ID: 999653311

View in Genome Browser
Species Human (GRCh38)
Location 5:153788445-153788467
Sequence CATTTTATTCTGAGATTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 417}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999653311 Original CRISPR CATTTTATTCTGAGATTGGA GGG (reversed) Intronic
901145911 1:7064564-7064586 CAGTTTAAGCTGAGATGGGAAGG + Intronic
903209492 1:21808955-21808977 CATTTTTTTCTGAGATGGATCGG + Intergenic
903469505 1:23575991-23576013 CAGGTTATACTGAGAGTGGAAGG - Intergenic
905457960 1:38101294-38101316 AATTTCATAGTGAGATTGGAAGG + Intergenic
906494256 1:46292468-46292490 CATTTTACTATGCTATTGGAGGG - Intronic
907595358 1:55714604-55714626 CATTGTACTTTGAGATTGCAAGG - Intergenic
907765544 1:57406820-57406842 CATTTTATTTTTAAATTGGGAGG - Intronic
908158050 1:61376901-61376923 CATTTTCATCTGAGATAGGTAGG - Intronic
908564959 1:65344920-65344942 TATTTTCTTTGGAGATTGGATGG - Intronic
908690349 1:66772502-66772524 CATTTCAATATGAGATTTGAAGG + Intronic
909089632 1:71209108-71209130 CATTTTATTCAAAGAATGAAGGG - Intergenic
910309540 1:85808017-85808039 CACTATGCTCTGAGATTGGAGGG - Intronic
910784504 1:90980458-90980480 CATTTTATTCTGAAAGTGATGGG + Intronic
910848106 1:91623372-91623394 CATTTGATTCCAAGATTGGTAGG + Intergenic
911243819 1:95495147-95495169 CATATTATTCTTGGATAGGAAGG - Intergenic
911467528 1:98274290-98274312 CATTTCATCATGAGATTTGAGGG - Intergenic
911512613 1:98826391-98826413 CATTTCAGTATGAGATTTGAAGG - Intergenic
911664411 1:100537899-100537921 AATTTTATTCTAATATTGAAGGG + Intergenic
912529633 1:110310918-110310940 CCTCTTAATCTGAAATTGGAAGG - Intergenic
913288526 1:117250347-117250369 CATTTTAATGTGAGATTTGGAGG + Intergenic
913955874 1:143292469-143292491 AATTTTAACATGAGATTGGAAGG - Intergenic
913981559 1:143522968-143522990 AATTTTAACATGAGATTGGAAGG + Intergenic
914075931 1:144349627-144349649 AATTTTAACATGAGATTGGAAGG + Intergenic
914103247 1:144616869-144616891 AATTTTAACATGAGATTGGAAGG - Intergenic
914928490 1:151909246-151909268 GCTTTTATTCTGAGATTGGCTGG + Intronic
915823545 1:159051449-159051471 CATTGTTTTATGAGAGTGGAAGG - Intronic
916660015 1:166914862-166914884 CATTTAAATCTGATTTTGGAAGG + Exonic
916666083 1:166968763-166968785 CATTTTGTTCTCACAGTGGAGGG - Intronic
918373563 1:183885473-183885495 CATATTAATCTGAAGTTGGAGGG + Intronic
918911312 1:190574358-190574380 CATTGTGTACTGAGATTTGATGG - Intergenic
919765273 1:201123198-201123220 CTTTTCATTCAAAGATTGGAGGG - Intronic
920603584 1:207355600-207355622 TATTATCATCTGAGATTGGAGGG - Intronic
921211023 1:212897859-212897881 CATTTCAATGTGAGATTGGAGGG + Exonic
921522997 1:216180290-216180312 CATTTTATTCTTAGAAATGATGG - Intronic
921565999 1:216720966-216720988 CATTTTAATCAGAGGTTGAAAGG + Intronic
921617576 1:217288441-217288463 CATTTTATTCTAGGAATGCAAGG + Intergenic
921928021 1:220729088-220729110 CACTTGATTCTAAGATTGTAGGG + Intergenic
922629498 1:227091263-227091285 CATTTCAACCTGAGATTCGAAGG - Intronic
923450559 1:234113193-234113215 CAATTTAGTCTGTGGTTGGACGG - Intronic
923871027 1:237994435-237994457 CAATTTATTAAGAGATGGGAGGG - Intergenic
924199919 1:241647979-241648001 CTTTTTATTCTGAAAATGTAAGG + Intronic
924754020 1:246925656-246925678 CATTTCAGTATGAGATTGGGAGG - Intronic
924950887 1:248882273-248882295 CATTTGATTATGAGGTTAGATGG + Intergenic
1063336030 10:5215245-5215267 CATTTTAACATGAGATTAGAAGG - Intronic
1064118498 10:12599271-12599293 CATCTTATTTTGAGAGTGGAAGG + Intronic
1064404059 10:15045499-15045521 GATTTTTTTCTGAGAGTTGATGG + Intronic
1064477493 10:15706808-15706830 GATTTTATTCTAAGAGTGGTGGG - Intronic
1064813565 10:19230602-19230624 CATTTTAACATGAGATTTGAAGG + Intronic
1064851995 10:19718597-19718619 CATTTCATCATGAGATTTGAAGG + Intronic
1065116610 10:22489328-22489350 CATTTTTTTTTGAGATTTCATGG - Intergenic
1065397393 10:25253500-25253522 CCTTTGACTTTGAGATTGGAAGG + Intronic
1066474807 10:35736421-35736443 CATTTTATTCTCACCTTTGAGGG + Intergenic
1066601910 10:37118132-37118154 CATTTTAATATGAGATTTGGAGG + Intergenic
1066952593 10:42135886-42135908 AATTTTAACATGAGATTGGAAGG - Intergenic
1067017964 10:42771788-42771810 GACTTTGCTCTGAGATTGGAGGG - Intergenic
1068047075 10:51899773-51899795 CATTTCAATATGAGATTGGGAGG - Intronic
1068205663 10:53848636-53848658 TATTTTTTCCTGAGATTTGAAGG - Intronic
1068472591 10:57483714-57483736 GATTTTATTCTGAGAGTGTCAGG - Intergenic
1068647227 10:59481064-59481086 GATTATATTTTGAGATTTGAGGG - Intergenic
1069202419 10:65637305-65637327 CATTTTAATATGAGATTGGGGGG + Intergenic
1072054660 10:91742566-91742588 TATTATATTCTGAGATCGTATGG - Intergenic
1072364348 10:94693889-94693911 CATTTCAGTATGAGATTTGAAGG + Intronic
1073080323 10:100855771-100855793 CATTTTAATATGAGATTTGGAGG - Intergenic
1074437758 10:113448640-113448662 CATTTTCTACTTAGATTGTATGG + Intergenic
1077803623 11:5567652-5567674 CATTTGATTCTGAGACTGACTGG + Intronic
1078592487 11:12656242-12656264 CACTGTATTCTCAAATTGGAAGG + Intergenic
1078944202 11:16045522-16045544 CATTTTATTCTGAGTGTGATGGG - Intronic
1079517620 11:21287747-21287769 CATTTTTTGCTGAGATTGAGGGG + Intronic
1079742322 11:24078498-24078520 CATTTTCTTATTACATTGGATGG - Intergenic
1084493061 11:69488728-69488750 CATTGTGTTCTCAGACTGGAAGG - Intergenic
1085262555 11:75215957-75215979 CATTTTTTACTGAGATTCTATGG - Intergenic
1086781348 11:90910172-90910194 CATTTCAATGTGAGATTTGAAGG + Intergenic
1087696305 11:101380186-101380208 CATTCTATTCACAGATTAGATGG + Intergenic
1088350894 11:108886110-108886132 CATTTTATTTTGAGAAGGGGAGG + Intronic
1088458440 11:110057790-110057812 CATTTTTTTCTGATGTTTGAGGG - Intergenic
1089411054 11:118243276-118243298 CATTTTCTTCTGAGAATGAGGGG - Intronic
1090819693 11:130330393-130330415 CAGTTTCTTCAGAGTTTGGAGGG + Intergenic
1091572090 12:1695795-1695817 CAATTTATTTTGGGAATGGAAGG + Intronic
1093186186 12:16022076-16022098 CATTTTAACATGAGATTGGGAGG - Intronic
1094291816 12:28859421-28859443 CATTTTTATTTGAGATAGGAAGG + Intergenic
1094373952 12:29770278-29770300 CATTTTATACTGTTTTTGGAAGG - Intronic
1095326571 12:40901711-40901733 TATTTTATTCTGACAATGGAAGG + Intronic
1097861007 12:64518579-64518601 CATTTCAATGTGAGATTTGAAGG + Intergenic
1098241734 12:68474126-68474148 TTTCTTATTCTGAGATTGGAGGG + Intergenic
1098484638 12:71006434-71006456 TATTTTGTTCTAAGATTGCAGGG - Intergenic
1098531590 12:71547651-71547673 CATTTAATTCCAAGATTTGAGGG - Intronic
1099544232 12:83956169-83956191 CATTTCAATATGAGATTGGGGGG + Intergenic
1101773022 12:107769008-107769030 GATTTTATTCTAAGAATGCAAGG + Intergenic
1102638218 12:114343082-114343104 CAATTCATTCTGAGCTTAGATGG + Intergenic
1104176649 12:126339517-126339539 TATGTCATTCTGAGATTGAATGG - Intergenic
1104345602 12:127993885-127993907 CATTTCATTCTAAGGGTGGAGGG - Intergenic
1105321370 13:19325243-19325265 CATTTCAATATGAGATTTGAAGG + Intergenic
1105446946 13:20465785-20465807 CATTTTATCATGAGATTTGGAGG - Intronic
1105683567 13:22753660-22753682 CATTTCAACATGAGATTGGAGGG - Intergenic
1105777101 13:23673180-23673202 TATTTTATCCTGAGATTACATGG + Intronic
1106560410 13:30840653-30840675 CATTTCAATGTGAGATTGGGAGG + Intergenic
1108742402 13:53351766-53351788 CAAGTTATTCTGGGATTGAAGGG + Intergenic
1108770785 13:53698473-53698495 CATTTTATTCATTTATTGGAAGG + Intergenic
1108794313 13:54012700-54012722 CAATCTCTTCTTAGATTGGATGG + Intergenic
1108984534 13:56568748-56568770 TGTTTTATTCTGAGTTTGAATGG + Intergenic
1109299235 13:60573984-60574006 CAGTTTATTCTGTAATTGTAGGG - Intergenic
1112150851 13:96761840-96761862 CATTTTATTCTGACCTTGAGAGG + Intronic
1113370570 13:109721523-109721545 CATGTTATGCTCAGATTGTAAGG + Intergenic
1115532558 14:34340674-34340696 CATTCATTTCTGAGATTTGAGGG + Intronic
1115776963 14:36725886-36725908 CATTTTATTTTGAAATTGTTAGG - Intronic
1116510400 14:45738099-45738121 CATTTCAACATGAGATTGGAGGG + Intergenic
1116765178 14:49061724-49061746 TATTTTTTTAAGAGATTGGATGG - Intergenic
1117133676 14:52711472-52711494 TTTCTTATTCTGAGATTGGAGGG + Exonic
1117508835 14:56428551-56428573 CATTTTGCTCTGAGGTTGGTGGG - Intergenic
1118024639 14:61756498-61756520 CATTTTATCATGAGATTTGGAGG + Intergenic
1119412783 14:74444979-74445001 CATTTCAGTGTGAGATTGGAAGG - Intergenic
1120499054 14:85271288-85271310 TAGCTTATTCTGAGAATGGAGGG - Intergenic
1120703384 14:87723253-87723275 CATTTAACTCTGAAATGGGATGG + Intergenic
1121401472 14:93681590-93681612 CATTTTGTTCTCATACTGGAAGG - Intronic
1121732568 14:96196782-96196804 CATTTCAACATGAGATTGGAAGG + Intergenic
1202938377 14_KI270725v1_random:115990-116012 AATTTTAACATGAGATTGGAAGG - Intergenic
1123394818 15:19921898-19921920 AATTTTAACATGAGATTGGAAGG + Intergenic
1124574304 15:30894557-30894579 CAATTCATGCTGAGCTTGGACGG - Intergenic
1126126768 15:45301098-45301120 CATTATATTAAGAGATAGGAAGG - Intergenic
1126314767 15:47358196-47358218 CATTTTATTCAAAGACTTGAGGG - Intronic
1126747182 15:51837863-51837885 CAGTTTCTTCTGAGGTAGGAGGG - Intronic
1128609508 15:69062716-69062738 CTGTTTATTCTGCGATGGGAGGG - Intronic
1128660486 15:69497445-69497467 CTTTCTATTCTGAGTTTGGTTGG - Intergenic
1129481402 15:75829480-75829502 GACTTTATCCTGAGAGTGGAGGG + Intergenic
1130829093 15:87581442-87581464 TATTTTATTCTGAAAATGGCTGG - Intergenic
1131231067 15:90659962-90659984 GATTTTATTCTGAGGTTAGTGGG + Intergenic
1131652952 15:94422035-94422057 CATTTTAAACTGAGAGTGGCTGG + Intronic
1132035181 15:98477346-98477368 CATTTTAACCTGAGATTTGGAGG + Intronic
1133314213 16:4872253-4872275 CATTTTATTCCTGGAATGGAGGG + Intronic
1133738945 16:8637192-8637214 CTTTTGTTTCTGAGATAGGAAGG + Intronic
1134043623 16:11085900-11085922 CATTTCAACCTGAGATTGGGCGG + Intronic
1134781916 16:16905963-16905985 CATTTTGTTCTGCACTTGGATGG - Intergenic
1135159175 16:20078370-20078392 CACTTTACTCAGAGTTTGGAAGG + Intergenic
1135463085 16:22661999-22662021 GATTTTATTCTAAGATTGACGGG - Intergenic
1135826065 16:25730042-25730064 TATTTTATTTTGAAACTGGATGG + Intronic
1136717634 16:32296630-32296652 CATTTTAATATGAGATTTGGAGG + Intergenic
1136770440 16:32834832-32834854 AATTTTAACATGAGATTGGAAGG - Intergenic
1136836010 16:33502894-33502916 CATTTTAATATGAGATTTGGAGG + Intergenic
1136936560 16:34472722-34472744 AATTTTAACATGAGATTGGAAGG - Intergenic
1136945163 16:34641214-34641236 AATTTTAACATGAGATTGGAAGG + Intergenic
1136955500 16:34780240-34780262 AATTTTAACATGAGATTGGAAGG + Intergenic
1136963259 16:34875848-34875870 AATTTTAACATGAGATTGGAAGG + Intergenic
1136967348 16:34930053-34930075 AATTTTAACATGAGATTGGAAGG + Intergenic
1137016976 16:35387208-35387230 AAGTTTAATATGAGATTGGAGGG + Intergenic
1137087959 16:36152166-36152188 AATTTTAACATGAGATTGGAAGG + Intergenic
1137092406 16:36210326-36210348 AATTTTAACATGAGATTGGAAGG + Intergenic
1137233625 16:46593789-46593811 CATTGTTTTCAAAGATTGGAAGG + Intronic
1138643739 16:58407308-58407330 CCTTTTTCTCTGAGATGGGAGGG - Intergenic
1141451836 16:84108905-84108927 CATTTTGTTCTGATACTGAATGG - Intronic
1203008794 16_KI270728v1_random:221144-221166 CATTTTAATATGAGATTTGGAGG - Intergenic
1203072861 16_KI270728v1_random:1096938-1096960 AATTTTAACATGAGATTGGAAGG - Intergenic
1203146187 16_KI270728v1_random:1803215-1803237 CATTTTAATATGAGATTTGGAGG + Intergenic
1146682331 17:34817073-34817095 AATTTTATCCTGAGAGTGGCTGG + Intergenic
1148223746 17:45883563-45883585 CATTTGATTTTGACTTTGGATGG + Intergenic
1148588296 17:48796640-48796662 CAGTTCTTTCTGAGATTGGGTGG + Intronic
1149011187 17:51858300-51858322 CATTTTATACTGAGAAGGCATGG + Intronic
1149065887 17:52478826-52478848 CATTTTTTTGTGAGATATGAGGG - Intergenic
1149715104 17:58781530-58781552 CATTTTCGTCTTAGATTGTAAGG + Intronic
1150956804 17:69868561-69868583 CATTTTATCATGAGATTTGGAGG + Intergenic
1151813090 17:76456564-76456586 CATTGTGTTCTGGGATGGGAAGG - Intronic
1152303231 17:79507365-79507387 CTTATAATTCTGAGGTTGGAGGG + Intronic
1203182953 17_KI270729v1_random:81846-81868 AATTTTAACATGAGATTGGAAGG + Intergenic
1152981102 18:277608-277630 GATTTTATTCTGGGAGTTGAAGG + Intergenic
1153040488 18:808905-808927 TATTTTATGCTGAGATTTCATGG + Intronic
1156664071 18:39383855-39383877 CATTTGATGCTGAGAGTGTATGG + Intergenic
1156818970 18:41346820-41346842 TCTTTTCTTCTGAGATTGGTAGG - Intergenic
1157754215 18:50203882-50203904 CATTTCATTCTGGGGTTGGCGGG - Intergenic
1158784739 18:60696763-60696785 CATTTCATCGTGAGATTGGGAGG - Intergenic
1159214482 18:65372525-65372547 CATTTCAACATGAGATTGGAGGG + Intergenic
1159467517 18:68803895-68803917 CACTTTATTCTGAGTTTGATGGG + Intronic
1160224995 18:77005607-77005629 CATTTCCTTCTGAGAATGGTGGG + Intronic
1160235150 18:77079777-77079799 GAATTTATTCTGAGTGTGGAAGG - Intronic
1161836025 19:6647213-6647235 AATCTTATTCTGTGATTGGCCGG + Intergenic
1162059554 19:8086317-8086339 CATTGTCATCTGAGATGGGAGGG + Exonic
1164387749 19:27790509-27790531 CAATTTATTCTTAGAATGCAAGG + Intergenic
1164423760 19:28121318-28121340 CATTTTGTTCTGTGTTTAGATGG - Intergenic
1164961252 19:32432318-32432340 CATTTTATTCTAAGAATAAAAGG - Intronic
1165222933 19:34332015-34332037 CATTTCAGTCAGAGGTTGGAAGG + Intronic
1167128409 19:47567831-47567853 CATTTAAGCCTGAGTTTGGAGGG - Intergenic
1202671072 1_KI270709v1_random:52395-52417 AATTTTAACATGAGATTGGAAGG + Intergenic
926971928 2:18475125-18475147 CATTTTAGGCTGAGATGGCAGGG - Intergenic
929046238 2:37793328-37793350 CATTTCAACCTGAGATTTGAAGG + Intergenic
929167537 2:38898160-38898182 CACTTGATTCTGATTTTGGAGGG + Intronic
930716651 2:54599704-54599726 CTTTTTATTTTGGGAGTGGAGGG + Intronic
930776180 2:55172642-55172664 CATTTTTTTCTGAGAAAGAATGG + Intergenic
931141769 2:59467289-59467311 AGTTTTATCATGAGATTGGAGGG + Intergenic
931961412 2:67487208-67487230 GATTTTATTCTGAGAGTGACAGG + Intergenic
932019740 2:68071832-68071854 TATTTTATTCTGATATTGTTTGG - Intronic
932485242 2:72080701-72080723 AACTCTACTCTGAGATTGGAGGG - Intergenic
932834724 2:75025665-75025687 CATTTTATTTTGATATTTCATGG + Intergenic
934250344 2:90347858-90347880 AATTTTAACCTGAGATTGGAAGG - Intergenic
934259221 2:91455558-91455580 AATTTTAACCTGAGATTGGAAGG + Intergenic
934302520 2:91787448-91787470 AATTTTAACATGAGATTGGAAGG + Intergenic
934330736 2:92065321-92065343 AATTTTAACATGAGATTGGAAGG - Intergenic
935076459 2:99749574-99749596 CATTTTATTCTAAGGATGGCAGG + Intronic
935228231 2:101072923-101072945 CATTTCAATATGAGATTCGAAGG + Intronic
936128572 2:109813195-109813217 ATATTTATTCTGTGATTGGAGGG + Intronic
936216125 2:110558290-110558312 ATATTTATTCTGTGATTGGAGGG - Intronic
937528650 2:122801666-122801688 TATTTCATTCTGAGTTTGAATGG + Intergenic
938452862 2:131438523-131438545 TATTTTAATTTGAGACTGGATGG - Intergenic
941292445 2:163694125-163694147 CTTTTTATTCTGATAGTGGAAGG + Intronic
942074068 2:172340816-172340838 CATTTTATTTAGAAATTTGAAGG + Intergenic
943963616 2:194301256-194301278 CATTTTATTCTTATAATGAAAGG + Intergenic
944127858 2:196314455-196314477 TATTCTGATCTGAGATTGGAAGG - Intronic
944380105 2:199098609-199098631 CATTTTATTCTGAGCTCTAAAGG + Intergenic
944563185 2:200962201-200962223 CATTTTATTGTGTGATTGTTAGG - Intronic
947385782 2:229588632-229588654 CATTTTCTTTTGAGTTTGTAAGG - Intronic
948371279 2:237490630-237490652 CATTCTATTTTCAGAATGGATGG - Intronic
1172757952 20:37300395-37300417 CATTTTATTTTGTGATGAGAAGG - Intronic
1173963230 20:47091207-47091229 CATTTAATCCTGGGAGTGGAGGG - Intronic
1174778362 20:53366052-53366074 CTTTTTCTTCTGACACTGGAAGG - Intronic
1176255674 20:64151497-64151519 CACTTTGTCCTGAGGTTGGAGGG - Intergenic
1176584938 21:8573146-8573168 AATTTTAACATGAGATTGGAAGG + Intergenic
1176589081 21:8623073-8623095 CATTTTATTCTGAGACATCAAGG - Intergenic
1177481431 21:21694790-21694812 GTTATTATTCTGAGACTGGAAGG + Intergenic
1177522301 21:22241472-22241494 AATTTTATTTTGATATTGAAAGG - Intergenic
1178473348 21:32914904-32914926 CATTTTCTGCAGTGATTGGAAGG + Intergenic
1179413880 21:41182474-41182496 TATTTTATTTTTATATTGGAGGG + Intronic
1180267747 22:10550048-10550070 AATTTTAACATGAGATTGGAAGG + Intergenic
1180271907 22:10600070-10600092 CATTTTATTCTGAGACATCAAGG - Intergenic
1181122540 22:20681409-20681431 GATTTTATTCTGAGCTTTGAGGG - Intergenic
1181179883 22:21059676-21059698 GATTTTATTCTGAGCTTTGAGGG + Intronic
1181260012 22:21590966-21590988 CATTCTATTTGGAGAGTGGAAGG + Intronic
1183130893 22:35834825-35834847 GATTTTATTCAGAGACTGAAGGG + Intronic
1184171110 22:42760357-42760379 AATTTTAACCTGAGTTTGGAGGG - Intergenic
1185253462 22:49818101-49818123 CATTTTATTTTGAGTTTAAAAGG - Intronic
1203236774 22_KI270732v1_random:10334-10356 AATTTTAACATGAGATTGGAAGG + Intergenic
949138235 3:598696-598718 CATTTTATTCTGAGACATCAAGG + Intergenic
949169448 3:980960-980982 CATTTTACTATGAGATTTGGAGG + Intergenic
949240935 3:1870879-1870901 CATGATATTCCGAGATTGGTAGG + Intergenic
949542628 3:5045711-5045733 CATATGAATTTGAGATTGGAGGG - Intergenic
951018412 3:17755452-17755474 CATTTTAATGGGACATTGGAAGG - Intronic
951583879 3:24195614-24195636 GATTTTATTCTAATATTGGTGGG - Intronic
951811443 3:26705217-26705239 CAGTTAATTCTGGGATTGGGTGG - Intronic
952623458 3:35374604-35374626 TATTTTATACTAAGAGTGGAAGG + Intergenic
952669547 3:35949673-35949695 CATTTTAAAATGAGATTTGAAGG - Intergenic
952878478 3:37968050-37968072 TATTTTATACTGAGATTATAAGG + Intronic
954644071 3:52120076-52120098 GGTTTTCTTCTGAGATAGGAAGG - Intronic
955776235 3:62436748-62436770 CATTTTTATCTGAGAGAGGATGG + Intronic
955951447 3:64246434-64246456 AATTTTATTCTTATGTTGGAAGG - Intronic
956234216 3:67049940-67049962 CATTTTAATATGAGATTTGGAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
957223905 3:77417561-77417583 CATTCTATTCTGACATTAAATGG - Intronic
957665779 3:83224192-83224214 CATTTTGTTCAGAGATTTCATGG + Intergenic
957853331 3:85840287-85840309 CATTTTTTTCTAAAAATGGAAGG - Intronic
957903668 3:86531295-86531317 GTCTTTATTCTGAGGTTGGATGG - Intergenic
958115196 3:89207249-89207271 TATTTTATTTTGTGATTAGAAGG + Intronic
958245610 3:91150533-91150555 CATTCAATTCTGAGAGTTGAAGG - Intergenic
958843251 3:99234235-99234257 CATTTCATGCTGAAAATGGATGG + Intergenic
958867321 3:99516398-99516420 TATTTTAGTCAGAGATTGCATGG - Intergenic
959248862 3:103913222-103913244 CATTTTAGTTGCAGATTGGAAGG + Intergenic
959631979 3:108517262-108517284 CATTTTGATCAGAGATTGGGAGG - Intronic
959743499 3:109748757-109748779 CATTTTATTTTTAGACTTGAGGG + Intergenic
960512270 3:118564883-118564905 CATTTTATTCTCATCTTGAAAGG - Intergenic
963956593 3:151261113-151261135 CATTTAATTCTGAAATAAGAGGG + Intronic
964004052 3:151808842-151808864 CATTTGATTATGAGATGAGATGG + Intergenic
964005090 3:151817440-151817462 CATTTTCATCTGAGGTTGGTGGG - Exonic
964396311 3:156249678-156249700 GATTTTATTCTAAGATTGATAGG - Intronic
966456214 3:180118706-180118728 CATTTTATTTTTAGAATCGATGG - Intergenic
966763877 3:183441227-183441249 CATCTCAATATGAGATTGGAGGG + Intergenic
967126202 3:186426865-186426887 CACTTTTTTCTGGGCTTGGAAGG + Intergenic
967306551 3:188065103-188065125 TAGTTTCATCTGAGATTGGAGGG - Intergenic
967367951 3:188709153-188709175 CATTATATTCATGGATTGGAAGG - Intronic
968842411 4:3017150-3017172 AATTTTATTCTCAGAGTGGCAGG - Intronic
969178152 4:5415741-5415763 CAGTTGAGTCTGAGATTAGAGGG + Intronic
970261312 4:14227747-14227769 CATTTTATACTGAGATGTGTTGG - Intergenic
971626743 4:28930677-28930699 TATTTTTTTCTCAGATTGGTAGG - Intergenic
972007160 4:34124013-34124035 AATTGTATTCTGAGAATGAAAGG - Intergenic
972495997 4:39635362-39635384 GATTTTATTCTGAATATGGATGG + Intronic
972908184 4:43777627-43777649 TATTTTATTCTGGGCTTGGTTGG + Intergenic
973248777 4:48040233-48040255 CATTTTGTTTTGAGATTAAAAGG + Intergenic
973317472 4:48777764-48777786 CCTTTTATTATGAGATGGGAAGG + Intronic
973917894 4:55655052-55655074 GATTTTATTTTTATATTGGATGG + Intergenic
974356420 4:60818567-60818589 TATATTATTCTGAGATGGTAAGG - Intergenic
974489474 4:62546087-62546109 CATTTGATTCTGAATTTGGTAGG + Intergenic
975244319 4:72101868-72101890 CTTTGGATTCTTAGATTGGATGG - Intronic
975360034 4:73458519-73458541 CATTTTACTCTGAGAGAGGTGGG - Intergenic
975619525 4:76281985-76282007 CATTTGATTGTGAGATGAGATGG + Intronic
976107504 4:81634712-81634734 CCTTTTATTCTGTGATTGACAGG - Intronic
976533523 4:86184528-86184550 CATTTTAACATGAGATTTGAAGG - Intronic
976649438 4:87419152-87419174 CATTTCAACATGAGATTGGAGGG + Intergenic
976807834 4:89067984-89068006 CATTTTAGATGGAGATTGGAAGG - Intronic
977380543 4:96267815-96267837 CACTTGATTTTGTGATTGGATGG - Intergenic
977470483 4:97436921-97436943 CATTTTATCATGAGATTTGGAGG - Intronic
977988412 4:103413287-103413309 CATTTTTTTCTGAGTTTTAATGG - Intergenic
978749091 4:112227333-112227355 TATTTTATTCTGAAGTTGAAGGG - Intergenic
979661675 4:123262913-123262935 AATTTTTTTCTGAGTTTTGATGG + Intronic
980773351 4:137407655-137407677 TATTTTCTTCTGAAAATGGAGGG - Intergenic
980787619 4:137575131-137575153 CATTTTGTACTGAGGTTGCAGGG - Intergenic
981052468 4:140323078-140323100 CATTTTAACATGAGATTTGAAGG - Intronic
981119159 4:141029021-141029043 CATTTGATTCTAAGAATGGGTGG + Intronic
981815163 4:148822643-148822665 CATTTTATTCTGAAAGTTCATGG - Intergenic
982639210 4:157935989-157936011 AATTTTATTTTGAGAGTGGCTGG - Intergenic
982923207 4:161303195-161303217 CAGTTTCTTCTGAGGCTGGAGGG - Intergenic
983137053 4:164097791-164097813 CATATTTTTGTGAGATTTGAGGG + Intronic
983144631 4:164198177-164198199 CATTTTATTCTTTCATTTGAGGG - Intronic
983751450 4:171277728-171277750 CATTTGATTTTGAGATTGTGAGG - Intergenic
984033208 4:174630924-174630946 TAGATTATTCTGAAATTGGAGGG + Intergenic
984113717 4:175651409-175651431 CATTGTCTTCTGAAATGGGAGGG - Intronic
984325518 4:178245184-178245206 CATTTTATTCTTGGTTTGCAAGG - Intergenic
984492551 4:180453628-180453650 CATGTTATTCAAATATTGGAAGG + Intergenic
985006522 4:185540015-185540037 CCTTTTCTTCTGAGAATGGTTGG + Intergenic
985347311 4:189019811-189019833 CATTTCAACATGAGATTGGAGGG - Intergenic
986268435 5:6210752-6210774 CATTTGATACTGAGATTAGTAGG + Intergenic
986792415 5:11175024-11175046 CATTGTTTCCTGAGAATGGAAGG + Intronic
987108870 5:14665960-14665982 CCTTTTAGCATGAGATTGGAGGG + Intronic
988072911 5:26317488-26317510 CATTTGATTCTCAGCTTGGTTGG + Intergenic
988730842 5:33971248-33971270 TTTCTTATTCTGAGATTGGAGGG + Intronic
989757937 5:44978665-44978687 CATTTCAATATGAGATTTGAAGG + Intergenic
990083540 5:51945812-51945834 CATCTTCTTCAGAGATTGGTAGG - Intergenic
990947771 5:61267171-61267193 GATTTTATCCTGAGATCTGATGG + Intergenic
992099402 5:73392031-73392053 CCTTTTGTTCAGAGATTTGAAGG + Intergenic
992164982 5:74040583-74040605 CTTTTTCTTCTGAGATATGAAGG - Intergenic
992280568 5:75172217-75172239 CAGTTTATTCTAAGAATGTAAGG + Intronic
992938215 5:81734251-81734273 CATTTTTTTCTTAGTATGGAAGG - Intronic
993178779 5:84521386-84521408 AATTTTAACATGAGATTGGATGG - Intergenic
993591132 5:89796442-89796464 CATTTTAGTGTGAGTTTGGGAGG - Intergenic
993843803 5:92914347-92914369 CATTGTATTATGTGATTTGAAGG + Intergenic
994951242 5:106466004-106466026 CATTTTATTCTGAGAGGGAAGGG + Intergenic
994966003 5:106671767-106671789 CAATTTGTTCTGAGAGTGAAAGG + Intergenic
995522199 5:113019829-113019851 TATTTTATTCTGAAATGAGATGG - Exonic
996616656 5:125450082-125450104 AATTTTATTCTGGGATTTGGAGG + Intergenic
996689072 5:126318319-126318341 CATTTTATTCTAAGAAGGGGAGG + Intergenic
997651816 5:135527531-135527553 CATTTCAATCTGAGATTTGGAGG - Intergenic
997868234 5:137483644-137483666 CAATTTATTTTGGGGTTGGAGGG + Intronic
998246636 5:140512687-140512709 CTTTTTATTCTTAAATTGGTAGG + Intronic
998300637 5:141016174-141016196 CATTTCAATCTGTGATTGAATGG - Intergenic
998764155 5:145466609-145466631 CATTTTATTTTGATATTGGCTGG + Intergenic
998881404 5:146648949-146648971 GATTTTATTCTGAGTTTAGTGGG + Intronic
999653311 5:153788445-153788467 CATTTTATTCTGAGATTGGAGGG - Intronic
1000979790 5:167804366-167804388 CATTCTATGCTGAGATCTGAGGG + Intronic
1004504291 6:16235387-16235409 CATTTTATTATGGGAGGGGAGGG - Intergenic
1006489593 6:34375709-34375731 CATTTTCTTCGGAGATTGGAAGG - Intronic
1009430635 6:63561751-63561773 CATTATATTCTCACATTTGATGG + Intronic
1009611147 6:65942936-65942958 CATTTTCTTCTGTGATAAGAAGG - Intergenic
1009890215 6:69671828-69671850 CATTTTAACATGAGATTTGAAGG - Intergenic
1010590484 6:77706590-77706612 CATTTTAACATGAGATTTGAAGG - Intronic
1011022977 6:82834753-82834775 CATTTCAATATGAGATTTGAGGG + Intergenic
1012086462 6:94832019-94832041 CATTTTATTTTGGGTGTGGAAGG - Intergenic
1012555392 6:100505400-100505422 GCTTTTATTCTGAGATGGAAAGG + Intergenic
1014642602 6:123931437-123931459 CATTTTATTATGATATTTGCTGG + Intronic
1014759861 6:125344603-125344625 GATTTTATTCTGAGGTTTGATGG + Intergenic
1015327493 6:131940039-131940061 CATATAAATGTGAGATTGGAAGG - Intergenic
1016194185 6:141312034-141312056 CTTTTTATTCTGTGTTTGTATGG + Intergenic
1016710752 6:147168920-147168942 CATTTTATTTTGAAATGTGAAGG - Intergenic
1017641572 6:156499122-156499144 TATTTTATTCTAAGGTTGGAAGG + Intergenic
1021252365 7:18346655-18346677 CATCTTATTTTCAGATGGGAAGG - Intronic
1021516549 7:21494654-21494676 CATTGTATTCAAGGATTGGATGG + Intronic
1022422140 7:30233382-30233404 CTTTTTAATCTGAGAAAGGAAGG + Intergenic
1023559411 7:41458300-41458322 CATTTTACTCTAAGATGGAATGG - Intergenic
1025221965 7:57119065-57119087 CATTTTTTTCTGCAATTGCAGGG + Intergenic
1025473731 7:60892904-60892926 AATTTTAACATGAGATTGGAAGG + Intergenic
1025479884 7:60969071-60969093 AATTTTAACGTGAGATTGGAAGG + Intergenic
1025489035 7:61088776-61088798 AATTTTAACATGAGATTGGAAGG - Intergenic
1025513274 7:61596962-61596984 AATTTTAACATGAGATTGGAAGG - Intergenic
1025552076 7:62263267-62263289 AATTTTAACATGAGATTGGAAGG - Intergenic
1025557881 7:62332392-62332414 AATTTTAACATGAGATTGGAAGG - Intergenic
1025564797 7:62420394-62420416 AATTTTAACATGAGATTGGAAGG + Intergenic
1025593890 7:62900478-62900500 CATTTCCAACTGAGATTGGAAGG + Intergenic
1027126698 7:75561583-75561605 GATTTTCTTCTGAGATTAAAGGG + Intronic
1027857044 7:83525158-83525180 CATTTTCCTCTGAAATTAGATGG + Intronic
1027939720 7:84660361-84660383 CATTTTATTGTGAGTTTAGCTGG - Intergenic
1027955621 7:84875577-84875599 TATTTTATACTGAGAGTGTAAGG - Intergenic
1028676265 7:93465787-93465809 AATTTTATTCTGAGCATGCAGGG - Intronic
1030188913 7:106791302-106791324 CCTTTTATTCTGGGAGAGGATGG - Intergenic
1030349237 7:108464651-108464673 CCTTTTATTCTGTGCCTGGAAGG + Intergenic
1030417268 7:109261445-109261467 CATCTTATTCTCATATTAGAGGG - Intergenic
1030648398 7:112090286-112090308 AATTATATTTTGAGATTGGGGGG + Intronic
1032462430 7:132122124-132122146 CAATTTCTTCTGAGATACGAGGG - Intergenic
1032990493 7:137389678-137389700 CATTTTCTTCTGATATTTTAGGG + Intronic
1033722872 7:144080395-144080417 CATTTTAATCTGTGATTTGGGGG - Intergenic
1035192303 7:157182039-157182061 GATTTTAATCAGTGATTGGATGG + Intronic
1035898601 8:3433097-3433119 CGTTTTATACAGAGATTGGAAGG + Intronic
1036420513 8:8591252-8591274 CATTTTTTTCTAAGGTTGAATGG - Intergenic
1038423368 8:27448472-27448494 AGTTTTATTATGAAATTGGAAGG + Intronic
1038974941 8:32684753-32684775 CATTTTATTGTGAGATAGCTAGG + Intronic
1039756970 8:40534364-40534386 AATTTTCTTCTTGGATTGGATGG - Intronic
1041264449 8:56050797-56050819 TTTCTTATTCTGAGATTGGAGGG - Intergenic
1041278921 8:56191695-56191717 CATTTAATTCAGAGTTTGGCAGG + Intronic
1041558033 8:59181502-59181524 CAATTTGTTTGGAGATTGGAGGG + Intergenic
1042363936 8:67914797-67914819 CATTTTCCTCTGGGCTTGGAAGG + Intergenic
1042809665 8:72810290-72810312 CATTTTATTTTGAGAATGAAAGG + Intronic
1043014444 8:74920702-74920724 CATTTTATTCTAAGAGTGAATGG + Intergenic
1043364919 8:79521524-79521546 AATTTCATTCTGAGACTGTATGG - Intergenic
1043683920 8:83065135-83065157 CATTTTCTTCTTAGATTGCCAGG - Intergenic
1043941873 8:86205215-86205237 CATTTTAACCTGAGATTTGAAGG - Intergenic
1044541576 8:93414081-93414103 CATTTTTTTGTGAGGTTGAAGGG - Intergenic
1045681026 8:104660237-104660259 CATTTTATGGTGACATTGAAAGG + Intronic
1045720689 8:105107090-105107112 CATATCCTTCTGAGAATGGAAGG - Intronic
1045825585 8:106394137-106394159 CATTTTATTCTAAGAGTTGGGGG + Intronic
1046314041 8:112477444-112477466 CATTTCAATATGAGATTTGAGGG - Intronic
1046409600 8:113822985-113823007 CATTTTATTTTAAAATTGGGTGG + Intergenic
1046466730 8:114614535-114614557 CATTTCAACATGAGATTGGAGGG - Intergenic
1046681390 8:117174301-117174323 TATTTTTTTCTGAAATTTGAGGG + Intronic
1046822025 8:118644228-118644250 CATTTCAATATGAGATTTGAAGG - Intergenic
1047553961 8:125908699-125908721 CATTTTGACATGAGATTGGAGGG - Intergenic
1047791678 8:128209820-128209842 CATTTCAATGTGAGATTGGAGGG + Intergenic
1048834684 8:138507551-138507573 CAGTTTCTTCTGAGTATGGAGGG + Intergenic
1049535432 8:143178438-143178460 CATTTTCTTCTCAGATTGTCAGG + Intergenic
1049581924 8:143416410-143416432 CATTTTATTTAGAGATTTGGAGG + Intergenic
1050885121 9:10754688-10754710 CATCTTATTCTGAAATGGAAGGG - Intergenic
1051057955 9:13009974-13009996 CATTTTATTCTGAGTATGCGAGG + Intergenic
1051136096 9:13923309-13923331 CTTTTTATTCTGATTTTGAAAGG + Intergenic
1051345763 9:16149587-16149609 AATTTTGTTCTGAGAGTGAAAGG - Intergenic
1052173598 9:25430609-25430631 CTTTTTGTTATGATATTGGATGG - Intergenic
1052449303 9:28607072-28607094 CTTGGTATTCTGAGATTGCAAGG + Intronic
1053945360 9:43303482-43303504 AATTTTAACATGAGATTGGAAGG - Intergenic
1054442594 9:65280613-65280635 AATTTTAACATGAGATTGGAAGG - Intergenic
1054487685 9:65740889-65740911 AATTTTAACATGAGATTGGAAGG + Intergenic
1055391299 9:75824915-75824937 TATTTTATTTTTATATTGGAAGG + Intergenic
1056453220 9:86736511-86736533 CATTTAATTTTGAGAGTGAAGGG + Intergenic
1056760945 9:89414595-89414617 CATTTTATCCTCAGTTTGCAAGG - Intronic
1056802700 9:89704153-89704175 CAATTCATTCTGAGTTTGAAAGG - Intergenic
1056850954 9:90083372-90083394 CATTTTGTTATGAGATTAGAAGG - Intergenic
1057440333 9:95078373-95078395 GATTTGATTGTGAGAATGGAGGG - Intronic
1057534311 9:95883963-95883985 CATTTTAGTCTCAAATTTGAAGG + Intronic
1059042733 9:110831279-110831301 TAATTTATTCTGAGAATGAATGG + Intergenic
1059233121 9:112739951-112739973 CATTTCAATATGAGATTGGAGGG - Intergenic
1059747013 9:117212598-117212620 CACTTTTTTATTAGATTGGAGGG - Intronic
1060257722 9:122047279-122047301 CAATTTGAGCTGAGATTGGAAGG + Intronic
1060285747 9:122250233-122250255 CAGTATGTTCTGAGATTGTATGG - Intronic
1061336695 9:129942847-129942869 TTTTTTTTTCTGAGATTGGTTGG + Intronic
1061339501 9:129967873-129967895 AATTTTTTTTTGAGATTGGGGGG + Intronic
1203580804 Un_KI270746v1:1663-1685 AATTTTAACATGAGATTGGAAGG + Intergenic
1203588495 Un_KI270747v1:32060-32082 AATTTTAACATGAGATTGGAAGG - Intergenic
1203614844 Un_KI270749v1:50665-50687 AATTTTAACATGAGATTGGAAGG + Intergenic
1203619086 Un_KI270749v1:101653-101675 CATTTTATTCTGAGACATCAAGG - Intergenic
1187321639 X:18244131-18244153 CATTTTTTTCTCTGAGTGGAGGG - Intronic
1187659663 X:21528182-21528204 CATTTTAGTAGGATATTGGATGG - Intronic
1187815796 X:23230475-23230497 TATTTTATTATGATCTTGGAAGG + Intergenic
1188203178 X:27317986-27318008 TATTTCATGCTGAGTTTGGAAGG - Intergenic
1188554994 X:31401127-31401149 CTTTAAATTCTGAGATTGCATGG + Intronic
1188849029 X:35109758-35109780 CATTTCAATATGAGATTTGAAGG + Intergenic
1190395971 X:49984241-49984263 GATTTTAGTCTGAGGTTGCATGG - Intronic
1190826735 X:54024801-54024823 AATTTTATTCTTAGATTGAACGG - Intronic
1190876438 X:54463567-54463589 GATTTTATTCTGAGTATGGTGGG - Intronic
1192047296 X:67689320-67689342 CAGATTATTCAGAGAGTGGAGGG + Intronic
1193446245 X:81607348-81607370 CATTTGCTTCTGAGTTTGTATGG + Intergenic
1194069311 X:89300222-89300244 CATTTCAATGTGAGATTGGATGG + Intergenic
1194571166 X:95555954-95555976 TATTTTATTTTTATATTGGAGGG + Intergenic
1194922163 X:99779841-99779863 AATTTCATTATGAGATTTGAGGG + Intergenic
1195134072 X:101886070-101886092 CATTTTATTCTGTTATTTCAAGG - Intronic
1195160244 X:102163700-102163722 CATTTCAACCTGAGATTTGAAGG + Intergenic
1195227714 X:102815419-102815441 GGTTTTATTCTGAGTGTGGAAGG + Intergenic
1195685275 X:107579325-107579347 CTTTTTTTTCTGAGACTTGAAGG - Intronic
1197234033 X:124038963-124038985 CATTTTTTTCTGGGGTAGGATGG + Intronic
1197492976 X:127141296-127141318 CCTTTTATTCTGATATTGTGGGG - Intergenic
1200723460 Y:6634364-6634386 CATTTCAATGTGAGATTGGATGG + Intergenic
1201902672 Y:19059400-19059422 CATTTGATTATGAGATGAGATGG - Intergenic