ID: 999652413

View in Genome Browser
Species Human (GRCh38)
Location 5:153780348-153780370
Sequence GCTACTTTCTCAAGATCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 378}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999652413_999652414 9 Left 999652413 5:153780348-153780370 CCATGTGATCTTGAGAAAGTAGC 0: 1
1: 0
2: 1
3: 45
4: 378
Right 999652414 5:153780380-153780402 TATCACCCTGAAGTCAAGACTGG 0: 1
1: 0
2: 2
3: 8
4: 131
999652413_999652417 22 Left 999652413 5:153780348-153780370 CCATGTGATCTTGAGAAAGTAGC 0: 1
1: 0
2: 1
3: 45
4: 378
Right 999652417 5:153780393-153780415 TCAAGACTGGTATGAATCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999652413 Original CRISPR GCTACTTTCTCAAGATCACA TGG (reversed) Intronic
900733058 1:4275658-4275680 GCTTCTGTCTCAGGGTCACATGG - Intergenic
900885899 1:5415212-5415234 GTGACTTGCTCAAGGTCACAGGG - Intergenic
901197420 1:7447902-7447924 GCTATTTGCCCAAGGTCACATGG + Intronic
901931698 1:12600068-12600090 GTAACTTGCTCAAGGTCACACGG + Intronic
902376380 1:16031956-16031978 GTGACTTGCTCAAGGTCACACGG - Intronic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903703896 1:25270717-25270739 GTGACTTGCTCAAGGTCACAGGG - Intronic
903723345 1:25422607-25422629 GTGACTTGCTCAAGGTCACAGGG + Intronic
903755105 1:25655176-25655198 AGGACTTTCCCAAGATCACACGG - Intronic
903892859 1:26581456-26581478 GCAACTTGCCCAAGGTCACATGG - Intergenic
903976816 1:27155442-27155464 GTAACTTGCTCAAGGTCACACGG - Intronic
904583985 1:31569003-31569025 GTGACTTGCTCAAGGTCACATGG + Intergenic
904752477 1:32749532-32749554 GTGACTTGCTCAAGTTCACATGG + Intronic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905967246 1:42109092-42109114 GCTACTTTCTCCAGATTCTATGG - Intergenic
906041164 1:42788755-42788777 GATACTTGCTCAAAGTCACATGG - Intronic
906227150 1:44131457-44131479 AGAACTTTCTCAAGGTCACATGG - Intronic
906238613 1:44227804-44227826 GGAACTTGCTCAAGTTCACATGG - Intronic
906267790 1:44447262-44447284 GCAACTAGCTCAGGATCACAGGG - Intronic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
907490245 1:54804864-54804886 GTGACTTGCTCAAGATCCCACGG + Intergenic
910989442 1:93039889-93039911 GCTACATTTTCATGATTACAAGG - Intergenic
911510068 1:98800618-98800640 TCAACTTTATCAAGATCAGATGG + Intergenic
912420526 1:109539534-109539556 GCAACTTGCCCAAGGTCACACGG + Intergenic
912459735 1:109822630-109822652 TCCATTTTCTCAAGATAACAGGG + Intergenic
913044073 1:115058466-115058488 GTAACTTGCTCAAGGTCACAAGG + Intronic
913373955 1:118130868-118130890 GATTCTTTCCCAAGAACACAGGG + Intronic
914227406 1:145732284-145732306 GCTTCTTTGAAAAGATCACATGG - Intronic
915960207 1:160260250-160260272 GTAACTTGCTCAAGGTCACATGG + Intronic
916610967 1:166391115-166391137 CTGACTTTTTCAAGATCACATGG - Intergenic
918105874 1:181414750-181414772 GTGACTTTCTCAAGGTCACGTGG + Intronic
919323368 1:196072335-196072357 GCTGTTTTATAAAGATCACAGGG - Intergenic
920689208 1:208132897-208132919 GCAACTTGCCCAAGGTCACATGG + Intronic
921514826 1:216077041-216077063 GTAACTTTCCCAAGGTCACATGG - Intronic
921964604 1:221075166-221075188 GTAACTTTCTCAAGGTCACAAGG - Intergenic
922109167 1:222540609-222540631 GCAACTTGCTCAGGGTCACATGG - Intronic
922454555 1:225764199-225764221 GCTGTTTTCTCACAATCACAAGG - Intergenic
922596043 1:226813930-226813952 GCTAATGTCTCAAGAACCCAAGG - Intergenic
1064382264 10:14856363-14856385 GTAGCTTCCTCAAGATCACACGG + Intronic
1064389339 10:14928039-14928061 GCTCCTTTCTCCAAACCACATGG + Exonic
1065850445 10:29783333-29783355 GCGATTTGCTCAAGGTCACATGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067472273 10:46545885-46545907 GTAACTTGCCCAAGATCACATGG + Intergenic
1067900190 10:50232006-50232028 GTTACTTTCTCCAGGCCACAGGG + Intronic
1067993740 10:51245296-51245318 GCTAATTTCACTAGATAACAGGG - Intronic
1068856221 10:61799849-61799871 GTAACTTTCCCAAGACCACAAGG - Intergenic
1068913288 10:62401831-62401853 GGTACTTTCTGAAGATCATGGGG - Intronic
1070380120 10:75873578-75873600 GTTACTTTGTCAGAATCACAGGG + Intronic
1070692872 10:78540779-78540801 GTAACTTGCCCAAGATCACAAGG + Intergenic
1070700681 10:78599624-78599646 GCAACTTGCTCAAGATCATGTGG + Intergenic
1071075724 10:81749858-81749880 GCCACTTTGTCAATATCACATGG + Intergenic
1071356444 10:84801027-84801049 GTTGCTCTCTCAAGATCACAGGG - Intergenic
1072237061 10:93462484-93462506 GTAACTTGCTCAAGATCACAGGG + Intronic
1073290904 10:102412822-102412844 GCTGCTTCCTCAAGCTCCCAGGG + Intronic
1073703377 10:105955477-105955499 GCCACTTGCTCAAGGTCTCATGG + Intergenic
1073772102 10:106745952-106745974 GATATTTTCTCATGATTACAGGG - Intronic
1074183323 10:111081707-111081729 GCGACTTGCTCAGGATCCCAAGG + Intergenic
1074239702 10:111625469-111625491 GCCAATTTCTCAAAACCACAAGG - Intergenic
1074921315 10:118016773-118016795 GTAACTTGCTCAAGGTCACAGGG - Intronic
1075073641 10:119335842-119335864 GCTACTTGCTCAAAGTCACAGGG - Intronic
1076850589 10:133090633-133090655 GCTTCCTTCTCAAGACCCCATGG - Intronic
1078531349 11:12139119-12139141 GATTCTTTCTCAAGGTGACAGGG + Intronic
1078661005 11:13285497-13285519 GGTACCTTATCTAGATCACAGGG + Intronic
1078868101 11:15317191-15317213 GTAACTTGCCCAAGATCACACGG - Intergenic
1078911644 11:15738235-15738257 GTGACCTTCTCAAGATCACAGGG + Intergenic
1079587238 11:22141036-22141058 GTGACTTTCCCAAGGTCACATGG - Intergenic
1080593567 11:33747004-33747026 GATACTTTCTCAAAATCTCTAGG + Intronic
1081204327 11:40257507-40257529 GCTTCTTTCTCAGAAGCACATGG - Intronic
1081607155 11:44534560-44534582 GTTACTTGCCCAAGGTCACATGG - Intergenic
1081915846 11:46729636-46729658 GCAACTTGCTCAAAGTCACATGG - Intronic
1082122773 11:48397359-48397381 CCTGCTTTCACAGGATCACAAGG - Intergenic
1082556475 11:54568640-54568662 CCTGCTTTCACAGGATCACAAGG - Intergenic
1083258794 11:61512017-61512039 GTGACTTGCTCAAGATCACTTGG - Intergenic
1083403384 11:62440197-62440219 GTGGCTTTCTCAAGCTCACAGGG + Intronic
1083959649 11:66007455-66007477 GCAACTTGCTCCAGATCGCATGG - Intergenic
1084569532 11:69951097-69951119 GCTGCTTGCTCAAGCTCCCACGG + Intergenic
1085821577 11:79799217-79799239 GTAACTTAGTCAAGATCACATGG + Intergenic
1086367648 11:86123991-86124013 GATAGTGGCTCAAGATCACAGGG - Intergenic
1090534373 11:127624722-127624744 GCTCCTTTCTAAACCTCACAAGG - Intergenic
1091402690 12:190197-190219 GGGACTTTTTCAAGTTCACATGG - Exonic
1091536236 12:1412669-1412691 GTGACTTTCCCAAGGTCACAGGG - Intronic
1091855997 12:3740796-3740818 GCAACTTGCTCGAGGTCACATGG - Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1092247532 12:6872012-6872034 GCAACTTTCTCAAGTTCTCTTGG - Intronic
1092275483 12:7057834-7057856 GTAACTTTTTCAAGGTCACACGG + Intronic
1093224272 12:16462774-16462796 GTAACTTTCCCAAGATCACGTGG + Intronic
1093828783 12:23729267-23729289 ACCATCTTCTCAAGATCACACGG + Intronic
1094341780 12:29420174-29420196 GATAATGTCTCAATATCACATGG + Intronic
1094525997 12:31231700-31231722 GTTACTTTGCCAAGGTCACATGG - Intergenic
1095781851 12:46068673-46068695 GCTACTTTTGCATGATAACAAGG - Intergenic
1096108490 12:49013656-49013678 GCAACTTGCCCAAGGTCACATGG + Intronic
1096430586 12:51539713-51539735 GTAACTTTCTCAGGGTCACACGG - Intergenic
1096571173 12:52524142-52524164 GCTAGATTCTCAGAATCACAGGG + Intergenic
1096684015 12:53275988-53276010 TCTACTTTGTAAAGATCTCAGGG + Intronic
1097356826 12:58611631-58611653 GGAACTTGCTCAAGGTCACACGG + Intronic
1097627138 12:62014187-62014209 GCTACATCCTCAAGAATACAGGG + Intronic
1098229407 12:68357730-68357752 GCAGCTTACCCAAGATCACATGG - Intergenic
1098600244 12:72323095-72323117 TCCCCTTTCCCAAGATCACAGGG - Intronic
1098941330 12:76540281-76540303 ACTACTTGCCCAAGATCCCAGGG + Intronic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1100819424 12:98417497-98417519 GCAACTTGCTCAAGGTCACATGG - Intergenic
1101116028 12:101532136-101532158 GGTACTTGCTCAAGATCATATGG - Intergenic
1101241894 12:102847209-102847231 GTGACTTGCTCATGATCACAGGG + Intronic
1102745042 12:115242953-115242975 GTGACTTGCTCAAGATCACATGG + Intergenic
1103394424 12:120597131-120597153 GCGACTTTCCCAAAACCACATGG + Intergenic
1104234713 12:126922698-126922720 GTAACTTACTCAAGATCACAAGG + Intergenic
1104707588 12:130958940-130958962 GCGATTTGCTCAAGGTCACAGGG + Intronic
1105621663 13:22073560-22073582 TCTACTTTCGCAGTATCACAAGG - Intergenic
1105940218 13:25141205-25141227 GCAACTTTCCCAAGATCAAGCGG - Intergenic
1106368203 13:29104589-29104611 GCTACTTGTTGAAGATTACAAGG - Intronic
1106567802 13:30901412-30901434 GAAACTTGCTCAAGATGACATGG + Intergenic
1106831837 13:33592663-33592685 GATACTTGCTTAAGATCATAGGG + Intergenic
1106835391 13:33628817-33628839 GCAACTTTCCTAAGATCAAAAGG - Intergenic
1107420319 13:40240031-40240053 GCTCCTTTCCCAAGACCTCATGG + Intergenic
1108014356 13:46058611-46058633 GCCACTTTCTCAAGGTTGCAAGG - Intronic
1108454420 13:50598571-50598593 CTTACTTGCTCAAGGTCACATGG - Intronic
1109160385 13:58965759-58965781 GGTAGTTTCTCAAAATTACAGGG - Intergenic
1110405244 13:75143751-75143773 GCTACTGTCTCAAAATCAGCTGG + Intergenic
1110947773 13:81444764-81444786 GATAATTTCTGAAGCTCACATGG - Intergenic
1112038388 13:95519016-95519038 GCAATTTACTCAAGGTCACATGG - Intronic
1113637226 13:111927966-111927988 GCAACTTTCCCAAGATCACACGG + Intergenic
1114262679 14:21049709-21049731 GCCACTTTGTAAATATCACAAGG - Intronic
1115199972 14:30842800-30842822 ATTACTTGCTCAAGATCACATGG + Intergenic
1115380584 14:32733871-32733893 GCTACTTTATCAAGCACATAAGG - Intronic
1116248287 14:42446711-42446733 ACTACTTTCTCAGAAACACAAGG - Intergenic
1116917979 14:50543886-50543908 GATACTTTCCCCAGATGACATGG + Intronic
1117387049 14:55225962-55225984 GTTACACACTCAAGATCACATGG - Intergenic
1118595184 14:67429957-67429979 GTAACTTCCTCAAGATCACGTGG + Intergenic
1119708930 14:76807285-76807307 TCTACTTTCTCAGGCACACATGG + Intronic
1119748878 14:77063888-77063910 GAGACATTCTCAAGGTCACATGG + Intergenic
1119934719 14:78581126-78581148 GCTACTTGACCAAAATCACAAGG + Intronic
1120027379 14:79601457-79601479 GCTATTTGCTCAAAATGACAAGG - Intronic
1120032414 14:79657220-79657242 GGGACCTGCTCAAGATCACATGG + Intronic
1120833271 14:89016898-89016920 GTGACTTGCTCAAGGTCACATGG - Intergenic
1121285473 14:92732101-92732123 GTGACTTGCTCAAGGTCACATGG - Intronic
1121535376 14:94687111-94687133 GTGACTTCCTCAAGGTCACACGG + Intergenic
1121940963 14:98070244-98070266 GTTACTTTTGCAAGTTCACATGG - Intergenic
1122024849 14:98868192-98868214 GTGACTTTCTCAAGATCATGTGG - Intergenic
1122321700 14:100859428-100859450 TCTACATTCTCAAAATCACCTGG - Intergenic
1124848333 15:33311985-33312007 GCGACTTGCTCAAGGTCACTTGG - Intronic
1126636760 15:50787704-50787726 GCTATTTTCTCATGGTCACAAGG - Intergenic
1126733387 15:51707620-51707642 GCAACTTGCTCAAGATCTCATGG + Intronic
1126988117 15:54338750-54338772 GACATTTTCTCAAGGTCACAAGG + Intronic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129857608 15:78835800-78835822 GTTACTTGCTTAAGGTCACAGGG - Intronic
1130079126 15:80716345-80716367 GCTTCTGTCTCAAGACCACAGGG + Intronic
1132216583 15:100067094-100067116 GCTGCCTTCTCAATATCATAAGG - Intronic
1132216594 15:100067206-100067228 GCTGCCTTCTCAATATCATAAGG - Intronic
1132216604 15:100067318-100067340 GCTGCCTTCTCAATATCATAAGG - Intronic
1134174333 16:11993626-11993648 GTAACTTGCTCATGATCACATGG + Intronic
1134541404 16:15069634-15069656 GTCATTTTCCCAAGATCACATGG - Intronic
1134681281 16:16127568-16127590 GTTACTTGCCCAAGATCACATGG + Intronic
1135359392 16:21799214-21799236 GTCATTTTCCCAAGATCACATGG - Intergenic
1135428535 16:22361455-22361477 GTTACTTTTACAAGAGCACATGG + Intronic
1135436859 16:22434191-22434213 GTCATTTTCCCAAGATCACATGG - Intronic
1135968640 16:27055964-27055986 GTCACTTGCCCAAGATCACATGG + Intergenic
1135984108 16:27171126-27171148 GCTACTTTCCCAAAGTCTCATGG + Intergenic
1136263401 16:29097730-29097752 GTCATTTTCCCAAGATCACATGG + Intergenic
1137289216 16:47040344-47040366 GTGACCTCCTCAAGATCACATGG + Intergenic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1138680475 16:58680309-58680331 ATAACTTTCCCAAGATCACATGG + Intronic
1139116217 16:63957031-63957053 TCTACTTTATAAAGAACACATGG + Intergenic
1139236431 16:65344215-65344237 GCTACTTATTCAAGGTCATATGG + Intergenic
1140061759 16:71576447-71576469 GCTATGTTATCAACATCACAGGG - Intronic
1140439440 16:74975730-74975752 GTAACTTGCCCAAGATCACATGG + Intronic
1140649165 16:77067624-77067646 GCAACATTCTCAATATCACAAGG + Intergenic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141010427 16:80391865-80391887 CCTACTTTCTCGTGATCACTGGG - Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1142718729 17:1762577-1762599 GCTACTTTTTCAAAATCAGCTGG + Intronic
1143289413 17:5817695-5817717 GCAACTTGCTCAAGGCCACAGGG + Intronic
1143610971 17:8017161-8017183 GACACTTTCCCAAGGTCACATGG - Intronic
1145812885 17:27775105-27775127 ACTAATTGCTCAAGGTCACATGG - Intronic
1146008476 17:29177059-29177081 GGGACTTGCTCAAGGTCACACGG - Intronic
1146076850 17:29738486-29738508 GAGACTTTCTCAAGGTCTCAAGG - Intronic
1148443274 17:47722721-47722743 AATACCTTGTCAAGATCACATGG - Intergenic
1149005802 17:51803985-51804007 GCAACTTGGTCAAGATCACACGG - Intronic
1149035490 17:52129489-52129511 GTAACTTGCTTAAGATCACATGG + Intronic
1149445028 17:56706682-56706704 ATTACTTGCTCAAGATCACACGG + Intergenic
1150937123 17:69648757-69648779 GTTTCTTACTCAAGATCATATGG + Intergenic
1151146716 17:72047977-72047999 GTTACTTGTCCAAGATCACAGGG - Intergenic
1151282027 17:73083416-73083438 GCTAGTTTTTCCAGATCGCAGGG + Intronic
1154145576 18:11863614-11863636 GCTGCTTCCTTAAAATCACATGG + Intronic
1155375544 18:25153015-25153037 ACTATTTTATAAAGATCACAGGG - Intronic
1155746839 18:29365052-29365074 AATATTTTTTCAAGATCACAAGG + Intergenic
1156083410 18:33368677-33368699 GCAACTTGTTCAAGCTCACAAGG - Intronic
1157643053 18:49237146-49237168 GGTAACTTCCCAAGATCACACGG + Intronic
1157945956 18:51981105-51981127 GCCACTTTCCCAAGATCCGATGG - Intergenic
1160599707 18:80003232-80003254 GCTACATCCTCAAGAGCTCATGG + Intronic
1161682102 19:5685211-5685233 GCGACTTGCCCAAGGTCACACGG - Intronic
1162897772 19:13775708-13775730 ACAATTTGCTCAAGATCACAGGG - Intronic
1162974377 19:14200101-14200123 GCTCCTCTCTCAAATTCACAGGG - Intronic
1165107487 19:33480896-33480918 GCCATTTTCTCAAGTGCACATGG + Intronic
1166772495 19:45292356-45292378 GTTACTTGCCCAAGGTCACACGG - Intronic
1167666479 19:50825417-50825439 GCCTCTTGTTCAAGATCACACGG + Intronic
926534159 2:14089815-14089837 GATCCTTTCTCAAGAGCACATGG + Intergenic
926729267 2:16023010-16023032 GCAACTTGCCCAAGTTCACATGG - Intergenic
927070893 2:19528570-19528592 TTTACTTGCTCAAGATCACAGGG + Intergenic
928083678 2:28332373-28332395 GTGGCTTGCTCAAGATCACATGG + Intronic
929424420 2:41829549-41829571 GCAAATTTGTCAAGATTACATGG - Intergenic
931215922 2:60244629-60244651 GCTAATTTCAGAAGATCACTAGG + Intergenic
931476510 2:62593065-62593087 GTAACTTTCTGAAGTTCACACGG + Intergenic
931709486 2:64976149-64976171 GTAACTTTCCCAAGATCACAAGG + Intergenic
932909089 2:75786969-75786991 GCTGCTTCTTCAAGATCAAAGGG - Intergenic
933364706 2:81336407-81336429 ACATTTTTCTCAAGATCACATGG + Intergenic
933383029 2:81574608-81574630 GTAACTTTTTCTAGATCACATGG + Intergenic
933577330 2:84084183-84084205 TCTGCTTTCTCCAGATCAAAGGG + Intergenic
933808231 2:86015574-86015596 GCCACTTGCTGAAGGTCACAGGG + Intergenic
934128636 2:88924460-88924482 CATATTTTTTCAAGATCACATGG + Intergenic
935639604 2:105278533-105278555 CCTACTTGCTCAAGGTCACGCGG - Intronic
936246082 2:110828710-110828732 GTCATTTGCTCAAGATCACATGG + Intronic
936688526 2:114857943-114857965 GTAGCTTTCTCAAGGTCACATGG - Intronic
936959279 2:118056453-118056475 GCTATTTGCTGAAGCTCACATGG + Intergenic
937829693 2:126405935-126405957 TCTAATTTCTCAAGACAACATGG - Intergenic
938979537 2:136513247-136513269 GTGACTTGTTCAAGATCACATGG - Intergenic
939035380 2:137124541-137124563 GCTACTTCCTCAAGCACACAGGG + Intronic
939060047 2:137410661-137410683 GCTACTTTCTCATTGCCACATGG - Intronic
941575853 2:167229017-167229039 GCTACTTCCTCAACAACTCAGGG - Intronic
942115806 2:172728054-172728076 GCCACTTTCTCAAGCTCAGTTGG - Intergenic
944056899 2:195531741-195531763 GTTGCTTGCTCAGGATCACATGG + Intergenic
945109784 2:206351163-206351185 GTTACCTTCTCAAGATCATAGGG + Intergenic
945314111 2:208352074-208352096 GCAACTTGCTCAAGATCACTTGG - Intronic
945344559 2:208697571-208697593 GCTGCTTTCTCCAGAGCAAAAGG - Intronic
945975798 2:216269769-216269791 GCCAGTTCCTCAAGGTCACAAGG + Intronic
946395240 2:219440740-219440762 GTTACTTGCCCAAGGTCACATGG - Intronic
946727408 2:222674081-222674103 GTGAGTTACTCAAGATCACATGG + Intronic
946918531 2:224552349-224552371 GTTCATTTCTCAAGACCACAAGG - Intronic
947400043 2:229722810-229722832 CATACTTTCTCAAAATCAAAGGG + Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1169309712 20:4525187-4525209 GCTACTTACTCATGTGCACAGGG - Intergenic
1170258638 20:14376859-14376881 GTAACTTTCCCAATATCACATGG - Intronic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1170526433 20:17242733-17242755 GCTCCTCTCTCAATAGCACAAGG - Intronic
1171118318 20:22546487-22546509 GCCACTTGTTCAACATCACAAGG + Intergenic
1172611868 20:36258495-36258517 GCAGCTTGCTCAAGATCACACGG - Intronic
1173813474 20:45970546-45970568 GTAGCTTGCTCAAGATCACACGG + Intronic
1174179415 20:48665551-48665573 GAAACTTTCTCAAGGTTACATGG - Intronic
1174367713 20:50066551-50066573 GCCACTGGCTCAAGGTCACAGGG + Intergenic
1174496918 20:50952095-50952117 TTTATATTCTCAAGATCACATGG - Intronic
1174728730 20:52892707-52892729 ACAACTTTCTCAATATCACAGGG - Intergenic
1174943967 20:54964229-54964251 GGAACTTTCCCAAGATTACAGGG + Intergenic
1175649514 20:60706946-60706968 GCTTCTCTCTGAAGTTCACATGG - Intergenic
1175910067 20:62401019-62401041 GCAACTTGCCCAAGATGACATGG + Intronic
1178211093 21:30533006-30533028 TCTACTTTGTCAAGACCACTTGG + Intergenic
1181905634 22:26193386-26193408 GTAACATACTCAAGATCACAAGG + Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182740588 22:32564461-32564483 GTAACTTTCCCAAGGTCACACGG + Intronic
1182925765 22:34123149-34123171 GTGACTTGCTCAAGATCACACGG + Intergenic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183492779 22:38125640-38125662 GTGACTTGCTCAAGGTCACACGG - Intronic
1183529908 22:38347725-38347747 GTGACTTGCTCAAGGTCACATGG + Intronic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1183713213 22:39519088-39519110 GCTTCTTGCTCAAAGTCACAAGG - Intergenic
1184665616 22:45987401-45987423 GCTCCTGTCCCAAGAGCACAGGG - Intergenic
949183698 3:1165760-1165782 GTGACTTACTCAAGATAACATGG + Intronic
949669256 3:6379514-6379536 GCTAATTTCTCAACATAAAAAGG + Intergenic
949737518 3:7191022-7191044 GCTAATTTTTCAATATAACAGGG + Intronic
949805210 3:7947582-7947604 GTTACTTGCCCAAGATCAAATGG + Intergenic
950049846 3:9979477-9979499 GTGACTTGCTCAAGATCACATGG - Intronic
950243233 3:11390924-11390946 GATACTTGCTCAAGGTCACATGG - Intronic
952416977 3:33098000-33098022 GATACTTTCTCAATCTCTCAAGG - Intergenic
954217913 3:49134608-49134630 TCTGCTTTCTCAAGGTCAGAGGG + Intergenic
954589681 3:51771990-51772012 GCCACTTTCTCAGGGACACATGG + Intergenic
955187696 3:56730925-56730947 GGTACTTGCCCAAGATCAAAGGG - Intronic
955697325 3:61649802-61649824 GTTACTTGCTCAAGATCATGTGG + Intronic
956090813 3:65664998-65665020 GTTACTTTTTCAAGACCACATGG - Intronic
956860416 3:73318092-73318114 GCGACTTCTGCAAGATCACAGGG - Intergenic
957347495 3:78981113-78981135 TCGACTTTCCCAAGCTCACATGG + Intronic
959182114 3:102994317-102994339 TCTACTTTTTCAACATCAGAAGG + Intergenic
959258154 3:104041161-104041183 ACTACATTCTCAGGATCAAAGGG - Intergenic
960279159 3:115761828-115761850 TCTACTTTCCCCAGATCAAAGGG + Intergenic
961588217 3:127952990-127953012 GCAACTTGCTCAAAATCACATGG - Intronic
962736590 3:138330858-138330880 GATTCTTTCTCAAGCTCACATGG + Intergenic
963594776 3:147312138-147312160 CTTGCTTTCTCAAGATCCCAGGG - Intergenic
963897098 3:150698654-150698676 GCAACTTGCCCAACATCACAAGG + Intronic
963900245 3:150726663-150726685 GTTACTTACTCAAGTTTACATGG - Intergenic
964703425 3:159593490-159593512 GCTACTTTCTTAGGTTCACATGG - Intronic
965663179 3:171063929-171063951 GCTACTTCCTCCAGATCGCACGG + Exonic
966031481 3:175353546-175353568 GTGATTTACTCAAGATCACAAGG + Intronic
969085117 4:4650783-4650805 GCAGCTTGCTCAAGATAACAAGG + Intergenic
969116844 4:4875611-4875633 GCACCTTTTCCAAGATCACATGG + Intergenic
969832047 4:9805725-9805747 GCTTCTTTATCAAGATCAAAGGG - Intronic
970435972 4:16036081-16036103 TCTATTTTATGAAGATCACATGG - Intronic
971170807 4:24230750-24230772 ACTTCTGTCTCAAGATAACAAGG - Intergenic
971231754 4:24805842-24805864 GCTGCTTTCTCATGATAACGAGG - Intergenic
972234714 4:37117847-37117869 GCAACTTGCTCAAGGTCACATGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
974019089 4:56677052-56677074 GCTTCTTTCTCAGGAGCAGAAGG - Intronic
974353555 4:60782501-60782523 GTGACTTTCCCAAGGTCACATGG - Intergenic
975018665 4:69458676-69458698 GCTATTTTCTCCAGATCTCTGGG + Intergenic
975326830 4:73068326-73068348 GTTACTTGCACAGGATCACATGG - Intronic
975472754 4:74789569-74789591 GCAACTTTCTCAATGTTACAAGG + Intronic
975553457 4:75636539-75636561 GCTATTTGTTCAAGACCACATGG - Intergenic
977633212 4:99265789-99265811 GCAATTTTCCCATGATCACATGG + Intergenic
979533200 4:121791227-121791249 ATTACTTTCTCAAGGTCACATGG - Intergenic
979709975 4:123767934-123767956 GTTACTTGCTCAGGATTACACGG + Intergenic
979907276 4:126310969-126310991 GCTACTTTGACAATATCAGAAGG + Intergenic
980768550 4:137340762-137340784 GCTTCTTTCACATGGTCACAAGG + Intergenic
981347398 4:143692247-143692269 GTCACTTACTCAAGGTCACACGG + Intronic
981572018 4:146161834-146161856 GTAATTTGCTCAAGATCACATGG - Intergenic
982206934 4:153003861-153003883 GCTACTTTCTCCAAGTCTCAAGG + Intergenic
982293730 4:153805934-153805956 GTAACTTTCTCAAGGTCACCTGG - Intergenic
982477231 4:155868332-155868354 CCTACATGCTCAACATCACATGG + Intronic
983104690 4:163672116-163672138 AATACATGCTCAAGATCACATGG - Intronic
983514020 4:168638252-168638274 GCATCTTGCCCAAGATCACATGG + Intronic
983830231 4:172317843-172317865 GGTACTTAATCAAGTTCACAAGG - Intronic
984615391 4:181891297-181891319 GTTAGTTTCTTAAGATGACAAGG - Intergenic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
987131806 5:14867304-14867326 GGTACTTGTTCAAGATGACACGG - Intronic
988093878 5:26577103-26577125 GGGACTTGCTCAACATCACAGGG - Intergenic
988249933 5:28743963-28743985 GATACTTTTTCAAAACCACAGGG + Intergenic
990661614 5:58021760-58021782 GCAACTTTCTCAGGACCATAAGG + Intergenic
991189579 5:63853835-63853857 GTAACTTTCTCAGGGTCACATGG - Intergenic
992232967 5:74681666-74681688 GATAGTTTCACAAGATCTCAGGG + Intronic
992853406 5:80834937-80834959 GCCACTTCCTCAAGGTGACAGGG - Intronic
993570950 5:89538312-89538334 GCAACTTGACCAAGATCACAAGG + Intergenic
994557998 5:101329740-101329762 GCTCTTATCTCAAAATCACATGG - Intergenic
995226443 5:109706503-109706525 GTTACTTCCCCAAGATCACATGG + Intronic
997125164 5:131219218-131219240 GTCACTATGTCAAGATCACAAGG - Intergenic
997383460 5:133454130-133454152 GCTACTTTCTCAAAAGCATTTGG + Intronic
997607194 5:135183599-135183621 GCAACTTACCCCAGATCACACGG - Intronic
998364819 5:141622801-141622823 GTAACTTTCTGAAGGTCACATGG - Intronic
998796261 5:145822636-145822658 GTGACTTGCTCAAGGTCACATGG - Intronic
999346866 5:150830702-150830724 TATATTTTCTCAAGAGCACACGG + Intergenic
999615251 5:153416433-153416455 GCTCATTTCTCAGGTTCACATGG - Intergenic
999652413 5:153780348-153780370 GCTACTTTCTCAAGATCACATGG - Intronic
1000294287 5:159899457-159899479 GCTTCTTTCTCCAGTACACATGG - Intergenic
1001119593 5:168968844-168968866 GTAACTTACTCAAGGTCACACGG - Intronic
1001694680 5:173661128-173661150 GCGACTTGCTCAAGATCATGTGG + Intergenic
1002328148 5:178423381-178423403 GGTTCATTCTCATGATCACATGG - Intronic
1002444730 5:179282899-179282921 GCTCCCATCTCAAGATGACATGG - Intronic
1002790176 6:431684-431706 CTTACTTTCACAAGACCACATGG - Intergenic
1003139741 6:3460426-3460448 GCTTCTTTATTAAGATCACTGGG - Intergenic
1004535026 6:16492006-16492028 GGTCCTTTTTCAAGCTCACATGG - Intronic
1005899311 6:30204197-30204219 GCAACTTGCCCAAGAGCACATGG + Intronic
1005952258 6:30640646-30640668 GCTACTTACTCTAGATGCCACGG + Intronic
1006376161 6:33672771-33672793 GGTGCTTTCCCAAGGTCACAGGG + Intronic
1006748656 6:36363005-36363027 GTGACTTGCGCAAGATCACATGG - Intronic
1007243843 6:40445804-40445826 GCAACTTGCCCAAGACCACAGGG - Intronic
1008506362 6:52234678-52234700 GCGACTTGCTCAAGGTCACTTGG - Intergenic
1010895443 6:81357468-81357490 TCTATTTTCTCAATAGCACAAGG - Intergenic
1012265483 6:97136980-97137002 GTGACTTTCTCAGGGTCACACGG - Intronic
1012529293 6:100214786-100214808 GTAATTTTCTCAAAATCACATGG - Intergenic
1014599865 6:123397964-123397986 GCTACTTCATCAATATTACAAGG + Intronic
1014842073 6:126231660-126231682 GCTACTTTCAAAACATAACAGGG - Intergenic
1017148304 6:151254961-151254983 GCTGGGTTCTGAAGATCACAGGG - Intronic
1018347506 6:162917132-162917154 GCGAGTTTCTCAAAATAACATGG - Intronic
1018607256 6:165610868-165610890 GCTGCTTGCTAAAGGTCACATGG - Intronic
1021405056 7:20256217-20256239 GCTACTTGCTTAAGATTGCAGGG - Intergenic
1022779482 7:33564414-33564436 GTTACTTACTCAAAATCACATGG - Intronic
1022799361 7:33761097-33761119 GTCACTTCCTCAAGATCACATGG + Intergenic
1023336752 7:39178610-39178632 TCAACTTTATGAAGATCACAAGG - Intronic
1023700768 7:42889945-42889967 GTTACCTGCTCAAGATTACATGG - Intergenic
1026403318 7:70038718-70038740 GCCACTTTCCCAAACTCACATGG - Intronic
1027435163 7:78156637-78156659 GTAACTTCCTCAAGGTCACATGG + Intronic
1028071148 7:86452520-86452542 GCTACTTACTCATGTTCATATGG + Intergenic
1030194543 7:106840899-106840921 GCTTCTTTTCCAAGATCGCATGG + Intergenic
1030786833 7:113672799-113672821 GCTATTTTCTCAAAATCTCAAGG + Intergenic
1030796090 7:113789831-113789853 GTGAGTTTGTCAAGATCACATGG - Intergenic
1032382633 7:131500906-131500928 GTGACTTCCTCAAAATCACATGG - Intronic
1033438268 7:141353935-141353957 GAGACTTTCTCAAGGTCAAATGG - Intronic
1033799140 7:144880099-144880121 GTAACTTTATCAAGATTACATGG + Intergenic
1033947089 7:146733160-146733182 GCTACTCTTTCAAGAGCCCACGG + Intronic
1039766721 8:40636236-40636258 GCCAGTTTCTCAAGATGAAAAGG - Intronic
1041283268 8:56233131-56233153 GTGACTTGCTCAAGTTCACATGG + Intergenic
1041485161 8:58368463-58368485 GTGACTTTCTTAAGGTCACACGG - Intergenic
1041755110 8:61305023-61305045 GCAACTTGCTCAAGACCCCATGG - Intronic
1042289830 8:67158216-67158238 GCAAGTTTCTTAAGGTCACACGG + Intronic
1042652730 8:71060831-71060853 GCAACTTGGTCAAGACCACATGG + Intergenic
1043851611 8:85222554-85222576 GTAACTTTTCCAAGATCACACGG - Exonic
1045445689 8:102260919-102260941 GCTACTTTCTCACAATGACGTGG + Intronic
1045743129 8:105385948-105385970 GTAACTTGCTCAAGGTCACATGG - Intronic
1046095100 8:109548482-109548504 GCTAATTTCTAAAGTTCATATGG - Intronic
1046839087 8:118837732-118837754 GATGCTGTCTCAAGATCTCAAGG + Intergenic
1046946048 8:119975319-119975341 GCAACTTTCTCAAGACTATATGG + Intronic
1047181108 8:122589054-122589076 GCAACTTTCTCTGGATGACAAGG + Intergenic
1047971567 8:130088925-130088947 GATACTTGCTGAAAATCACAAGG + Intronic
1048396679 8:134020631-134020653 GTAACTTGCTCAAGGTCACACGG + Intergenic
1048543058 8:135360605-135360627 GTTACTTGCCCAAGGTCACACGG - Intergenic
1049099921 8:140571614-140571636 GCTTCTTTCTCAGGAACTCAGGG + Intronic
1049190941 8:141287032-141287054 GCGACTTCCTCAAGGTCACACGG - Intronic
1052252856 9:26420303-26420325 GCTACTTGCCCAGGATCCCATGG + Intergenic
1052854236 9:33397254-33397276 GCTCCTTTCTCATCAGCACACGG - Intronic
1053557618 9:39154382-39154404 ACTACTTTCTCATAATCATAAGG - Intronic
1053821733 9:41974670-41974692 ACTACTTTCTCATAATCATAAGG - Intronic
1054139496 9:61464569-61464591 ACTACTTTCTCATAATCATAAGG + Intergenic
1054608837 9:67212738-67212760 ACTACTTTCTCATAATCATAAGG + Intergenic
1054712319 9:68523579-68523601 GCTACTTTCTCCTGATCCCTAGG - Intronic
1054754688 9:68945735-68945757 GTAACTTTCTCAAGACCACATGG + Intronic
1054892447 9:70266324-70266346 GATAATTGCTCAAGGTCACAAGG - Intronic
1055251358 9:74310481-74310503 GCTTTGTTCTCAAGAGCACATGG + Intergenic
1056068948 9:82965930-82965952 GTTATTTACTCAAGGTCACATGG - Intergenic
1058304712 9:103424695-103424717 GCTACTTTCATAAGATCATAAGG + Intergenic
1058872294 9:109213036-109213058 ATGACTTTCTCAAGGTCACACGG - Intronic
1059332822 9:113546903-113546925 GCAATTTGCTCAAGGTCACACGG - Intronic
1059544144 9:115159442-115159464 GCAACTTACACAAGTTCACATGG - Intronic
1059772994 9:117445227-117445249 GTTACTTTCTCTAAACCACATGG - Intergenic
1061168480 9:128938376-128938398 CCTACTGGCTCAAGATCTCAGGG - Intronic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061226876 9:129285517-129285539 GATGCTTTCACATGATCACAGGG - Intergenic
1061268725 9:129524110-129524132 GGGACTTGCTCAAGGTCACAAGG - Intergenic
1061787154 9:133036519-133036541 GGTACTTACTCAAGAACACGGGG - Intronic
1062181088 9:135191688-135191710 GCAACTTTCTCAAGGTTGCACGG - Intergenic
1186218251 X:7323136-7323158 GCTATTTTCTCAAGTGCAAAGGG + Intronic
1187104711 X:16229399-16229421 GTGACTTCCTCAAGGTCACATGG - Intergenic
1188445918 X:30253203-30253225 GTAACATTCTCAAGTTCACATGG + Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1189226284 X:39415908-39415930 GTAACTTGCTCAAGGTCACATGG - Intergenic
1189663852 X:43332178-43332200 GTGACTTTCTTAAGATCTCATGG - Intergenic
1191951567 X:66598973-66598995 GTTAGTTTCTCAAAGTCACAGGG - Intronic
1191979596 X:66911339-66911361 GTGACTTGCTCAAGTTCACATGG - Intergenic
1192211432 X:69130362-69130384 TCCACTTTCTCAAGACCATAGGG - Intergenic
1192710921 X:73586659-73586681 GTGACTTTCTCAGAATCACATGG + Intronic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1194655967 X:96573777-96573799 GTGACTTTCTCAAGGCCACAAGG - Intergenic
1195021038 X:100828889-100828911 GTTACTTTCTCAAGGGGACAAGG + Intronic
1195461743 X:105134729-105134751 GCTCCTTTCTGAAGAACAAATGG - Intronic
1196084512 X:111670530-111670552 GCTGTTTGCTCGAGATCACATGG - Intronic
1196598595 X:117574541-117574563 GCTACTTTTTAAACATGACAAGG + Intergenic
1196735476 X:118977603-118977625 GGCATTTTCTCAAGGTCACACGG - Intronic
1199713698 X:150490967-150490989 GGGACTTTCTCAAGTTCACACGG + Intronic
1199982812 X:152930104-152930126 GTAACTTGCTCAAGGTCACATGG + Intronic
1200561785 Y:4713009-4713031 ACTTTTTTCTCAAGTTCACATGG - Intergenic
1200761112 Y:7039942-7039964 CTTACCTTCACAAGATCACAAGG + Intronic
1201587856 Y:15581064-15581086 GCTATTTTCTCAAGGGAACAGGG + Intergenic