTGCTGAGGATGTGG - Intergenic
908033516 1:60027399-60027421 CAGAGAGAGTGAGGGGAATGTGG - Intronic
908527456 1:65001667-65001689 AAGTGTGTGTGTGGGGGGGGGGG + Intergenic
908561009 1:65306498-65306520 AGGTGTGTATGAAGGGGATGGGG + Intronic
909687070 1:78361771-78361793 CATTGTGTGTGGGGGGGAAGTGG + Intronic
909854850 1:80515912-80515934 CAGGGCTTGTGTGGGGGATGAGG - Intergenic
910102024 1:83587742-83587764 CAGTGGGGGTGTGGGGGATGTGG - Intergenic
910119102 1:83764791-83764813 CAGTGTGTGTGAAGGGGCTGAGG + Intergenic
911587274 1:99705219-99705241 CAGGGTGTGGAATGGGGATGTGG - Intergenic
912212738 1:107572385-107572407 TTGTGTGTGTGCGGGGGAGGTGG + Exonic
912439578 1:109688037-109688059 CTGTGTGTGTGTTGGGGGTGTGG + Intronic
912689616 1:111794566-111794588 CAGTGTTGGGGATGGGGATGGGG + Intronic
912734917 1:112142102-112142124 CATTGTGTGCGTGGGGCATGGGG - Intergenic
912826662 1:112910408-112910430 AAGTGTGTGTGAGGGGATGGTGG + Intergenic
912942700 1:114059151-114059173 TAGTGTGTGTGAGGGGGTGCTGG + Intergenic
912952603 1:114130549-114130571 GAGAGTGAGTGAGTGGGATGAGG - Intronic
913085015 1:115428905-115428927 CAGTTAGTCAGAGGGGGATGAGG - Intergenic
913500893 1:119471729-119471751 CAGTGCGTGTGATGGGGGTGTGG + Intergenic
913583263 1:120248352-120248374 CAGAGTGGGTGTGGGTGATGCGG + Intergenic
913624909 1:120649970-120649992 CAGAGTGGGTGTGGGTGATGCGG - Intergenic
914565250 1:148860188-148860210 CAGAGTGGGTGTGGGTGATGCGG + Intronic
914607575 1:149270060-149270082 CAGAGTGGGTGTGGGTGATGCGG - Intergenic
915320210 1:155052119-155052141 CATTGTGTGTTGGGGGGGTGGGG + Intronic
915323454 1:155068836-155068858 CAGACTCTGTGAGGGGGAGGGGG - Intronic
915342865 1:155185758-155185780 GAATGTGTGTGAGGGGGCTGGGG - Intronic
915460894 1:156070080-156070102 CAGTATGTATGGGGGGGTTGGGG + Intronic
915661494 1:157409297-157409319 CCGTGTGTGTGAGGTGAAAGTGG + Intergenic
915755642 1:158256876-158256898 CCGTGTGGGTGATGTGGATGCGG + Exonic
915762530 1:158329536-158329558 CCGTGTGGGTGATGTGGATGCGG - Exonic
915765271 1:158355917-158355939 CCGTGTGGGTGATGTGGATGCGG + Exonic
916451691 1:164926965-164926987 CAGTGTGTCTCAGGGTGCTGTGG + Intergenic
916683951 1:167127771-167127793 TGGTGTGGGTGATGGGGATGAGG + Exonic
916943384 1:169699824-169699846 CAAAGTGTGTGAGGGGGGTGGGG - Intronic
917002600 1:170375942-170375964 ATGTGTGTGTGGGGGGGGTGGGG + Intergenic
917121813 1:171651339-171651361 GTGTGTGTGTGGGGGGGGTGCGG - Intronic
917174246 1:172214510-172214532 ATTTGTGTGTGGGGGGGATGAGG - Intronic
917554314 1:176067964-176067986 CAGGGTGTGCGATGGGGGTGTGG - Intronic
917968596 1:180193689-180193711 CAGTGGGTGGGAGGGGGTGGGGG + Intronic
919539643 1:198830935-198830957 CAGGGTGTGTGATGAGGGTGTGG + Intergenic
919621745 1:199871430-199871452 CAGAGTGTGTGAGGGAACTGGGG - Intergenic
919723655 1:200867002-200867024 CCGTGTGTGTGAGTGGGGTGGGG - Intergenic
919746007 1:201009539-201009561 CAGTGTGAGGGAGGGGCCTGTGG - Intronic
920215886 1:204361412-204361434 TGGTGTGTGTGAGTGGGGTGTGG - Intronic
920680154 1:208066056-208066078 GTGTGTGTGTGGTGGGGATGTGG + Intronic
921055995 1:211542835-211542857 CAATGTGGGTGATGGGGTTGGGG + Intergenic
921134118 1:212244960-212244982 CAGAGTGAGTGAGAGAGATGGGG + Intergenic
921249230 1:213281025-213281047 CAGTGTGTGTGTGGGTGGGGAGG - Intergenic
921893817 1:220378993-220379015 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
921939843 1:220828124-220828146 CAGTGTGTGTATGGGGGTGGGGG - Intergenic
922006060 1:221531846-221531868 AAGTGTGTATGAAGGGGAGGGGG + Intergenic
922085619 1:222344224-222344246 ACGTGTGTGTGATGGGGAGGCGG + Intergenic
922085730 1:222345057-222345079 ATGTGTGTGTGATGGGGAGGTGG - Intergenic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
923030467 1:230245581-230245603 GTGTGTGTGTGAGAGAGATGTGG - Intronic
923037044 1:230291825-230291847 CAGTGACGGTGAGGGGGAGGGGG + Intergenic
923546511 1:234927463-234927485 CAGTGGGTGTGAGAAGGAGGAGG - Intergenic
923658010 1:235935077-235935099 GTGTGTGTGTGGGGGGGGTGTGG + Intergenic
923719751 1:236456718-236456740 CAGAGGGAGTGAGGGGGAGGGGG - Intronic
923786283 1:237071859-237071881 CAGAGTTTCAGAGGGGGATGAGG + Intronic
924000470 1:239545323-239545345 CAGAGTGTGGGAGGAGGGTGAGG + Intronic
924055177 1:240118090-240118112 CAGTGTGTTTGAGGAGGAGAAGG + Intronic
924708997 1:246519044-246519066 CAGTGTCTGGGAGGAGGCTGAGG - Intergenic
924941130 1:248812962-248812984 CTGAGTGGGTGAGGGGGAGGAGG - Intronic
1062781416 10:213167-213189 CAATGTCTGTGATGTGGATGGGG - Intronic
1062831467 10:608488-608510 GTGTGTGTGTGGGGGGGGTGGGG - Intronic
1062888490 10:1037825-1037847 CTGTGTGTGTGGAGGGGCTGGGG - Intergenic
1063404582 10:5781201-5781223 CAGTGTTGGTGTGTGGGATGAGG - Intronic
1063588972 10:7377970-7377992 TTGTGTGTGTGGGGGGGAGGTGG + Intronic
1063910830 10:10828503-10828525 CACTGTGTGTGGGGAGAATGGGG + Intergenic
1064992268 10:21266531-21266553 CAGTGTGGGTGTGGGGAATTGGG - Intergenic
1065178450 10:23101148-23101170 GAAAGGGTGTGAGGGGGATGAGG - Intronic
1065355189 10:24834154-24834176 AAGTGTGTGGGAGCTGGATGAGG + Intergenic
1065486265 10:26239090-26239112 TAGTGGGTGTGTGGGGAATGGGG - Intronic
1065513923 10:26506239-26506261 CCGTGTGTGTGTGGGGGGGGGGG + Intronic
1066220655 10:33334706-33334728 CTGTGGGTGGGAGGGGGAGGAGG + Exonic
1066304607 10:34128576-34128598 TTGTGTGTGTGAGGAGGAAGGGG + Intronic
1066517979 10:36185034-36185056 TAGTGTGTGTGTGTGGGAGGTGG + Intergenic
1066638458 10:37531474-37531496 CAGGGTCTGTCAGGGGGGTGGGG + Intergenic
1067214782 10:44293055-44293077 CCGCGGGTGGGAGGGGGATGGGG + Intronic
1067429069 10:46230979-46231001 AAGAGGGTGGGAGGGGGATGAGG + Intergenic
1067968524 10:50942294-50942316 AAGTGTGAGGGAGTGGGATGGGG + Intergenic
1068259924 10:54566506-54566528 CAGTGATTGTCAGGGGGTTGTGG - Intronic
1068365577 10:56045126-56045148 CATTGAGTCTGAGGAGGATGGGG - Intergenic
1068764871 10:60752028-60752050 ATGTGTGTGTCGGGGGGATGGGG - Intergenic
1069244637 10:66188566-66188588 CTGTGTGTGTGTGGGGGGAGGGG + Intronic
1069708772 10:70476050-70476072 ACGTTTGTGTGTGGGGGATGTGG + Intergenic
1069830214 10:71278455-71278477 CAGTGTGTGTACGGGCGGTGGGG - Intronic
1069841318 10:71341154-71341176 CAGTGGCTGTGAGAGGGGTGGGG - Intronic
1070688809 10:78509690-78509712 CAGAGTGTGTGCTGGGGCTGGGG - Intergenic
1070984036 10:80672855-80672877 GAACGTGAGTGAGGGGGATGTGG + Intergenic
1071074383 10:81733210-81733232 CAGGGTGTGTGATGGGGGTGTGG - Intergenic
1071120270 10:82268763-82268785 CAGTGTTTCTCTGGGGGATGGGG + Intronic
1071353159 10:84767076-84767098 CAGGGTGTGCGATGGGGATGTGG + Intergenic
1071486907 10:86108221-86108243 CAGGGTGTGCGATGGGGGTGTGG - Intronic
1071601952 10:86962725-86962747 CAGTGCGTCTGTGGGGGATGGGG - Intronic
1072638496 10:97193204-97193226 AAGTGGGTGTGATGGGGAAGGGG - Intronic
1072939609 10:99748773-99748795 CAGTGGGAGTGAGGGTGAAGGGG + Intronic
1072959139 10:99913760-99913782 AAGTGTGTGTGATGGAGTTGTGG - Intronic
1072988794 10:100169266-100169288 CTATGTATGTGAGTGGGATGGGG - Intronic
1073102654 10:101014874-101014896 CACTGTGTGTGAGGGCGAGCTGG - Intronic
1073112839 10:101072923-101072945 GAGTGTGTGTCAGGAGAATGTGG - Intergenic
1073152544 10:101321778-101321800 GTGTGTGTGTGATGGGGCTGGGG + Intergenic
1073338661 10:102729159-102729181 CACTGTGAGTGAGGGGGAGAGGG + Intronic
1073739541 10:106390958-106390980 TAGTGTGTCTGAGGGAGATTTGG + Intergenic
1074067744 10:110033005-110033027 CCTTGTGGGTGAGGGGAATGTGG + Intronic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074640004 10:115369252-115369274 GGGGTTGTGTGAGGGGGATGGGG + Intronic
1074685713 10:115960752-115960774 CTGTGTGTGTGTGAGGGAGGAGG - Intergenic
1074783254 10:116817509-116817531 CAGTGTGTGTGTGTGGGTGGGGG + Intergenic
1075087577 10:119423726-119423748 GAGTGTGTGTGTGCAGGATGGGG - Intronic
1075121299 10:119666761-119666783 CAGAGAGTGTGGGTGGGATGTGG + Intronic
1075221657 10:120590141-120590163 GAGTGCATGTGTGGGGGATGAGG + Intergenic
1075242667 10:120792819-120792841 CAGTGTGTGTGTGTGGGGTGGGG - Intergenic
1075242683 10:120792901-120792923 CAGTGTGTGTGTGGGGGGGGGGG - Intergenic
1075242776 10:120793264-120793286 GTGTGTGTGTGGGGGGGAGGGGG - Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1076066262 10:127450586-127450608 AGGTGTGTGTGATGGGCATGAGG + Intronic
1076292531 10:129358148-129358170 AAGTGTGTGTGTGGGGGGGGTGG + Intergenic
1076292533 10:129358150-129358172 GTGTGTGTGTGGGGGGGGTGGGG + Intergenic
1076307504 10:129475331-129475353 CTGTGTGTGTCTGGGTGATGGGG + Intronic
1076413694 10:130269946-130269968 CCGTGAGGGTGTGGGGGATGAGG + Intergenic
1076729282 10:132430145-132430167 CTGTGTGTGTGAGGGAGAGCAGG + Intergenic
1076825769 10:132967160-132967182 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1076896904 10:133317500-133317522 CTCTGTGTGTGTGGGGGGTGTGG - Intronic
1077169295 11:1159187-1159209 CAGAGGGTGTGAGGGCGAGGGGG + Intronic
1077462622 11:2718220-2718242 CAAGGTGTGTGAGGGGGATGTGG - Intronic
1077528883 11:3086078-3086100 CTGTGTGTGTGAAGGTGCTGGGG + Intergenic
1077538964 11:3137800-3137822 CAGTGTGTTTGTGTGTGATGAGG - Intronic
1077701428 11:4445511-4445533 CACTGGGAGTGAGGGAGATGAGG + Intergenic
1077889081 11:6405743-6405765 GAGTGTGAGTTAGGGGGAAGTGG - Intronic
1078127398 11:8581172-8581194 CTTTCTGTGTGAGGGGGATTGGG - Intronic
1078185977 11:9052522-9052544 CACTGTGTGTCAGGAGGCTGTGG - Intronic
1078367089 11:10715745-10715767 CAGTGTGGAGGAGGGGGATACGG - Intergenic
1078610385 11:12814368-12814390 CAGAGTGTGTGAGGGGCCTTTGG + Intronic
1079016112 11:16870292-16870314 TAGTGTGTGTGTGGGGGTGGGGG - Intronic
1079124347 11:17708240-17708262 CAGTGGGTGGGGTGGGGATGAGG - Intergenic
1079142476 11:17821381-17821403 TAGTTTGTATGAGGGAGATGAGG - Intronic
1079333635 11:19552885-19552907 GAGTGTGTGTGGGGGGGAAGGGG + Intronic
1079394096 11:20046585-20046607 GTGTGTGTGTGATGGGGAGGGGG - Intronic
1079408357 11:20164089-20164111 GAGTGAGTGTGAAAGGGATGGGG - Intergenic
1079701394 11:23553010-23553032 CTGTGTGTGTGAGGGGGTGGGGG + Intergenic
1079883286 11:25953374-25953396 TATTGTGTGTGTGGTGGATGTGG - Intergenic
1080576786 11:33607104-33607126 CTGTGTGTGTGAGGGGGTCGGGG - Intronic
1081003413 11:37702799-37702821 CAGGATGTGTGACAGGGATGTGG - Intergenic
1081924753 11:46816079-46816101 AATTGTGTGTTGGGGGGATGGGG - Intronic
1082783538 11:57304126-57304148 GAGTGTGTGTGTGTGGGGTGGGG - Intronic
1082799807 11:57406272-57406294 CAGTGGGAGGCAGGGGGATGGGG - Intronic
1083107705 11:60374298-60374320 CAGGGTGCGTGATGGGGGTGTGG - Intronic
1083176298 11:60952074-60952096 CAGTGGGGGTGAGGGGGACAGGG - Intronic
1083330075 11:61893335-61893357 CCCTGTGTGTGAGGTGGTTGGGG + Intergenic
1083634450 11:64112755-64112777 CAGTCAGTGAGAGGGGAATGGGG + Intronic
1084162472 11:67357229-67357251 CAGTGGCAGTGAGGGGGATCTGG - Intronic
1084555843 11:69875398-69875420 CTGTGTGTGTGAGTGGGGAGGGG - Intergenic
1084625013 11:70299761-70299783 GAGTGTGTATCAGGGGGATCAGG - Intronic
1084740292 11:71135026-71135048 CAGTGTGTGTGAGGCAGCAGAGG - Intronic
1085089723 11:73700598-73700620 AAGTGTGTGTGTGGGGGGGGGGG + Intronic
1086493764 11:87381786-87381808 GTGTGTGTGTGAAGGGGTTGGGG - Intergenic
1086609406 11:88736598-88736620 ATGTGAGTGTGAGGGGCATGGGG + Intronic
1087261192 11:96014128-96014150 CAGGGTGTGAGATGGGGAAGTGG - Intronic
1087991324 11:104747460-104747482 CAGGGTGTGTGACAGGGATATGG - Intergenic
1088000767 11:104877364-104877386 GTGTGTGTGTGGGGGGGGTGGGG + Intergenic
1088297243 11:108313073-108313095 CAATGTTTGAGAGTGGGATGTGG - Intronic
1088427680 11:109722981-109723003 CCGTGTGTGTAGGGGGGTTGGGG - Intergenic
1088547126 11:110970404-110970426 AAGTTTGTGGAAGGGGGATGTGG - Intergenic
1088548619 11:110987474-110987496 CTGTGTGTATGTGGAGGATGGGG - Intergenic
1088682390 11:112254653-112254675 CTGTGTGTGTGATGTGTATGTGG + Intronic
1089013328 11:115147637-115147659 AGGTGTGTGTGGGGGGGTTGGGG + Intergenic
1089226764 11:116930716-116930738 CAGTGTGGATGATTGGGATGAGG - Intronic
1089336044 11:117724786-117724808 CAGAGAGTGTCAGGGGGGTGTGG - Intronic
1089352556 11:117829676-117829698 CGGTGTGGGTGGGGGGGATTTGG - Intronic
1089523120 11:119078849-119078871 CAGCGTGTGTGAGCGCCATGGGG + Exonic
1089661784 11:119990821-119990843 CAGGGTGTGTGAGGTGGAGGTGG - Intergenic
1089735936 11:120550285-120550307 GAGTGAGTGGGAGGAGGATGGGG + Intronic
1090124240 11:124069484-124069506 CAGGGTGTGCGAAGGGGGTGTGG + Intergenic
1090229635 11:125092369-125092391 GAGTGTGTGTGGGGTGGCTGGGG + Intergenic
1090237438 11:125159891-125159913 CAGAGGGTGGGAGTGGGATGAGG + Intergenic
1090808258 11:130216358-130216380 CAGTGTGAGGGAGGGGGTCGAGG + Intergenic
1091011395 11:132004134-132004156 TTGTGTGTGTCAGGGGAATGAGG + Intronic
1091086565 11:132727010-132727032 CAGTGTGTGTGAGGAGCTTCAGG - Intronic
1091136618 11:133196672-133196694 CAATGTTTGTGAGGAGGGTGAGG + Intronic
1091624539 12:2112057-2112079 GAGTGTGTGAGAGAGGGCTGAGG + Intronic
1091685051 12:2555612-2555634 CAGCGTGTGGGAGGGGGACTGGG - Intronic
1091818397 12:3456393-3456415 CAGTGTGGGTGATGGATATGTGG - Intronic
1092046510 12:5434761-5434783 CTGTGTGTGTGAGGGAAAGGTGG + Intronic
1092119136 12:6031718-6031740 CTGTGTGTGTCTGGGGGACGGGG + Intronic
1092403568 12:8198595-8198617 AAGTGTGTGGGAGCTGGATGGGG - Intergenic
1092462395 12:8698045-8698067 GAGTGTGTGGGAGTGGGGTGAGG + Exonic
1092570036 12:9711207-9711229 CAGGGTGTGAGATGGGGGTGTGG - Intergenic
1093136262 12:15455304-15455326 TTGTGTGTGTGGGGGGGAAGGGG - Intronic
1093509089 12:19904515-19904537 CAGGGTGTGTGATGGGGGTGGGG - Intergenic
1093549350 12:20389226-20389248 CTGTGTGTGTGAGGAGGAAAGGG + Intronic
1094249232 12:28340614-28340636 CAGGGTGTGTAATGGGGGTGTGG + Intronic
1094284190 12:28773886-28773908 GTGTGTGTGTGTTGGGGATGAGG + Intergenic
1094361788 12:29638769-29638791 CAGGGTGTGTGATGGGGGAGTGG - Intronic
1095234296 12:39778127-39778149 CAGGGTGTGTGATGGGGGTGTGG - Intronic
1095641850 12:44494839-44494861 CAGGGTGCGTGATGGGGGTGTGG + Intergenic
1095920099 12:47520722-47520744 CAGGGTTTGTGAGGGGGTTGAGG - Intergenic
1095954473 12:47798395-47798417 CTGTGAATGTGTGGGGGATGTGG - Intronic
1096580021 12:52579064-52579086 GAGTGTGTGTGAGGGGAAAAGGG - Intergenic
1096829098 12:54300766-54300788 CAGGGTGTGTGTGGGGGGGGCGG - Intronic
1096901858 12:54891487-54891509 CAATGTGTCTGATGGGAATGGGG - Intergenic
1097051957 12:56229070-56229092 GAGGGAGTATGAGGGGGATGTGG - Exonic
1097604003 12:61730590-61730612 CACTGTGTGGTATGGGGATGTGG + Intronic
1098350675 12:69555994-69556016 CAGTGTGTGTGTGGCGGGGGGGG + Intronic
1098522396 12:71448060-71448082 GTGTGTGTGTGAGGGAGACGAGG - Intronic
1098554687 12:71804775-71804797 CAGGATGTGTGACAGGGATGTGG - Intergenic
1098680515 12:73348128-73348150 CTGTCTCGGTGAGGGGGATGTGG + Intergenic
1100328852 12:93567247-93567269 CAGTGTTTGTTTGGGGGATAGGG - Intergenic
1100704522 12:97185875-97185897 TAGTGTGTATGTGGGGGAAGGGG + Intergenic
1100992817 12:100267908-100267930 TATTGTGTGTGAGGTGGGTGGGG + Intronic
1101970534 12:109309404-109309426 GGGTGTGTGTGAGGGGGGCGGGG + Intergenic
1102208546 12:111107268-111107290 CAGGCTGTGTGAGGGGCCTGTGG - Intronic
1102466019 12:113131238-113131260 GAGCGTGTGTGGGGGGGGTGGGG + Intronic
1102681604 12:114694308-114694330 TGGTGTGTGTGTGGGGGGTGGGG - Intergenic
1102746176 12:115251018-115251040 CAGTGTGGGGGTGGGGGGTGCGG - Intergenic
1102756725 12:115347628-115347650 CAGTGTGTGTAGGGGGGGTCAGG + Intergenic
1103124960 12:118413737-118413759 CTGTCTGTGAGAGGGGGATATGG + Intronic
1103424715 12:120823198-120823220 GAGTGTGTGTGTGGGGGTGGGGG + Intronic
1104720230 12:131041270-131041292 GAGGGTGTGGGTGGGGGATGTGG + Intronic
1104872069 12:132006934-132006956 CAGTGTGTTTGATGGGAGTGTGG + Intronic
1104906184 12:132214647-132214669 CAGAGGGTATGAGGGGGATGTGG - Intronic
1104908243 12:132226942-132226964 CAGTGTGTATGGGGTGTATGTGG - Intronic
1104960666 12:132487267-132487289 CAGTGGGAGTGTGGGGGGTGGGG + Intergenic
1105415830 13:20210675-20210697 CAGTCTGTGAGAGAGTGATGGGG - Intergenic
1105600023 13:21878504-21878526 CAGTGTGACTGAGGGGCATAGGG - Intergenic
1105812208 13:24005607-24005629 CAGGGGGTGGGAGAGGGATGGGG + Intronic
1106098104 13:26668333-26668355 CAGTGTGTGAAAGAGGGATATGG - Intronic
1106134723 13:26965533-26965555 GTGTGTGTGTGAGAGAGATGGGG - Intergenic
1106463849 13:29995506-29995528 GTGTGTGTGTGAGGGGCAGGAGG + Intergenic
1107203536 13:37752588-37752610 AAGGGTGTGGGAGGGGGAGGGGG - Intronic
1107508077 13:41055465-41055487 GAGTTTGTGTGAGGGGAATGAGG - Intronic
1107649513 13:42530076-42530098 TAATGTGTGTGAGGGGGATTGGG - Intergenic
1108188950 13:47917476-47917498 CTGTGCCAGTGAGGGGGATGGGG - Intergenic
1109172823 13:59117620-59117642 CAAGGTGTGTGATGGGGGTGTGG + Intergenic
1109762753 13:66851564-66851586 GTGTGTGTGTGAGGGTGATGCGG - Intronic
1109956732 13:69578241-69578263 CTGTGTGTGTGATGGTGGTGGGG + Intergenic
1109956894 13:69580595-69580617 CAGTGGGTGGGTGGGGGGTGAGG + Intergenic
1110126057 13:71943373-71943395 CATTGGGTGTCAGGGGGAGGAGG + Intergenic
1110366443 13:74691587-74691609 CTGTGTGTGGGAAGGGGATGTGG + Intergenic
1110426752 13:75375762-75375784 GTGTGTGTGTGGGGGGGGTGGGG - Intronic
1110732993 13:78902482-78902504 CATTGTGTGTCAAGGGGATTTGG - Intergenic
1110779797 13:79451679-79451701 CAGTGTGTGGGAGGTGGTGGTGG + Intergenic
1110835229 13:80075019-80075041 CAGTGTGTGAGATAGGGGTGTGG - Intergenic
1110840137 13:80132834-80132856 ATGTGGGTGTGAGGGGGAGGTGG - Intergenic
1111495207 13:89039143-89039165 ATGTGTGTGTGAGGGGGTTGGGG - Intergenic
1111498069 13:89079281-89079303 GAGTGTGTGTGTGAGGGAGGTGG + Intergenic
1111647219 13:91046522-91046544 CAGTGGGGTTGTGGGGGATGAGG - Intergenic
1111936697 13:94565234-94565256 ATGTGTGTGTGAGGAGGAAGGGG + Intergenic
1111968239 13:94882800-94882822 TAGTGTGTGTTTGGGGGGTGGGG - Intergenic
1112362120 13:98727801-98727823 CGGGGTGAGTGAGGGGGAAGGGG - Intronic
1112721254 13:102248583-102248605 CAGAGTGGGAGAGGGAGATGGGG + Intronic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113039184 13:106085697-106085719 GACTGTGTGTGTGGGGGGTGGGG + Intergenic
1113138196 13:107117211-107117233 CAGTGAGTGTGACGAGGGTGAGG + Intergenic
1113140378 13:107141618-107141640 CAGCATGTGTGAGTGGGATAGGG - Intergenic
1113882757 13:113636835-113636857 AAGGGGCTGTGAGGGGGATGAGG + Intronic
1113993251 14:16045469-16045491 CAGTGTGTATGCGTGGGTTGCGG - Intergenic
1114845429 14:26314888-26314910 CAGGGTCTGTCAGGGGGTTGGGG + Intergenic
1115400012 14:32946321-32946343 GTGTGTGTGTTGGGGGGATGGGG - Intronic
1115435239 14:33364771-33364793 CAGTGGGGGTGTGGGGGGTGGGG - Intronic
1115854904 14:37621075-37621097 CAGTGTGTAGGAAGGGAATGGGG - Intronic
1115858555 14:37658420-37658442 AAGTGTGTGTGAGGTGGTGGGGG + Intronic
1115888811 14:38004292-38004314 GCGTGTGTGTGAGTGGGGTGGGG + Intronic
1116228049 14:42178550-42178572 AAGTGTGTGTGGGGGGGGAGGGG - Intergenic
1116911951 14:50476890-50476912 CAGTGTTTGTGAGGGTTGTGGGG - Intronic
1117069282 14:52042171-52042193 CAATTGGTGTGAGGGGGAGGAGG + Exonic
1117417475 14:55510493-55510515 GTGTGTGTGTGTAGGGGATGGGG - Intergenic
1117620072 14:57576674-57576696 CTGTGTGTGACAGGGGGAAGGGG + Intronic
1117627674 14:57656295-57656317 GAGTGTGTGTGGGGGGTGTGGGG - Intronic
1118184705 14:63526276-63526298 CAGTGTGTGTGCTGGGGAATGGG + Intronic
1118438393 14:65791505-65791527 AAGTGTGTGTGTAGGGGATGGGG + Intergenic
1119697560 14:76725862-76725884 CAGGGCGTGCGATGGGGATGTGG + Intergenic
1119717109 14:76867099-76867121 GGGTGTGTGTTGGGGGGATGGGG + Intronic
1120280403 14:82431371-82431393 CAGTGTGTGTGACAGGGGTGTGG + Intergenic
1120373797 14:83673946-83673968 CAAAGTGTGGGAGGGGGATGAGG - Intergenic
1121405014 14:93714432-93714454 CACTGGGTGTGAGGGGGGAGAGG - Intergenic
1121582445 14:95040953-95040975 CAGTGTTTGGAAGGGGGAGGGGG + Intergenic
1121590390 14:95101897-95101919 CAGTTAGTGTGATGGGGAAGGGG + Intronic
1121889116 14:97572752-97572774 ACGTGTGTGAGAGGGGGGTGAGG - Intergenic
1121953696 14:98195176-98195198 GAGTCTGAGTGAGGGTGATGTGG - Intergenic
1122210108 14:100168132-100168154 CGGTGTGTGTGTTGGGGGTGGGG - Intergenic
1122352385 14:101103597-101103619 CAGGCTGTGTGTGGGGCATGTGG + Intergenic
1122657397 14:103271394-103271416 TTGTGTGTGTGGGGGGGGTGTGG - Intergenic
1122882539 14:104696571-104696593 GAGTGTGAGGGAGGGGAATGGGG + Intronic
1122969754 14:105147751-105147773 CAGTGAGTGTGGGAGGGGTGTGG - Exonic
1202892117 14_KI270722v1_random:168416-168438 CAGGGTCTGTGAGGGAGCTGAGG - Intergenic
1124364669 15:29063297-29063319 CAGTGTCTGTATGGGTGATGCGG + Intronic
1124440918 15:29685737-29685759 CAGGGTGTGGGTGGGGGATTCGG - Intergenic
1124962345 15:34408488-34408510 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1124978969 15:34554710-34554732 CAGTGTGTGTGGTGTGTATGTGG - Intronic
1125183981 15:36909838-36909860 GAGTGTGTGTGTGGGGGTGGGGG + Intronic
1125314653 15:38418221-38418243 TAGTGTGTGTGTGGGTGGTGGGG + Intergenic
1125471475 15:40008608-40008630 CAGGGTGTGTGTGTGGGGTGGGG - Intronic
1125501026 15:40240382-40240404 CAGTGTGTGTCAGGAGGAGGGGG + Intronic
1125626928 15:41116322-41116344 CAGTGAGTGTGGGCGGGGTGGGG - Exonic
1125673181 15:41487874-41487896 TAGTGTGTGTGTGGTGGGTGTGG - Intergenic
1125953902 15:43776473-43776495 CAGGGTGTGTGAGCGAGGTGAGG - Intronic
1126013236 15:44323651-44323673 CAAAGGGTGTGAGGGAGATGAGG - Intronic
1126104457 15:45138443-45138465 GCGTATGTGTGAGGGGGGTGGGG + Intronic
1126469327 15:48990838-48990860 GCATGTGTGTGAGGGGGGTGGGG + Exonic
1126577381 15:50210350-50210372 CAGTATGTGTTCGGGAGATGAGG - Intronic
1127123688 15:55792333-55792355 CAGGTTTTGGGAGGGGGATGAGG - Intergenic
1127574083 15:60273163-60273185 CACTGTGGGGGATGGGGATGTGG + Intergenic
1128037841 15:64542110-64542132 GTGTGTGTGTGAGAGAGATGGGG - Intronic
1128401286 15:67284175-67284197 TAGTGTGGGTTAGGGGGAAGTGG - Intronic
1128794556 15:70455782-70455804 CAGTGTATGTTGGGGGGGTGGGG - Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1129593219 15:76936379-76936401 CAGTGTGTGGCGGGGGGGTGGGG + Intronic
1129688921 15:77702193-77702215 CAGTGTGTTAGTGGAGGATGGGG - Intronic
1129919176 15:79305036-79305058 TAGAGAGTGTGAGTGGGATGGGG + Intergenic
1129975325 15:79816761-79816783 CACTGTGTCTGAGGGCGAAGGGG + Intergenic
1130015230 15:80180915-80180937 CAGGGTCTCTGAGGGGCATGAGG + Intronic
1130106560 15:80932885-80932907 CTGTGTGTGAGAGGGAGGTGGGG - Intronic
1130106562 15:80932887-80932909 GACTGTGTGTGAGAGGGAGGTGG - Intronic
1130861214 15:87892073-87892095 GTGTGTGTGTGTTGGGGATGGGG - Intronic
1130881963 15:88062984-88063006 GTGTGTGGGTGAGGGGGATGGGG - Intronic
1130881966 15:88062990-88063012 AAGTGTGTGTGTGGGTGAGGGGG - Intronic
1131294582 15:91135993-91136015 AAGTGTGTGTGTTGGGGAAGAGG - Intronic
1131298027 15:91169421-91169443 CAGGGTGGGGGTGGGGGATGGGG - Intronic
1132023155 15:98382279-98382301 CAGTAAGTGTGAGGGAGCTGAGG + Intergenic
1132843740 16:1990602-1990624 GGGTGTGTGTGCGGGGGAAGGGG - Intronic
1133026858 16:2992367-2992389 CAGTGTGTGAGGGGTGGATCTGG - Intergenic
1133658715 16:7893011-7893033 CAGGTTGTGTGATGTGGATGAGG + Intergenic
1134045434 16:11097749-11097771 CAGTGTCTGAGAGTGTGATGAGG + Intronic
1134249000 16:12561385-12561407 CTGTGTGTGTGGCGGGGATGTGG - Intronic
1134775592 16:16850574-16850596 CAGTGAGTGTGAAAGAGATGAGG + Intergenic
1134824801 16:17275847-17275869 CAGGGTGTGTGTGGGGGATAGGG - Intronic
1134891741 16:17847119-17847141 CAGTGGCTGAGAGGGTGATGTGG + Intergenic
1135424329 16:22324823-22324845 CAGTGTGGGTGAGGAGCGTGGGG - Intronic
1135698346 16:24610130-24610152 CAGTCTGTGAGCGGGGGCTGGGG + Intergenic
1135956173 16:26958268-26958290 CCATGTGTGTCTGGGGGATGGGG + Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1135964537 16:27024868-27024890 CACTGTGTGTGTGGGGGGGGGGG - Intergenic
1136747733 16:32606754-32606776 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1137559673 16:49494600-49494622 CAGTTTGTGTGATGGTGGTGGGG + Intronic
1137625136 16:49903012-49903034 CTGTTTGTGTGAAGGGGTTGAGG + Intergenic
1137868895 16:51930393-51930415 GTGTGTGTGTGATGAGGATGAGG - Intergenic
1138128275 16:54456646-54456668 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
1139202195 16:64989215-64989237 GATTGTGTGTGAGGGTGAGGGGG + Intronic
1140002639 16:71040489-71040511 TTGTGTGTGTGGGGGGGAGGGGG - Intronic
1140200039 16:72887628-72887650 CAGTGTGTGTGGGGTGTGTGGGG + Intronic
1140529878 16:75655968-75655990 ACGTGTGTGTGAGGGGTAGGGGG - Intronic
1140905016 16:79402513-79402535 CAGTGGGTGTGACGGGGGAGAGG + Intergenic
1140932997 16:79645079-79645101 GTGTGTGTGGGAGGGGGATGGGG + Intergenic
1140949877 16:79806813-79806835 CAGTGTGTGTGTGGCGGGGGCGG + Intergenic
1141069430 16:80939917-80939939 CAGTGTGGGAGAAGGGGCTGAGG - Intergenic
1141125823 16:81400283-81400305 CAGTGAGTGTGTGGGGAAAGGGG - Intergenic
1141160611 16:81627190-81627212 GAGTGTGTGTGTGTGGCATGTGG + Intronic
1141161027 16:81629314-81629336 CAGTGTGTTTGGGGAAGATGTGG - Intronic
1141167227 16:81668833-81668855 CAGTGAGTGTGAGGTGGGTGTGG - Intronic
1141167232 16:81668860-81668882 CAATGAGTGTGAGGTGGGTGTGG - Intronic
1141167242 16:81668907-81668929 CCGTGAGTGTGAGGTGGGTGTGG - Intronic
1141407373 16:83806521-83806543 AGGTGTGAGTGAGGGGGAAGGGG + Intergenic
1141494335 16:84396623-84396645 CTGAGTGAGTGTGGGGGATGGGG + Intronic
1141633632 16:85302453-85302475 CGGTGTGTGTGTGGGGGCGGGGG - Intergenic
1141658457 16:85428777-85428799 CAGTGGGTGGGAGCGGGCTGGGG + Intergenic
1141768500 16:86074377-86074399 GAGTGAGTGTGAGTGGGATGAGG + Intergenic
1141883021 16:86872424-86872446 CAGAGTGGGTGAGGGAGACGAGG - Intergenic
1203049868 16_KI270728v1_random:865963-865985 CAGTGTGTGTGTGTGTCATGGGG - Intergenic
1142815709 17:2423541-2423563 CGGTGTGTGGGAGGATGATGGGG + Intronic
1142954362 17:3511146-3511168 CGGGGTGTGTGTGGGGGCTGAGG + Intronic
1143688785 17:8542447-8542469 CTGTGTGTGAGAGAGGGATTGGG - Intronic
1143841678 17:9737218-9737240 TTGTGTGTGTGTGGGGGGTGGGG + Intergenic
1144156077 17:12504504-12504526 GAGGGGGTGTAAGGGGGATGAGG + Intergenic
1144176267 17:12710698-12710720 CAGTGTGTGGTAGGGTGCTGTGG - Intronic
1144185109 17:12789617-12789639 CGGCGCGCGTGAGGGGGATGCGG + Exonic
1144209971 17:13005902-13005924 CAGTGTGAGTGTGGGGGGTAAGG - Exonic
1144426263 17:15145106-15145128 CTCTGTGTGTGTGGGGGAGGGGG - Intergenic
1144603999 17:16647800-16647822 CAGTGTTTGGTGGGGGGATGTGG + Intronic
1144612046 17:16728725-16728747 GAGAGTGTGGGAGGAGGATGAGG - Intronic
1144679608 17:17184259-17184281 CTGTGAGTGTTATGGGGATGTGG - Intronic
1144710670 17:17399557-17399579 CAGTGTGTGGGTGGGGGCAGGGG - Intergenic
1144840205 17:18181391-18181413 TGGTGTGTGTGAGGGGGAGGGGG + Intergenic
1144900689 17:18586659-18586681 GAGAGTGTGGGAGGAGGATGAGG + Intergenic
1145013812 17:19384298-19384320 CTGGGTGTGTGACAGGGATGTGG + Exonic
1145131764 17:20359080-20359102 GAGAGTGTGGGAGGAGGATGAGG - Intergenic
1146531194 17:33609003-33609025 CAGTGGGTGTGAAGGAGGTGGGG + Intronic
1146534975 17:33642209-33642231 CATTGTGTGTGGGGGGGGGGGGG - Intronic
1146645222 17:34572717-34572739 CATTGTGTGGGAGAGGGAAGTGG - Intergenic
1147314234 17:39611970-39611992 GAGTGTGTGTGGAGGGGAGGTGG + Intergenic
1147536174 17:41324468-41324490 CAGTGTCTGGGAGGAGGCTGAGG + Intergenic
1147611280 17:41803177-41803199 CAGGGTGTGTGTGGGTGCTGGGG - Intronic
1147621059 17:41867210-41867232 CTGTTTATGTCAGGGGGATGGGG - Exonic
1147887028 17:43691080-43691102 CAGTGTGTGTGTGAGGGGTGGGG + Intergenic
1148085149 17:44989492-44989514 CAGTGTGTGGGAGTGGGAAGGGG + Intergenic
1148647733 17:49228953-49228975 GTGTGTGTGTGTTGGGGATGGGG - Intronic
1148778498 17:50109107-50109129 AAGTGTGTGTGGGGTGAATGGGG - Intronic
1148778605 17:50109561-50109583 CAGTGCGTGTCTGGGGGTTGAGG - Intronic
1148891579 17:50811419-50811441 CTGGGTGGGTGAGGGGGAAGGGG - Intergenic
1149318301 17:55459171-55459193 CAGGGCGTGTGATGGGGGTGGGG - Intergenic
1149385727 17:56141663-56141685 CAGGGTGTGTGTGGGGGGTGGGG + Intronic
1149856565 17:60088101-60088123 CAGTGTGTGTGGGGAGGAGAGGG - Intergenic
1149882653 17:60308409-60308431 CAGGGTGTGTGATGGGGGTGTGG - Intronic
1150441407 17:65194760-65194782 CTGAGTGTGTGAGGGAGGTGGGG + Intronic
1150616863 17:66778941-66778963 CACTGTGTTTGAGGCGGGTGAGG - Intronic
1151081683 17:71336512-71336534 GAGTGGGTGTGAGGGGAAAGGGG + Intergenic
1151311023 17:73292489-73292511 TAGTGTGAGTGTGGGGGGTGGGG + Intronic
1151320896 17:73351848-73351870 CAATGTGTGGCAGGGGGAGGAGG + Intronic
1151376483 17:73692303-73692325 GTGTGTGTGTGGTGGGGATGGGG - Intergenic
1151569209 17:74917729-74917751 GAGAGTGTGGGAGGTGGATGCGG - Exonic
1151655676 17:75494937-75494959 CATTGGGTGTGAGGGAGATGTGG - Exonic
1151761124 17:76103751-76103773 AAGTGGGTGTGACGGGGACGGGG - Intronic
1152147190 17:78575409-78575431 CAGACAGTGTGAAGGGGATGGGG + Intronic
1152169531 17:78735199-78735221 CAGTGGGAGTGATGGGGGTGGGG - Intronic
1152318014 17:79591987-79592009 CAGTGTGTGTGTGTGGAGTGTGG + Intergenic
1152378636 17:79930987-79931009 CAGTGTCTCTGAAGGGGCTGGGG - Intergenic
1152435089 17:80271570-80271592 GAGTGTGTGTCAGGGAGAGGTGG + Intronic
1152970318 18:155264-155286 CAATGTGTGTCATGGCGATGAGG + Intergenic
1153990425 18:10394378-10394400 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
1154196704 18:12272138-12272160 GAGTGTGTGTGTGGGGGGGGGGG + Intronic
1155243768 18:23887787-23887809 CTGTGTGTCTGAGGGAGAAGAGG - Intronic
1155283744 18:24268042-24268064 GAGTGAGTGTGAGGGAGGTGAGG - Intronic
1155581026 18:27306393-27306415 CTGTGTGTTAGAGGTGGATGAGG - Intergenic
1156061056 18:33076682-33076704 TGGTGTGTGTGAGGGGGAGGAGG + Intronic
1156281004 18:35638459-35638481 CTGTGTGTGTGTGTGGGGTGGGG - Intronic
1156676239 18:39530036-39530058 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1156751198 18:40457866-40457888 CAGTGTGTGTGTGGTGGAAAGGG + Intergenic
1156766445 18:40662614-40662636 CAGGGCGTGTGGTGGGGATGTGG + Intergenic
1157119534 18:44895970-44895992 GAGTGTGTGTAAGGAGGGTGGGG - Intronic
1157236116 18:45966975-45966997 CAGAGTGTGGCAGGGGGATATGG + Intronic
1157700924 18:49761318-49761340 AAATGTGTGTGGGGGGTATGGGG - Intergenic
1157795107 18:50566465-50566487 CACTGAGTGTCAAGGGGATGGGG - Intronic
1158015078 18:52774615-52774637 CAGAGTGTGTGATGGGGGTATGG + Intronic
1158051689 18:53228832-53228854 GAGTGTGTGTTAGGGGAATAGGG - Intronic
1158180712 18:54712553-54712575 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
1158664801 18:59422718-59422740 AAGTGTGTGTGTGTGGGGTGAGG + Intergenic
1159603307 18:70449416-70449438 CTGTGTGTGTGAATGGGAAGGGG - Intergenic
1159647833 18:70940767-70940789 CTGTGTGTGTGTGTGGGGTGGGG + Intergenic
1159953361 18:74501847-74501869 CACTGTGTGTGAGGGGGAGCCGG - Intronic
1160240152 18:77117809-77117831 CAGTGGGTTGGAGTGGGATGGGG + Intronic
1160415031 18:78703787-78703809 CGGTGTGTGTGTTGGGGGTGTGG + Intergenic
1160415058 18:78703992-78704014 TAGTGTGTGTGTTGGGGATGTGG + Intergenic
1160530299 18:79558558-79558580 CAGGGGGCTTGAGGGGGATGGGG + Intergenic
1160628379 18:80228664-80228686 CAGTCTGTGGGCAGGGGATGGGG - Intronic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160962443 19:1729539-1729561 CAGTGTGTGTGAGTGGCAGAAGG + Intergenic
1160977480 19:1800467-1800489 CAGGGTGGGTGAGGGGGGCGGGG + Intronic
1161447480 19:4326773-4326795 GGGTGTGTGTGTGGGGGAGGGGG - Intronic
1162096894 19:8315604-8315626 TGATGTGTGAGAGGGGGATGTGG - Intronic
1162117786 19:8442027-8442049 CAGTGTGATTGAGGGGCAGGTGG + Intronic
1162125598 19:8498202-8498224 CAGTGAGTGTGGGGAGGAAGCGG - Exonic
1162432520 19:10637560-10637582 AAGTGTGTGTGATAGGGAAGAGG + Intronic
1162517034 19:11154743-11154765 CAGGGTCTGAGAAGGGGATGGGG + Intronic
1162528899 19:11224045-11224067 CAGTGTGTGTGTGTGGGGCGGGG + Intronic
1162591719 19:11596648-11596670 CTGTGTGTGTGACGGGGGTGGGG - Intronic
1162966038 19:14156557-14156579 GTGTGTGTGTGGGGGGGGTGGGG + Intronic
1163006154 19:14397827-14397849 CAGTGTGTGTGCTGGGGGTGGGG - Intronic
1163061591 19:14765613-14765635 CAGTGTGTGTGCTGGGGGTGGGG + Intronic
1163174211 19:15552762-15552784 GAGAGTGTGTGAGCGGGATCAGG + Intergenic
1163241559 19:16067027-16067049 AAGTGTGTGTGTGGGCGGTGGGG + Intronic
1163476963 19:17532224-17532246 CAGTGGGTGTCAGGGGGCTGTGG - Intronic
1163602751 19:18258659-18258681 CAGTGTCTGTGGGCAGGATGGGG - Intronic
1163697360 19:18770565-18770587 CGGTGTGTGTGTGTGGGTTGTGG + Intronic
1163781274 19:19250025-19250047 GATTATGTGTGTGGGGGATGTGG - Exonic
1163847526 19:19646019-19646041 CAGTGTGTGTGAGCCGGAGCAGG - Intronic
1164037720 19:21468777-21468799 CAGTGTGTGTTAGGGAGGTCTGG - Intronic
1164509887 19:28888609-28888631 CAGCGGGTGTGAGGGAGACGGGG - Intergenic
1164986740 19:32653784-32653806 CAGTGTGTGTGGGGCAGCTGAGG - Intronic
1165185068 19:34012167-34012189 CTGTGTGTGTGTGGGGGTAGAGG - Intergenic
1165323871 19:35102797-35102819 CAGAGTGAGTGAGGGGCAGGTGG - Intergenic
1166226156 19:41396830-41396852 GGGTGTGTGTGTGGGGGGTGGGG + Intronic
1166317540 19:41997555-41997577 GAGTGGGCGGGAGGGGGATGGGG - Intergenic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1166855029 19:45779107-45779129 GAGGGTGTGTCAGGTGGATGAGG - Intronic
1166997084 19:46724768-46724790 CAGTGGATGTGAGGGGAAGGCGG + Intronic
1167006033 19:46777190-46777212 CTGTGAGTGTCAGGGGGCTGCGG - Exonic
1167087643 19:47321054-47321076 TGGTGTGTGTGGGGGGGGTGGGG - Exonic
1167706095 19:51082144-51082166 ATGGGTGTGTGAGGTGGATGGGG - Intronic
1167824344 19:51958560-51958582 CAATCTCGGTGAGGGGGATGTGG - Intergenic
1168455948 19:56508327-56508349 CAGTGAGTGTGAGAGAGATAGGG + Intronic
925025661 2:605194-605216 TAGTGTGTCTGTGGTGGATGTGG - Intergenic
925167874 2:1729559-1729581 CAGGGTGGGGGAGGGGGGTGAGG + Intronic
925376972 2:3393327-3393349 CTGGGGGTGTGAGGGGCATGGGG + Intronic
925409225 2:3629347-3629369 CAGTGTGTGTGGCTGGTATGTGG + Intronic
925937954 2:8785499-8785521 CTGTGTATGTGTGGGGGAAGTGG + Intronic
926136438 2:10339940-10339962 GTGTGTATGTGAGGGGTATGGGG + Intronic
926898462 2:17722140-17722162 CAGGGTGTATGAGGTGTATGAGG - Intronic
926961637 2:18364288-18364310 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
927011231 2:18906635-18906657 GTGTGTGTGTGTGAGGGATGGGG + Intergenic
927347235 2:22059353-22059375 CAGTTTGTCTGAAGAGGATGGGG - Intergenic
927652983 2:24923377-24923399 CACTGTGAGTGAGATGGATGAGG - Intergenic
927702117 2:25275416-25275438 GAGTGTGTGTGAGGGGGCGGAGG - Intronic
928101663 2:28440863-28440885 CAGGGTGTGGGGTGGGGATGGGG + Intergenic
929662089 2:43797144-43797166 CAGTGTGTGTATTGGGGATGGGG + Intronic
929723015 2:44390519-44390541 GTGTGTGTGTGGGGGGGAGGTGG + Intronic
930335922 2:50045529-50045551 CATTGTCTGTGAGGGGAAGGAGG - Intronic
930398117 2:50848225-50848247 CAGGGCGTGCGATGGGGATGTGG - Intronic
930402264 2:50905271-50905293 CAGTGTGTGTCAGAGGGTTGGGG - Intronic
931228086 2:60351351-60351373 CATTGTGTGCTATGGGGATGAGG + Intergenic
932099186 2:68881031-68881053 CTGTGTGTGTTGGGGGGGTGTGG - Intergenic
932362630 2:71121683-71121705 CAGTGTGGGAGAGGGGGGAGTGG + Intronic
932423267 2:71613578-71613600 CAGTCTGGCTGAGGGGGGTGGGG + Intronic
932465229 2:71918029-71918051 TAGTGTGTGGCAGGGGGAAGGGG - Intergenic
932498484 2:72159669-72159691 CAGTGTCTGAGAGATGGATGGGG + Intergenic
933179135 2:79210482-79210504 CAGTGTGTGTGAGAGAGGTGAGG + Intronic
933944749 2:87276266-87276288 GACTGTGTGAGATGGGGATGGGG + Intergenic
934015704 2:87879446-87879468 CAGTGTGTGTCAGGGGTGGGGGG - Intergenic
934036268 2:88091163-88091185 GGGTGTGTGTGAAGGGGATGGGG + Intronic
934068728 2:88364302-88364324 CAGAGTGTGTGGGGGCGAGGGGG - Intergenic
934592260 2:95565548-95565570 AAGTGTGTGTCATGGGGATTTGG - Intergenic
934776934 2:96945268-96945290 TAGTGTGTGTGTGGGGGGTGGGG - Intronic
934957186 2:98632344-98632366 CAGGGCGTGTGATGGGGGTGTGG - Intronic
934985837 2:98884032-98884054 CGGCGTGTGTTGGGGGGATGGGG + Intronic
935297746 2:101665460-101665482 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
936231066 2:110699948-110699970 GCGTGTGTGTGAGGGGAATTGGG + Intergenic
936335462 2:111585313-111585335 GACTGTGTGAGACGGGGATGGGG - Intergenic
936419762 2:112352589-112352611 CACTGTGTGTTGGGGGCATGGGG + Intergenic
936528750 2:113260369-113260391 ATGTGTGTGTGTTGGGGATGGGG + Intronic
937230818 2:120397130-120397152 GAGTGTGGGTGTGGGGGAGGAGG + Intergenic
938102124 2:128504435-128504457 CAGTGTGTGTGGGGGGGGCGGGG + Intergenic
938141265 2:128796516-128796538 CCGTGTTTGTGGTGGGGATGGGG + Intergenic
938294274 2:130167731-130167753 CAGTGTGGATCAGGGGGCTGGGG - Intronic
938462375 2:131506159-131506181 CAGTGTGGATCAGGGGGCTGGGG + Intergenic
938471611 2:131568053-131568075 CAGTGTGTGGGAGATGAATGTGG - Intergenic
938651964 2:133392044-133392066 CAGTGTGTGTATGTGGGATGGGG - Intronic
938864193 2:135401458-135401480 GTGTGTTTGTGAGGGGGAAGGGG - Intronic
940003857 2:148993898-148993920 TAGTGTGTGTGTGTGGCATGTGG + Intronic
940017092 2:149118173-149118195 CAGTGTGTGTGCTGGGGCTGGGG + Intronic
941125260 2:161576674-161576696 CAGGGCGTGTGATGGGGGTGTGG - Intronic
941937583 2:170997366-170997388 CTGTGTGTGTGGGTGGGGTGGGG + Intronic
943559702 2:189446090-189446112 TAGGGTGTGTCTGGGGGATGGGG + Intronic
943906473 2:193505817-193505839 CTGGGTGTGTGATGGGGGTGTGG + Intergenic
943981276 2:194554457-194554479 ATGTATGTGTGAGGTGGATGAGG - Intergenic
944857662 2:203784112-203784134 CTGTGGGCCTGAGGGGGATGTGG + Intergenic
945599267 2:211838232-211838254 GAGTGTGTGTCAGCGGGGTGGGG + Intronic
945854430 2:215051638-215051660 GTGTGTGTGTGAAGGTGATGGGG + Intronic
946145950 2:217731188-217731210 CAGAGTGGGAGAGAGGGATGAGG - Intronic
946431695 2:219629819-219629841 CAGGGTGTGGGAGGGGGGTGGGG + Intronic
946445829 2:219739067-219739089 GTGTGTGTGTGGGGGGGGTGCGG + Intergenic
946778344 2:223167482-223167504 CAGGGCGTGTGAGGGGAATAGGG + Intronic
946841600 2:223825421-223825443 ATGTGTGTGTGAGAGGGAAGGGG - Intronic
947100260 2:226613223-226613245 CAGTGGGCATGAGGGGCATGTGG - Intergenic
947111754 2:226726117-226726139 CTGTGTGTGTGGGTGGGGTGAGG + Intergenic
947150247 2:227108113-227108135 CAGTGGGTGTGAGTGGCAGGGGG + Intronic
947201864 2:227621286-227621308 GTGTGTGTGTGATTGGGATGAGG + Intronic
947284810 2:228502198-228502220 CTGAGTGTGTGTGGGGGGTGGGG - Intergenic
947749647 2:232525606-232525628 GGGTGTGTGTGGGTGGGATGGGG + Exonic
947995764 2:234525906-234525928 GGGTGTGTGTGGGTGGGATGGGG - Intergenic
948039454 2:234888032-234888054 CAACTTGTGTGAGGGGAATGAGG - Intergenic
948166481 2:235866545-235866567 CAGTGTGCTGGAGGGGGAAGGGG + Intronic
948265361 2:236631991-236632013 CAGTGTGTGTGAGCGGGGAAAGG + Intergenic
948281020 2:236748145-236748167 CAGTGTGTGGGCTGAGGATGAGG - Intergenic
948563902 2:238871469-238871491 TGGTGTGTGTGGGAGGGATGTGG - Intronic
948916098 2:241035753-241035775 GAGTGTGGGGGTGGGGGATGGGG + Intronic
949043904 2:241861872-241861894 CTGTGTGTGTGCTGGGGATTGGG - Intergenic
949049130 2:241887882-241887904 CAGTGGCTCTGAGGGGGCTGTGG + Intergenic
1168804174 20:662986-663008 CTGTGTGTGGGAGTGGGGTGTGG + Exonic
1169631467 20:7637438-7637460 CATTGTGTGTGGGCAGGATGTGG - Intergenic
1169689797 20:8317518-8317540 GTGTGTGTGTCGGGGGGATGGGG - Intronic
1170549399 20:17463661-17463683 ATGTGTGTGTGTGGGGGGTGGGG - Intronic
1170997201 20:21373972-21373994 GAATGTGGGTGAAGGGGATGTGG + Intronic
1171274913 20:23848234-23848256 CAGTGGGTGAGAGGAGGGTGTGG + Intergenic
1171811773 20:29750388-29750410 CAGTGTGTGTGCGTGGGTTGCGG + Intergenic
1171867343 20:30497195-30497217 CAGCGTGTGTGCGTGGGTTGCGG + Intergenic
1171907900 20:30915320-30915342 CAGCGTGTGTGCGTGGGTTGCGG - Intergenic
1172900477 20:38331029-38331051 CAGCCTGTGAGAGGGGGAGGAGG - Exonic
1172934901 20:38613163-38613185 CATTGTGTGTGTTGGGGACGTGG + Intronic
1173247584 20:41347314-41347336 CAGTGTGAGTGAGGGAGAGATGG + Intronic
1173421669 20:42906713-42906735 CAGGGTGTGTGATGGGGGTGTGG - Intronic
1173706093 20:45111289-45111311 GAGTGTGTGTGTGGGGGCCGGGG - Intronic
1173751651 20:45481249-45481271 CTGTGTGGGTGTGTGGGATGGGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174128378 20:48325382-48325404 TAGTGTGTCTGAGGGGCAGGGGG - Intergenic
1174354381 20:49988429-49988451 GGGTGTGTGTGAGGGGAGTGGGG - Exonic
1174401076 20:50276299-50276321 AAGTGACTATGAGGGGGATGGGG + Intergenic
1174548573 20:51344713-51344735 CAGTTTGTGCAAAGGGGATGGGG + Intergenic
1174677556 20:52373055-52373077 CAGAGTGTGTGAGGGGAAGAGGG - Intergenic
1174783978 20:53415482-53415504 CTGTGTGTGTGGGGTGCATGGGG - Intronic
1174796488 20:53526918-53526940 CAGGGGGTGGGAGGGGGAGGTGG + Intergenic
1175791550 20:61743448-61743470 CAGTGGGCATGAGGGGCATGAGG - Intronic
1175793121 20:61754703-61754725 CAGTGTGTGTGCGGTGTGTGTGG - Intronic
1175793127 20:61754768-61754790 CAGTGTGTGTGTGGTGTGTGTGG - Intronic
1176371377 21:6063861-6063883 CAGTGTGGGGGAGGCGGGTGCGG - Intergenic
1177203473 21:17983901-17983923 AAGTGTGTGTGTGGGGGGGGTGG + Intronic
1177203475 21:17983903-17983925 GTGTGTGTGTGGGGGGGGTGGGG + Intronic
1177264537 21:18765453-18765475 CAGGGTGTGTGATGGGGATGTGG - Intergenic
1178384577 21:32138802-32138824 CAGGGTGTGTGACAGGGGTGTGG - Intergenic
1178438734 21:32581631-32581653 CAGGGTGTGCGATGGGGGTGTGG - Intronic
1178723782 21:35033462-35033484 CCATGTCTGTGATGGGGATGTGG + Intronic
1178810793 21:35879159-35879181 CAGTCTGTGTGAAGAAGATGTGG - Intronic
1179047623 21:37860619-37860641 CAGTGTGAGTGATGGGGAGAAGG - Intronic
1179176684 21:39012649-39012671 GAGTGTGTGTGTGAGGGGTGAGG - Intergenic
1179342326 21:40523943-40523965 CAGGGTGTGTGATGGGGGTGTGG - Intronic
1179752142 21:43474678-43474700 CAGTGTGGGGGAGGCGGGTGCGG + Intergenic
1179918109 21:44491058-44491080 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1180314017 22:11262044-11262066 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1180559684 22:16605596-16605618 GGGTGTGGGTGTGGGGGATGGGG + Intergenic
1180936978 22:19632323-19632345 CAGGGTGTGGGATGGGGGTGTGG + Intergenic
1181846455 22:25713246-25713268 GAGTGTGTGTGTGAGTGATGGGG - Intronic
1182002258 22:26929286-26929308 AAGTGAATGTGATGGGGATGGGG - Intergenic
1182243165 22:28933719-28933741 GTGTGTGTGTGGGGGGGGTGGGG - Intronic
1182476008 22:30576711-30576733 AACTGTGTGGGAGGGGGCTGTGG + Exonic
1182775406 22:32827866-32827888 CAGTGAGTATCTGGGGGATGAGG - Intronic
1182833336 22:33321467-33321489 CAGTGTGGGTGAGGGAGTTTAGG - Intronic
1183019596 22:35016569-35016591 CACTGTGTGTGTGGGGGGTGGGG - Intergenic
1183126696 22:35789112-35789134 CATTGTATGTGGGTGGGATGAGG - Intronic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1183326777 22:37198802-37198824 CGGTTTGTGTGTGGGGGGTGGGG - Intronic
1183376968 22:37471094-37471116 CACTGTGTGTGTAGGGGATGAGG - Intronic
1183384898 22:37509149-37509171 CAGTGTGTTTCATGGGGTTGGGG - Intronic
1183415190 22:37677623-37677645 CAGTGACAGTGAGGAGGATGAGG + Intronic
1183748033 22:39703631-39703653 GAGTGTGTGTGTCGGGGGTGGGG - Intergenic
1184090229 22:42289295-42289317 CAGAGTGTGTCGGTGGGATGTGG - Intronic
1184098462 22:42329259-42329281 CAGCCTGTGTGCTGGGGATGAGG - Intronic
1184239853 22:43206386-43206408 GTGTGTGTGTGCGGGGGGTGGGG - Intronic
1184395051 22:44230076-44230098 TTGTGTGTGTGAGAGAGATGGGG + Intergenic
1184400930 22:44274053-44274075 CAGGGTGGGTGGGGGGGAGGGGG - Intronic
1184482350 22:44755243-44755265 CAGTGTGTGTGGGAGGAAGGTGG - Intronic
1184538150 22:45101531-45101553 CAGAGTGGGTGAGGGGGGAGGGG - Intergenic
1185083012 22:48720146-48720168 CAGTGGGTGTGGCGGGGCTGGGG + Intronic
1185125161 22:49006511-49006533 GAGTGTGTGTGCGGGGGGGGGGG + Intergenic
1185351233 22:50340514-50340536 TGGTGTGTGTGGGGGGTATGTGG + Intergenic
949256381 3:2051531-2051553 CAGTCTCTGTGAGGGGGCAGAGG - Intergenic
949268281 3:2185550-2185572 CAGTGTATGCTATGGGGATGAGG + Intronic
949738933 3:7207480-7207502 CAGTGTATGTGAAGGGGATAAGG - Intronic
949828257 3:8185704-8185726 CAGGGCGTGTGATGGGGGTGTGG + Intergenic
949920595 3:8997180-8997202 CAGAGTGTGGGAGAGTGATGAGG - Intronic
950270897 3:11614095-11614117 GAGTGTGTGTGGGGAGGAGGCGG - Intronic
951704159 3:25526952-25526974 CAGGGTGTGTGTGGGAGGTGGGG + Intronic
952425639 3:33171702-33171724 CAGTGTGTATGTGGAGGGTGGGG - Intronic
952493509 3:33895075-33895097 TAGTGTGTGTGAAGGGGTTTGGG + Intergenic
952647692 3:35681503-35681525 AAGTGTGTGTAAAGGGGGTGTGG + Intronic
952784487 3:37139634-37139656 GAGTGTGTGTGACGGGGCTTGGG - Intronic
952967865 3:38632225-38632247 CTCTGTGTGTGGTGGGGATGGGG + Intronic
953031512 3:39183000-39183022 GTGTGTGTGTGATGGGGATAGGG + Intergenic
953793359 3:45965182-45965204 CTGTTTGGGTGAGGGGGCTGAGG - Intronic
954716840 3:52531178-52531200 CAGGGTGTGGGTGGGGGATCAGG + Intronic
954939460 3:54358127-54358149 TTGTGTGTGTGAGGTGGAGGTGG + Intronic
954993765 3:54863609-54863631 CACTGTGTGTGGGGAGGAGGCGG - Intronic
955102701 3:55867297-55867319 CTGTGTGTGGGAGGTGGGTGTGG - Intronic
955731834 3:61995569-61995591 GTGTGTGTGTGAGGGGGGTGTGG + Intronic
955737824 3:62058515-62058537 AGGTGTGTATGAGGGGGAGGGGG - Intronic
956097571 3:65733565-65733587 CATTGTGTGAGAGATGGATGAGG - Intronic
956125333 3:66005638-66005660 CAGTGTGTGTGAGTGGAAGGGGG + Intronic
956330011 3:68096063-68096085 AAGTGTGTGTGAGTGGGAGGGGG - Intronic
956681849 3:71788346-71788368 CCGTGTGTGTGGGGGGGGTGGGG - Intergenic
956763409 3:72463416-72463438 CAGTGTGTGTGTGATGGGTGTGG + Intergenic
956787479 3:72654536-72654558 GAGTGTGTGTGTCGGGGGTGGGG - Intergenic
957525156 3:81371075-81371097 AGGTGTTTGTGAGGGGGATTTGG + Intergenic
957582507 3:82092612-82092634 CAGTGTGTATGTAGGGGGTGAGG + Intergenic
958074400 3:88657583-88657605 CAGGGTGGGTGATGGGGGTGTGG + Intergenic
958879750 3:99656313-99656335 TACTGTGTGTTAGGGAGATGAGG - Intronic
960062765 3:113340554-113340576 CAGGGTGTGCGATGGGGGTGTGG + Intronic
960473468 3:118095461-118095483 CAGGGTCTGTCAGGGGGAGGGGG - Intergenic
960515172 3:118595419-118595441 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
960745154 3:120879567-120879589 CAGTGTGTGTGGGGGCGGGGTGG + Intergenic
961091609 3:124117623-124117645 CAGTGTGTGTGTCGGGGGAGTGG + Intronic
961388762 3:126539537-126539559 CAGTGTGTGTGCGGTGTGTGTGG - Intronic
961450665 3:127000955-127000977 CTGTGTGTGTGAAGGGGTGGAGG + Intronic
961787685 3:129357466-129357488 CAATGTGTGTTGGGGGGATCCGG + Intergenic
962029700 3:131586844-131586866 CAGTGTGTCTTAGTGGTATGTGG + Intronic
962095042 3:132284813-132284835 CAGGGCGTGTGACGGGGGTGTGG + Intronic
962170244 3:133094229-133094251 TCGTGTGTGTGGGGGGGGTGGGG - Intronic
962413398 3:135161301-135161323 CAGAGTAGGTGGGGGGGATGAGG + Intronic
962463557 3:135636529-135636551 GTGTGTGTGTGATGGGAATGGGG - Intergenic
963661055 3:148129593-148129615 CAGTGTGGGTGAGGGAGGGGAGG - Intergenic
963792129 3:149594297-149594319 CAGTCTTTTTGAGGGGGAGGGGG - Intronic
963840191 3:150096878-150096900 CAGTCTGTGTGTGGGTGTTGGGG + Intergenic
963858700 3:150283899-150283921 CAGTGGGGGTGAGGGGTAAGTGG + Intergenic
963996957 3:151721048-151721070 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
964042106 3:152273098-152273120 CAGTGCGTGTGTGGAGGGTGAGG + Intronic
964909707 3:161765159-161765181 GCATGTGTGTGAGGGGGCTGGGG - Intergenic
964944059 3:162196854-162196876 GAGTTTGTGTGAGGTGAATGGGG + Intergenic
965450950 3:168837043-168837065 GAGTGTGTGTGAGGGAGAGGTGG - Intergenic
965534718 3:169812504-169812526 CAGTGGGTGAGAGGAGCATGGGG - Exonic
965618131 3:170615465-170615487 CAGGGTCTGTCAGGGGGTTGGGG - Intronic
965963118 3:174452553-174452575 CACTGTGTGGGCGGGGGTTGGGG - Intronic
966183483 3:177207597-177207619 CTGTGTGTGTGGGCGGGTTGGGG + Intergenic
966591109 3:181683809-181683831 GAGTGTGTGTGGTGGGGAAGTGG - Intergenic
966923124 3:184627361-184627383 CAGTGTGGGGGTGGGGGGTGGGG + Intronic
966983955 3:185162970-185162992 CAGTGTGCTTGAGGGGTATGTGG + Intergenic
967117196 3:186352667-186352689 GAGTGTATGTGAGGGGGCTGAGG - Intronic
967177088 3:186870925-186870947 GAGTGTGTGTCAGGTGGAGGTGG + Intergenic
967272044 3:187740219-187740241 GTGTGTGTGTGAGGGGGTGGGGG - Intronic
967598042 3:191350986-191351008 ATGTGTGTATGTGGGGGATGTGG + Intronic
967693155 3:192500440-192500462 CTGTGTGTGTGTGGCGGGTGGGG - Intronic
967996240 3:195168867-195168889 CAGACTTTGTGATGGGGATGGGG - Intronic
968609628 4:1551133-1551155 CAGTGTGTCTAAGGGCCATGGGG + Intergenic
969061037 4:4435069-4435091 GTGTGTGTGTGATGGGGAGGGGG + Intronic
969294831 4:6263721-6263743 CAGTGTGTGTGTGTGGCAGGTGG + Intergenic
969317808 4:6392617-6392639 GTGTGCGTGTGAGAGGGATGGGG + Intronic
969548157 4:7845690-7845712 GGGTGTGTTGGAGGGGGATGTGG - Intronic
969762496 4:9199197-9199219 AAGTGTGTGGGAGCTGGATGGGG + Intergenic
969884227 4:10200969-10200991 CAGTGGCTGTGAGGTGGGTGTGG + Intergenic
969894495 4:10290825-10290847 GTGTGTGTGTGGGGGGGGTGGGG + Intergenic
969921085 4:10540434-10540456 GAGTGTGGGTGTGGGGGAGGGGG - Intronic
970273106 4:14368138-14368160 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
970609206 4:17709667-17709689 CAGTTAGGGTGAGGGGGCTGGGG + Intronic
971938084 4:33179454-33179476 GAAAGTGTGGGAGGGGGATGAGG - Intergenic
972311962 4:37890744-37890766 CAGTGTCTGTGGGGGGAATAGGG - Intergenic
972675148 4:41253036-41253058 GTGTGTGTGTTTGGGGGATGGGG - Intergenic
973567093 4:52199494-52199516 GTGTGTGTGTGGGGGGCATGTGG + Intergenic
973739164 4:53902362-53902384 CAGTGTGTGTGTGTGGCATGCGG + Intronic
973797241 4:54440070-54440092 CAATGTGTGTGGGGGGGGGGGGG + Intergenic
973846228 4:54915897-54915919 AAATGTGTGTGTTGGGGATGTGG - Intergenic
974069951 4:57114279-57114301 CTGTGTGTGTGGGGGGGTGGGGG + Intergenic
974200485 4:58632290-58632312 AGGTGTGTGTGAGGGGGTGGGGG + Intergenic
974453654 4:62098039-62098061 CAGTGTGGCTGAGAGGAATGTGG - Intergenic
974712169 4:65612312-65612334 GAGAGGGTGGGAGGGGGATGAGG - Intronic
975355203 4:73394343-73394365 CTGAGTGTGTGAGGGGAAAGAGG - Intergenic
975435017 4:74342125-74342147 CAGGGCGTGTCAGGGGGTTGGGG + Intergenic
975799503 4:78045121-78045143 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
976076583 4:81305916-81305938 CAGTGTGTGTGTGTAGGACGGGG - Intergenic
977766552 4:100805678-100805700 CAGGGTGTGCGATGGGGGTGTGG + Intronic
978560741 4:110031037-110031059 GTGTGTGTGGGAGGGGGCTGGGG + Intergenic
978562087 4:110044055-110044077 CAGCGTGTGTGTGGAGGAGGAGG - Intergenic
979100907 4:116613004-116613026 AAGTGTGTGTGGGGGGGAGGGGG - Intergenic
979549722 4:121977297-121977319 CATTGTGAGTGGTGGGGATGAGG + Intergenic
980480463 4:133380344-133380366 CAGGGTGTGTGACAGGGGTGTGG - Intergenic
981906122 4:149923754-149923776 CAGGGTGTGTAATGGGGAAGTGG + Intergenic
982206992 4:153004291-153004313 CAGAGTGTGTGGGGAGGAGGAGG + Intergenic
982378075 4:154716590-154716612 CAGTGTATGGGAAGAGGATGAGG - Intronic
982378294 4:154719195-154719217 CAATGTGTGTGTGAGGGTTGAGG - Intronic
982406620 4:155027493-155027515 TGGTATGTGTGAGTGGGATGGGG - Intergenic
982495896 4:156091828-156091850 CTGTGTGGGTGTGGAGGATGAGG + Intergenic
982806270 4:159768263-159768285 CAGTGTGTGTGTGAGTGGTGTGG + Intergenic
982947831 4:161648401-161648423 CAGGGTGTGCGATGGGGCTGTGG - Intronic
982948222 4:161654298-161654320 CAGTGTATTTGAGGGTGCTGTGG - Intronic
983230969 4:165128461-165128483 CAGTTTGGTTGAGGGGGATGAGG - Intronic
984117830 4:175704357-175704379 CATTGTGTGTGTGTGGGGTGGGG - Intronic
984136645 4:175948985-175949007 GTGTGTGTGTTGGGGGGATGTGG + Intronic
984199381 4:176698582-176698604 CTGTGTGTGTGGGGGAGTTGGGG + Intronic
984261298 4:177445679-177445701 CAGGGCGTGTGATGGGGGTGTGG - Intergenic
984468833 4:180138760-180138782 CTGTGTGTGTGTGTGGGGTGGGG + Intergenic
985340777 4:188950952-188950974 TTATGTGTGTGAGGTGGATGAGG - Intergenic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985519427 5:366068-366090 CAGTGTGTGTGTGGGGCAGGGGG - Intronic
985547205 5:515744-515766 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547212 5:515772-515794 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547219 5:515798-515820 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547226 5:515826-515848 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547233 5:515852-515874 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547240 5:515880-515902 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547247 5:515908-515930 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547254 5:515934-515956 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547261 5:515964-515986 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547268 5:515990-516012 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985547276 5:516017-516039 GTGTGTGTGTGAGGGGGCAGGGG - Intronic
985547283 5:516043-516065 GTGTGTGTGTGAGGGGCAGGGGG - Intronic
985780271 5:1867259-1867281 CAGTGTGTGTGTGTGGGGAGAGG + Intergenic
986230898 5:5864191-5864213 CAGGATGTGTGACAGGGATGTGG + Intergenic
986365272 5:7022694-7022716 CAGCGTGTGTGATGGGGGTGTGG + Intergenic
986484070 5:8217637-8217659 CAGGGTGTGTGATGGGGGTGTGG - Intergenic
986571276 5:9168519-9168541 CCATGTGGGTGAGGGGGAGGAGG + Intronic
986795025 5:11201705-11201727 CAGTGTGGTTGAGGGGGTTATGG + Intronic
987195876 5:15525598-15525620 CTGTGTGTGTGTGGGGGGTGGGG + Intronic
987311528 5:16685706-16685728 CACTGTGTGGGATGGGGGTGGGG - Intronic
987439464 5:17938742-17938764 AAGGGTGTGTGAGTGGGGTGGGG + Intergenic
988091457 5:26545530-26545552 CAGTGTGAGAGAAGGAGATGTGG - Intergenic
988435369 5:31168144-31168166 CTGTGTGTGTGAAGGGGTGGGGG - Intergenic
988810257 5:34777862-34777884 TGGTGTGTGTGGGGGGGGTGTGG + Intronic
989204443 5:38797383-38797405 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
989739142 5:44748847-44748869 AAGTGTGTGTGTGGGGGGGGGGG + Intergenic
989833339 5:45949470-45949492 CAGTATGTGTGAGGGAAATTTGG + Intergenic
990320473 5:54625145-54625167 TAGTGTGTATGAGGGGAAGGGGG + Intergenic
991946541 5:71903165-71903187 TATTGTGTGTGAAGGGGATGTGG + Intergenic
991952793 5:71963019-71963041 CAGTGGTGGTGAGGGGGAGGAGG - Intergenic
992197252 5:74352097-74352119 CAGTGGGGATGAGGAGGATGGGG + Intergenic
992210523 5:74475132-74475154 GGGTGTGTGGGTGGGGGATGGGG + Intergenic
992536898 5:77715548-77715570 GTGTGTGTGTCAGGGGGATGAGG - Intronic
993339004 5:86698878-86698900 CAGTGTGATTGTGGGGGGTGAGG - Intergenic
993434177 5:87871160-87871182 TAGTGTGTGTGTGGGGGTGGGGG - Intergenic
993566311 5:89480153-89480175 GTGTGTGTGTGAAGGGGAAGAGG - Intergenic
993631228 5:90288035-90288057 GAGAGTGTGTGAAGGGTATGGGG - Intergenic
993777015 5:92012348-92012370 CTGTGTGTGGGGGGGGGAGGCGG - Intergenic
993828353 5:92721963-92721985 CCGTGTGTGTGTGGGGGGTGGGG - Intergenic
993906809 5:93632433-93632455 CATGGTGTGTGAGGGGAAAGTGG + Intronic
993971087 5:94420947-94420969 CAGTGGATGTGAGGAGGATGAGG - Intronic
993982914 5:94564396-94564418 GTGTGTGTGTGATGGAGATGAGG + Intronic
993982921 5:94564476-94564498 GTGTGTGTGTGATGGAGATGAGG + Intronic
993982928 5:94564574-94564596 GTGTGTGTGTGATGGAGATGAGG + Intronic
994127906 5:96190322-96190344 CAGTGTGTGTGAGTGGGGAAGGG + Intergenic
994135352 5:96280278-96280300 GAGTGTGTGTGTGGGGACTGGGG - Intergenic
994213976 5:97116400-97116422 CTCTGTGTGTGCTGGGGATGGGG + Intronic
994661702 5:102661595-102661617 CAGAGTGTGCGATGGGGCTGTGG - Intergenic
994886182 5:105564454-105564476 CAGGGCGTGCGATGGGGATGTGG - Intergenic
994929567 5:106163856-106163878 CAGGGCGTGCGATGGGGATGTGG - Intergenic
995039359 5:107570639-107570661 AAGTGTGTGTGTGGGGGTGGGGG + Intronic
995130773 5:108628092-108628114 CAGTGTGTGTGTGTGTGTTGGGG + Intergenic
995179544 5:109218189-109218211 CAGTGTGTGTGAGTGTGGAGTGG - Intergenic
995716759 5:115088110-115088132 CAGGGTGTGTCAAGGGGATATGG - Intergenic
995829102 5:116334218-116334240 CAGTGTTTGTGGTGGTGATGGGG - Intronic
996210070 5:120798068-120798090 CAGTGTGTGTGTGTGTGGTGGGG + Intergenic
997424053 5:133791040-133791062 CAGAGTGAGTGAGGGGACTGTGG - Intergenic
997509705 5:134445651-134445673 GTGTGTGTGTGATGGGGATGGGG + Intergenic
997652592 5:135533620-135533642 GTGTGTGTGTTGGGGGGATGGGG + Intergenic
997741199 5:136256505-136256527 CAGTGAGGGTGGGAGGGATGGGG - Intronic
997803386 5:136889215-136889237 TAGTGGGGGTGGGGGGGATGGGG - Intergenic
997884726 5:137619984-137620006 GTGTCTGTGTGATGGGGATGAGG - Exonic
997886765 5:137637297-137637319 CAGTGTGGGTGTGGGCGTTGTGG - Exonic
997991518 5:138548109-138548131 CAGTGTGTGTGAAAGGGACTTGG + Intergenic
998193696 5:140047686-140047708 CAGTGTGTGAATGAGGGATGGGG + Intergenic
998397943 5:141831528-141831550 CAGTGGGTGGGATGGAGATGGGG - Intergenic
998488290 5:142523128-142523150 CAGTGTGTGAGGGGTGAATGAGG - Intergenic
998598492 5:143559754-143559776 GAATGTGTGTGTGTGGGATGGGG + Intergenic
998612390 5:143703416-143703438 CAGGATGTGTGACAGGGATGTGG + Intergenic
998779282 5:145638386-145638408 GACTGTGTGTGTGGGGGAAGGGG - Intronic
998874966 5:146590082-146590104 AAGTGTGTGTGGGGGGCAAGCGG - Exonic
999007236 5:147996462-147996484 CAGGGTGTGTGATGGGGGTGTGG + Intergenic
999178935 5:149655011-149655033 CAGTGTGTGTGTGCGGTGTGTGG - Intergenic
999178954 5:149655220-149655242 CGGTGTGTGTGAGGTGTGTGTGG - Intergenic
999295611 5:150457944-150457966 CGGTGTGTGTGTTGGGGATTAGG + Intergenic
999385405 5:151150719-151150741 CAGTGTGTGGTGGGGGGAGGAGG + Intronic
999652093 5:153777681-153777703 CAGTGTGTGTGAGGGGGATGAGG - Intronic
999977417 5:156925474-156925496 CAGTGTCTGAGAGAGAGATGGGG + Intronic
999989236 5:157034196-157034218 CTGTCTCAGTGAGGGGGATGTGG + Intronic
1000796368 5:165670008-165670030 CTGTGTGTGTGTCGGGGGTGGGG - Intergenic
1001320604 5:170677736-170677758 TGATGTGTGTCAGGGGGATGTGG - Intronic
1001322374 5:170693246-170693268 GTGTGTGTGTCGGGGGGATGGGG - Intronic
1001961834 5:175884292-175884314 GTGTGTGTGTGCGGGGGGTGGGG - Intergenic
1002058879 5:176614461-176614483 CTGTGTGTGGGGGGGGGAGGGGG + Intergenic
1002136603 5:177111732-177111754 CAGTGTGTTTCAGGGGCCTGAGG + Intergenic
1002183364 5:177442676-177442698 CTGTGTGGGTGAAGGGGATAGGG + Intronic
1002346004 5:178547778-178547800 CAGTGTGTGTGGGGGGTGTGTGG - Intronic
1002480093 5:179495161-179495183 CTGTTTGTGTGTGGGGGAGGTGG + Intergenic
1002591976 5:180296823-180296845 CCGTGTGTGTGTGGGGGGGGGGG - Intergenic
1002624798 5:180518495-180518517 TTGTGTGTGTGGGGGGGAGGAGG + Intronic
1002810685 6:625284-625306 CACTGTGTGTGGGGTGGCTGGGG - Intronic
1003122441 6:3329166-3329188 GTGTGTGTTTGTGGGGGATGAGG - Intronic
1003565960 6:7222457-7222479 CAGTGGGTGGTAGGGGGATGTGG - Intronic
1004340342 6:14802936-14802958 CAGTTTTGGTGAGGGGGTTGGGG + Intergenic
1005227130 6:23655975-23655997 CAATGTGTGTGTGGGGGGGGGGG + Intergenic
1005374598 6:25169606-25169628 AAGTGAGTGTGAGGAGGGTGGGG - Intergenic
1005735867 6:28745388-28745410 GTGTGTGTGTGTTGGGGATGGGG + Intergenic
1005986241 6:30877419-30877441 CTGTGTGTGTATGGGGGATGGGG + Intronic
1005999665 6:30955401-30955423 AAGGGTGTATAAGGGGGATGGGG + Intergenic
1006015761 6:31079372-31079394 AGGTGTGTGTGTTGGGGATGGGG - Intergenic
1006456994 6:34137467-34137489 CAGTCAGGGTAAGGGGGATGGGG + Intronic
1006582184 6:35083541-35083563 CTGTGGGTCTGACGGGGATGTGG - Intronic
1006646715 6:35520005-35520027 CAGTGTGAGTGAGTGGGATTCGG + Intergenic
1006784692 6:36658212-36658234 CAGTGTCTGGGAGGAGGAGGAGG + Intergenic
1006971450 6:38049889-38049911 GGGTGGGTGTGAGGGGGAGGGGG - Intronic
1007266448 6:40599864-40599886 CAGAGGTTGTGAGGGGAATGGGG + Intergenic
1007285780 6:40746547-40746569 CAATGTGTGGGTGGGGGAGGAGG - Intergenic
1007816665 6:44529767-44529789 CAGGGTGTGAGAGTGGGCTGGGG + Intergenic
1007830559 6:44635157-44635179 CTGTGTGTGTGAGGGGCTAGGGG - Intergenic
1007927123 6:45659023-45659045 CCATATGTATGAGGGGGATGGGG + Intronic
1007958460 6:45937980-45938002 CAGTGTGTGTATGGGGGCTGGGG + Intronic
1007976006 6:46101972-46101994 AAGTGTGTGTGTTGGGGGTGGGG + Intergenic
1008224233 6:48892896-48892918 AAGTGTGTGTGTGGGGGGGGGGG + Intergenic
1008284744 6:49634990-49635012 CTGTGTGTGTCGGGGGGGTGGGG + Intronic
1008653264 6:53585369-53585391 CAGTGTGCGGGTGGGGGAAGCGG - Intronic
1008678290 6:53844830-53844852 CATTATGTGTGTGGTGGATGTGG + Intronic
1008727611 6:54441360-54441382 CAGGGTGTGTGATGAGGGTGTGG + Intergenic
1009760664 6:68001332-68001354 CAGTGGGAGTGAGGAGGAGGTGG - Intergenic
1009923005 6:70086269-70086291 GTGTGTGTGTCAGGGGGGTGGGG - Intronic
1011016934 6:82767303-82767325 CTGTGTGTCTGGGAGGGATGTGG - Intergenic
1011639643 6:89406934-89406956 CAGGGTGTGTGATGGGGGTTTGG - Intronic
1012532690 6:100257231-100257253 CTGTGTGTGTGTGTGGGTTGAGG - Intergenic
1012801552 6:103835645-103835667 CAGTCTGTGTTGGGGGGAAGTGG - Intergenic
1013050852 6:106533651-106533673 CAGATTGTGTGTGGGGTATGAGG + Intronic
1013608739 6:111774564-111774586 GGGAGTGTGTGGGGGGGATGGGG - Intronic
1013929117 6:115508979-115509001 CTGTGTGTGTGTGTGGGGTGGGG - Intergenic
1014210701 6:118705124-118705146 AAGGGTGTGTGTGGGTGATGTGG - Intronic
1014718033 6:124888143-124888165 CAGGGTATGTGATGGGGATGTGG - Intergenic
1015551376 6:134415661-134415683 AACTGTGTGTGAGGGGAGTGGGG + Intergenic
1015729674 6:136335080-136335102 CAGGGTGTGTGATGGGAGTGTGG - Intergenic
1016449794 6:144170344-144170366 CTGTGTGTGTGCGTGGGAAGGGG + Intronic
1016612025 6:146000474-146000496 GAGTGTGTGTGGAGGGGATGGGG + Intergenic
1017292100 6:152749968-152749990 ATGTGTGTGTGTTGGGGATGAGG + Intergenic
1017344255 6:153361616-153361638 CAGTGTGAGTGAGAGTGGTGTGG + Intergenic
1017539698 6:155387947-155387969 GAGAGTGTGTGTTGGGGATGGGG - Intergenic
1017815695 6:158014951-158014973 AAGTGCCTTTGAGGGGGATGGGG + Intronic
1018378888 6:163240069-163240091 GAGTGTGTGTGGGGGGGTGGAGG - Intronic
1018618260 6:165708314-165708336 CAGTGAGGCTGAGAGGGATGGGG - Intronic
1018620468 6:165725484-165725506 CAGGGTGTATGATGGGGTTGTGG - Intronic
1018779907 6:167053770-167053792 CAGGGTGTTTCAGGGGGCTGTGG + Intergenic
1018794367 6:167174513-167174535 CAGGGTGTGCGAAGGGGATGTGG + Intronic
1018821952 6:167380554-167380576 CAGGGTGTGCGAAGGGGATGTGG - Intronic
1018960377 6:168443197-168443219 CCCTGTGTGTGTGGGGGGTGGGG + Intronic
1019171214 6:170134284-170134306 CAGTGTGTGTCTGCGGGCTGCGG + Intergenic
1019352984 7:563839-563861 CAGTGTGTGTGCATGGGTTGTGG + Intronic
1019388257 7:770751-770773 CAGTGTGGGGGAGGGAGATGGGG - Intronic
1019543194 7:1560612-1560634 GAGTGTGTGTGTGGGGGAAGGGG - Intronic
1020632553 7:10656972-10656994 TGTTGTGTGTGAGGGGGCTGAGG + Intergenic
1021389589 7:20075155-20075177 CAGTGTGGGTGGTGGGGAGGGGG + Intergenic
1022877099 7:34545200-34545222 CAGGGTGTGAGATGGGGGTGTGG - Intergenic
1023085800 7:36568911-36568933 CAGAGTGTGGGTTGGGGATGGGG + Intronic
1023217178 7:37875430-37875452 CAATGTGTGTGGGGGCTATGGGG - Intronic
1023344780 7:39260240-39260262 GAGTGTGTGTGTCGGGGGTGTGG - Intronic
1023487345 7:40701187-40701209 GAGTGTGTGGGAGGGGGAGTGGG - Intronic
1023731601 7:43197308-43197330 GAGTGTGTGGGGGTGGGATGGGG - Intronic
1023893843 7:44415733-44415755 CAGTGTTTGTGTTGGGGCTGTGG - Intronic
1023896006 7:44433485-44433507 CAATGTGTGTGTGGTGCATGTGG + Intronic
1024231795 7:47368673-47368695 TGCTGTGTGTCAGGGGGATGTGG + Exonic
1024265173 7:47600829-47600851 CAGGGCATGTGATGGGGATGTGG - Intergenic
1024268072 7:47621745-47621767 CAGGGTGTGTGATGGGGTTGTGG + Intergenic
1024563663 7:50664462-50664484 CAGTGTGTCTGTGGGGGCAGGGG + Intronic
1024841306 7:53590726-53590748 CAGGGCGTGTGATGGGGTTGTGG + Intergenic
1024872778 7:53984937-53984959 AAGTGCGTGTGAGGGGGAGGAGG + Intergenic
1025003803 7:55340038-55340060 CAGTGACTGGGAGGGGCATGAGG - Intergenic
1025138694 7:56443816-56443838 GAGTGTGTGTCAGGGGAGTGAGG + Intergenic
1025333612 7:58355991-58356013 CAGGGTGGGGGTGGGGGATGGGG + Intergenic
1025565737 7:62432146-62432168 CAGTATGTCTGAGGGCTATGTGG + Intergenic
1025639309 7:63352585-63352607 CAGAGAGTGGGAGGTGGATGAGG - Intergenic
1025643390 7:63395507-63395529 CAGAGAGTGGGAGGTGGATGAGG + Intergenic
1025776873 7:64568392-64568414 GAGTGTGTGTGAGGGCGGTCAGG + Intergenic
1026167675 7:67924610-67924632 CTGTGTATGTGTGGGGGCTGGGG + Intergenic
1026374247 7:69734477-69734499 CACTGGGATTGAGGGGGATGAGG + Intronic
1026784489 7:73293543-73293565 CGGTGTCTGGGAGCGGGATGAGG - Intergenic
1027109582 7:75426385-75426407 CGGTGTCTGGGAGCGGGATGAGG + Exonic
1027521954 7:79220486-79220508 CTGTGTGTGTGAGAGTGAGGAGG - Intronic
1027699808 7:81455987-81456009 TGGTGTGTGTGTGGGGGAGGGGG + Intergenic
1027943481 7:84715516-84715538 GAGTGTGTGTGTGGCGGGTGGGG + Intergenic
1028796573 7:94908914-94908936 GATTGTGCGTGAGGGTGATGTGG + Intronic
1028897716 7:96060994-96061016 CAGTGTTTGAGAGGGGATTGTGG + Intronic
1028971719 7:96866718-96866740 CAGTGTGTGTTATGGTGATGTGG + Intergenic
1029562072 7:101309160-101309182 CAGTGAGTGTGATGTGGATGAGG - Intergenic
1029707378 7:102282968-102282990 GAGTGTGTGTGTTGGGGAAGGGG - Intronic
1030414271 7:109221012-109221034 ATGTGTGTGTGTTGGGGATGGGG + Intergenic
1030769569 7:113457221-113457243 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1031189954 7:118536121-118536143 TTGTGTGTGTGAGAGGGAGGGGG - Intergenic
1031232361 7:119124012-119124034 CAGGGTGTGAGATGGGGGTGTGG - Intergenic
1031623660 7:123967626-123967648 ATGTGTGTGTGAGAGAGATGGGG + Intronic
1031898276 7:127379848-127379870 GTGTGTGTGTGGGGGGGGTGGGG - Intronic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1031968324 7:128044629-128044651 CTGTGTGTGTGGCGGGGGTGGGG - Intronic
1032190285 7:129761391-129761413 GCGTGTGTGTGGGGGGGGTGGGG - Intergenic
1032316236 7:130841623-130841645 CAGGGTGTGTGATGGGGGCGTGG + Intergenic
1032356490 7:131215884-131215906 CAGTTTGTTTGGGGGGGATAGGG + Intronic
1032688017 7:134255807-134255829 CCGTGTGTGCATGGGGGATGAGG + Intronic
1032833656 7:135653421-135653443 AAGTGTGTGGGAGGGAGAGGCGG + Intergenic
1033570940 7:142627534-142627556 GAGTGTGTGTGCAGGGGGTGGGG + Intergenic
1033732244 7:144191339-144191361 CAGTGGGGGGGGGGGGGATGGGG - Intronic
1034096554 7:148414103-148414125 CAGCTTGTGTGAGGGGGGGGGGG - Intronic
1034617554 7:152432210-152432232 GGGTGTGGGTGTGGGGGATGGGG - Intronic
1035168107 7:157003422-157003444 CAGTGTTGGTGAGGGCGCTGAGG + Intronic
1035254750 7:157619121-157619143 CAGTGTGGATGGGGGGGTTGGGG - Intronic
1035288247 7:157819741-157819763 CAGTGGGTGGGCGGGTGATGGGG - Intronic
1035370507 7:158376543-158376565 CAGGATGTGTGACAGGGATGTGG - Intronic
1035370584 7:158376813-158376835 CAGGATGTGTGACAGGGATGTGG - Intronic
1035543435 8:459695-459717 GAGTGTGTCTGAGAGGTATGTGG + Intronic
1035739389 8:1914730-1914752 GTGTGTGTGTGTGGGAGATGAGG + Intronic
1035742587 8:1939428-1939450 CAGCGTGAGTGAGGGTGCTGTGG + Intronic
1035957175 8:4094124-4094146 CTCCGTGTGTGGGGGGGATGAGG + Intronic
1036040697 8:5077092-5077114 AACTGTGTGTGGGGGGGGTGGGG - Intergenic
1036078834 8:5530194-5530216 CAGTGAGAGTGAGGGGTACGAGG - Intergenic
1036272581 8:7320932-7320954 AAGTGTGTGGGAGCTGGATGGGG + Intergenic
1036348767 8:7989412-7989434 AAGTGTGTGGGAGCTGGATGGGG - Intergenic
1036417589 8:8564842-8564864 GAGTGTGTGAGATGGGGCTGAGG - Intergenic
1036844037 8:12149884-12149906 AAGTGTGTGGGAGCTGGATGGGG - Intergenic
1036865407 8:12392205-12392227 AAGTGTGTGGGAGCTGGATGGGG - Intergenic
1036963745 8:13273720-13273742 GTGTGTGTGTAAGGGGGAAGGGG + Intronic
1037018892 8:13943451-13943473 CAGACAGTGTGAGGAGGATGTGG - Intergenic
1037324854 8:17678617-17678639 CTGTGTGGGTGATGGGGAGGAGG - Intronic
1037561207 8:20076117-20076139 CAGTGTGAGTGGAGTGGATGAGG - Intergenic
1037899393 8:22678610-22678632 CAGAGTTTGGGAGGAGGATGGGG + Intergenic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038370985 8:26990035-26990057 GAGTGTGTGATAGGGGAATGAGG - Intergenic
1038406269 8:27325219-27325241 AGGTGTGTGTGAGGTGGGTGGGG - Intronic
1038535739 8:28351806-28351828 CCCTGTGTGGGAGGGAGATGCGG + Exonic
1038590268 8:28831303-28831325 CAGGGAGTGTGCGGGGGAAGGGG + Intronic
1038691192 8:29765035-29765057 CAGTGGGTGTGAAGGGGAAAGGG - Intergenic
1038864123 8:31420804-31420826 CAGTGTGTGTTTTGGGGGTGTGG - Intergenic
1038891951 8:31735193-31735215 TAGTGGGTGTGTGGAGGATGGGG - Intronic
1039389948 8:37171518-37171540 CAGGGCGTGTGATGGGGATGTGG + Intergenic
1040465406 8:47690263-47690285 GAGAGTGTGTGGGGGGGGTGAGG + Intronic
1040887027 8:52276012-52276034 GTGTGTGTGTGGGGGGTATGTGG - Intronic
1041123378 8:54609661-54609683 GGGTGTGAGTGAGGGGGAGGAGG - Intergenic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041809838 8:61895755-61895777 CAGTGTGTGTGGGGTGGCTGGGG + Intergenic
1041821095 8:62033634-62033656 CAGTGTGAGTGAGTGGGATGTGG + Intergenic
1041896213 8:62927175-62927197 GAGTGAGTGGGAGGGGGGTGAGG - Intronic
1042359832 8:67869931-67869953 CAGTGAATGGGAGGGGGACGGGG + Intergenic
1042418196 8:68551665-68551687 CAATGTGTAAGATGGGGATGGGG + Intronic
1042910547 8:73821545-73821567 GAGTGTGTGTGTGGGGGGGGGGG + Intronic
1043605227 8:81991371-81991393 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1044320509 8:90795697-90795719 GTGTGTGTGTGAGAGAGATGAGG - Intronic
1044345922 8:91104280-91104302 CAGAGTTTGTGAGGGGGGAGAGG - Intronic
1044425725 8:92047501-92047523 TAGTGTATGTGAGGTGGGTGGGG - Intronic
1044727928 8:95208172-95208194 GTGTGTGTGTGTGGGGGAGGGGG + Intergenic
1044757073 8:95474754-95474776 TAGTGTGTGTGTGGGAGATGAGG + Intergenic
1044914449 8:97097657-97097679 CAGTTTGTGGGAGGGGTTTGGGG + Intronic
1045368360 8:101496560-101496582 CTGTGTGTGTGTTGGGGGTGGGG + Intronic
1045938447 8:107710631-107710653 CAGTGTGTGTGATGAGGGTGTGG + Intergenic
1046138385 8:110060581-110060603 CAGGGTGAGTGAGGGCGGTGTGG - Intergenic
1046260935 8:111766375-111766397 CAGTGTGTGCAATGGGGGTGTGG - Intergenic
1046310211 8:112426228-112426250 GAGTGTGTGTGCAGGGGGTGGGG + Intronic
1046590277 8:116198142-116198164 CAGGGTGTGCGATGGGGGTGTGG + Intergenic
1046739819 8:117816002-117816024 TAGTGTGTGTGTGTGGGGTGGGG + Intronic
1046915160 8:119671991-119672013 CTGTGTGTGTGCGTGGGAGGGGG + Intronic
1047010074 8:120662995-120663017 AAGTGTGTGTGTGGGGGTGGGGG + Intronic
1047141668 8:122147795-122147817 GTGTGTGTGTGTGGAGGATGGGG - Intergenic
1047460386 8:125058373-125058395 ACGTGGGAGTGAGGGGGATGGGG - Intronic
1047885296 8:129243674-129243696 CAATGTGTGTGTGGGGGCGGGGG + Intergenic
1048292927 8:133194213-133194235 CACTGTGTGTGTGTGGGGTGGGG + Intronic
1048623326 8:136158790-136158812 CAGGATGTGTGATAGGGATGTGG + Intergenic
1048648634 8:136450567-136450589 CTGTGCCTGTGAGGGGGATAAGG - Intergenic
1049361786 8:142215520-142215542 GAGTGTGTGTGGGGAGGCTGAGG - Intronic
1049410046 8:142469793-142469815 GCGTGTGCGTGGGGGGGATGGGG + Intronic
1049645621 8:143734371-143734393 CAGTGTGTGTGGTGGGGGTTGGG - Intergenic
1050088485 9:1991660-1991682 CAGGGTGTTTGTGGGAGATGAGG + Intergenic
1050181617 9:2928813-2928835 TTGTGTGTGTCAGGGGGTTGGGG + Intergenic
1050281253 9:4052483-4052505 CAGGGTGTGAGTGGGGAATGAGG - Intronic
1051075502 9:13229606-13229628 AATTGTGTGTGGGGTGGATGGGG - Intronic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051586618 9:18733624-18733646 GAGTGTGTGTGTGGGGGGAGTGG - Intronic
1052370187 9:27655488-27655510 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1052431307 9:28370317-28370339 GAATGTGTGTGAGGAGGAGGTGG - Intronic
1052795221 9:32917503-32917525 CAGTGTGTGTGTGATGAATGTGG - Intergenic
1052821187 9:33138933-33138955 TAGTGTGTGTGTTGGGGTTGGGG - Intronic
1052883247 9:33618644-33618666 GAGTGTGTGTGCAGGGGGTGGGG + Intergenic
1053344780 9:37370357-37370379 GAGAGAGTGTGAGGGGGTTGAGG - Intergenic
1053525563 9:38826585-38826607 CAGGGCGTGTGATGGGGGTGTGG - Intergenic
1054197792 9:62051012-62051034 CAGGGCGTGTGATGGGGGTGTGG - Intergenic
1054640562 9:67537360-67537382 CAGGGCGTGTGATGGGGGTGTGG + Intergenic
1055008555 9:71537297-71537319 ATGTGTGTGTGTGGGGGTTGGGG - Intergenic
1055466719 9:76573936-76573958 GAGGGTGTGTGAGGGGTAAGGGG - Intergenic
1055617592 9:78089112-78089134 CAGTGGTGGTGAGCGGGATGGGG + Intergenic
1056404754 9:86262881-86262903 CAGTGTTTGTGAGTAGAATGTGG + Intergenic
1056558985 9:87713414-87713436 GTGTGTGTGTGGGGGGGGTGTGG + Intergenic
1056708847 9:88973659-88973681 TAGTCTGTGTGTGGGGGGTGTGG - Intergenic
1056730287 9:89160204-89160226 CAGTGTTTGCCAAGGGGATGGGG - Intronic
1056753987 9:89371169-89371191 AGGTGTGTGTGGGGGGGGTGTGG + Intronic
1056754118 9:89371752-89371774 TGGTGTGTGTGTGGGGGGTGTGG + Intronic
1056857561 9:90146867-90146889 CTGAGTGTGTGGGGGGGATTAGG - Intergenic
1056858409 9:90156362-90156384 CAGTGGGTATGATGGGGAGGAGG + Intergenic
1056901877 9:90607444-90607466 CAGTTTCTGTGAGGGGTAGGCGG + Intergenic
1057036081 9:91812559-91812581 ACGTGTGTGTGGGGGGGGTGGGG - Intronic
1057142226 9:92734588-92734610 CAGCCTGTGGGAGGGGGAGGAGG - Intronic
1057335450 9:94151530-94151552 GTGTGTGTGTGCGGGGGGTGAGG + Intergenic
1057393472 9:94658541-94658563 GAGTCTGTGTGAGAGGGAAGGGG - Intergenic
1057899893 9:98940461-98940483 CTGTGGGTGTGGGAGGGATGGGG - Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058151878 9:101472670-101472692 CAGTGTGTGTGTTGGGAGTGGGG + Intergenic
1059001101 9:110349667-110349689 GAGTGTGTGTGGGGAGGGTGTGG - Intergenic
1059408671 9:114118359-114118381 AAGTGTGTGTGCAGGGGAGGGGG - Intergenic
1059780218 9:117518288-117518310 CAGTGTGTGTGGGCGGGGTGGGG - Intergenic
1060010844 9:120041666-120041688 CAGAGTGTGGCAGGGGGAGGAGG - Intergenic
1060915418 9:127386523-127386545 CAGTGTCTGTGTGGGGCTTGGGG - Intronic
1061239039 9:129358610-129358632 CAGGGTGTGGGAGGGGAAAGAGG - Intergenic
1061520487 9:131114685-131114707 CTGTGCGGGTGAGGGGCATGGGG + Intronic
1061715723 9:132517752-132517774 CTTTGTGTGTGCGGGGGATGAGG - Intronic
1061989986 9:134153612-134153634 CAGTGTATGTGACCGGGCTGAGG + Intronic
1062251271 9:135596294-135596316 TAGTGTGTGTGCAGGGGGTGGGG - Intergenic
1062432364 9:136531863-136531885 CGGCGGGTGTGATGGGGATGAGG - Intronic
1062461177 9:136663157-136663179 CAGCGGGAGTGAGGGGAATGGGG - Intronic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1203362327 Un_KI270442v1:228163-228185 CAGTGTGTATGCGTGGGTTGCGG + Intergenic
1185650201 X:1642091-1642113 CTGTGTGTGTGTGTGTGATGGGG + Intronic
1186265924 X:7833777-7833799 CTGTGTGTGTGGGTGGGAGGAGG - Intergenic
1186376959 X:9014031-9014053 ATGTGTGTGTGGGGGGGAGGAGG - Intergenic
1186789075 X:12979402-12979424 GAGTGTGTATGGGGGGGAGGTGG + Intergenic
1187193396 X:17057994-17058016 CAGTGTGGGTATGGGAGATGAGG - Intronic
1187225037 X:17367581-17367603 TGGTGTGTGTGTGGGGGATGGGG + Intergenic
1187386884 X:18857220-18857242 CAGTGAGGGAGAAGGGGATGAGG - Intergenic
1187457757 X:19457881-19457903 AAGTGCGTGTGTGGGGCATGAGG - Intronic
1187528120 X:20072244-20072266 CTGTGTGTGTGTTGGGGGTGGGG - Intronic
1187960413 X:24562304-24562326 CAGCATGAGCGAGGGGGATGAGG - Exonic
1188350329 X:29122462-29122484 AAGTGTGTGTGGGTGGGGTGGGG - Intronic
1188435459 X:30153425-30153447 TAGTGTGTGGGAGTGTGATGGGG + Intergenic
1189161712 X:38815729-38815751 CAGTGGTTGTGTGGGAGATGGGG - Intergenic
1190070053 X:47272235-47272257 CAGTGTGTGTGTGAGTGAAGAGG - Intergenic
1190316681 X:49156292-49156314 GAGGGTGTGTGACGGGGGTGGGG - Intergenic
1190366070 X:49695850-49695872 AAGTGTGAGTGAGGGTGAGGAGG - Exonic
1190630428 X:52380745-52380767 CAGTGTGAGTGAGTGTGAGGAGG + Intergenic
1190681425 X:52830102-52830124 AAGTGTGAGTGAGGGTGAGGAGG - Intergenic
1190766725 X:53481314-53481336 CAGGGTGTGAGAGCGGGGTGTGG - Intergenic
1190998517 X:55636142-55636164 AAGTGTGAGTGAGGGTGAGGAGG - Intergenic
1191075134 X:56444915-56444937 CTGGGTGTGGGAGGGGCATGAGG + Intergenic
1191772582 X:64777358-64777380 AAGGGTGAGTGTGGGGGATGTGG - Intergenic
1191805149 X:65127822-65127844 AACTGTGTGGGAGGGGGGTGAGG - Intergenic
1191862656 X:65678470-65678492 CAGAGTGTGGGGGTGGGATGGGG + Intronic
1192141938 X:68653484-68653506 TGGTGTGTGTGAGGGGTGTGGGG - Intronic
1192436906 X:71148596-71148618 CACTGGGTGTGTGGGGGGTGGGG + Intronic
1192491442 X:71579616-71579638 GGGTGTGTGTGTGGGGGTTGAGG + Intronic
1192605772 X:72515578-72515600 CAGTGTGTGTGGGGGGGGGGTGG + Intronic
1192829406 X:74735573-74735595 CTGCGTGTGTGAGGGGGCTACGG - Exonic
1193158456 X:78200112-78200134 GAGTGTGTGTGTGGGGGGGGGGG - Intergenic
1193194244 X:78611160-78611182 CAGTGTTTGTCAGGGGGTGGGGG - Intergenic
1193442268 X:81557034-81557056 GTGTGTGTGGGAGGGGGAAGGGG - Intergenic
1193444732 X:81586618-81586640 CCGTGTGTGTGTGTGGGTTGGGG + Intergenic
1193898276 X:87141347-87141369 CAGGGTGTGCGATGGGGGTGTGG - Intergenic
1193932854 X:87578467-87578489 CAGTGTTTCTGTGGGGAATGAGG - Intronic
1194068216 X:89288051-89288073 CAGGGTGTGAAATGGGGATGTGG + Intergenic
1194193283 X:90862699-90862721 AAGTGTGTGCGTGTGGGATGAGG - Intergenic
1194814333 X:98424197-98424219 AAGTGTGTGTGTTGGGGAAGGGG + Intergenic
1194865937 X:99066945-99066967 GTGTGTGTGTGTGGGGGGTGGGG - Intergenic
1195405566 X:104509211-104509233 GTGTGTGTGGGAGGGGGTTGGGG + Intergenic
1195654204 X:107319650-107319672 TAGTGTGTGTGTGGGGGGGGGGG + Intergenic
1196123742 X:112078221-112078243 GTGTGTGTGTTAGGGGGAGGTGG + Intronic
1196523065 X:116696179-116696201 CAGAGTGTGTGATGGAGGTGTGG - Intergenic
1196575223 X:117309295-117309317 GTGTGTGTGTGAGGGGGTAGAGG + Intergenic
1196651941 X:118176999-118177021 CAGTCTGTGTGAGGAGGCTTTGG - Intergenic
1196892482 X:120304849-120304871 AAGTGTGTGTGTGGGGGAGGGGG + Intronic
1197274495 X:124462422-124462444 GTGTGTGTGTGGGGGGGGTGGGG + Intronic
1197401185 X:125992796-125992818 GAGTGTGTGTGAGTGGGAAGAGG - Intergenic
1197643721 X:128994374-128994396 AAGGGTGTGGAAGGGGGATGAGG + Intergenic
1197833900 X:130674145-130674167 AAGAGTGTGGGAGGGGAATGAGG + Intronic
1198155227 X:133953281-133953303 GAGTGTGTGTGTAGGGGGTGGGG - Intronic
1199128782 X:144159079-144159101 CAGTGTGTGTCAGGGGTGGGGGG + Intergenic
1199429842 X:147746332-147746354 CAGTGTGGCTGAAGGGGAGGAGG - Intergenic
1199608942 X:149597710-149597732 CAGTGGGTCTGACGGGGAAGAGG + Exonic
1199630177 X:149771647-149771669 CAGTGGGTCTGACGGGGAAGAGG - Intergenic
1199641940 X:149870837-149870859 CAGTGACTGGGAGGGGAATGAGG - Intergenic
1199680503 X:150221268-150221290 AGATGTGTGTGAGGAGGATGCGG - Intergenic
1200055055 X:153455940-153455962 GAGAGTGAGTGAGGGGGCTGAGG - Intronic
1200302129 X:154987005-154987027 CAGTCTTAATGAGGGGGATGAGG + Intronic
1200722358 Y:6622221-6622243 CAGGGTGTGAAATGGGGATGTGG + Intergenic
1201145021 Y:11059710-11059732 CAGTGTGTGTGAGGCAGCAGAGG - Intergenic
1201704581 Y:16922154-16922176 GCCTGTGTGTGAGGGAGATGGGG - Intergenic