ID: 999654028

View in Genome Browser
Species Human (GRCh38)
Location 5:153795184-153795206
Sequence GCACCCATGGCAGCTGGACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999654014_999654028 27 Left 999654014 5:153795134-153795156 CCAAGGCTGGGTGAGCAGCCAGA 0: 1
1: 0
2: 1
3: 43
4: 293
Right 999654028 5:153795184-153795206 GCACCCATGGCAGCTGGACTTGG 0: 1
1: 0
2: 0
3: 12
4: 143
999654018_999654028 9 Left 999654018 5:153795152-153795174 CCAGAGAGCCTGTGGACAGGGAG 0: 1
1: 0
2: 2
3: 28
4: 328
Right 999654028 5:153795184-153795206 GCACCCATGGCAGCTGGACTTGG 0: 1
1: 0
2: 0
3: 12
4: 143
999654021_999654028 1 Left 999654021 5:153795160-153795182 CCTGTGGACAGGGAGGGTCCCCA 0: 1
1: 0
2: 0
3: 15
4: 194
Right 999654028 5:153795184-153795206 GCACCCATGGCAGCTGGACTTGG 0: 1
1: 0
2: 0
3: 12
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999654028 Original CRISPR GCACCCATGGCAGCTGGACT TGG Intronic
903332268 1:22602266-22602288 GCCCCCATGGGTGCTGGACCTGG - Exonic
904702309 1:32365059-32365081 GTCCCCTTGGCAGCTGCACTGGG - Intergenic
906160415 1:43644595-43644617 CCACCAATGGCAGCAGGATTTGG - Intergenic
908555830 1:65255357-65255379 GCTTCCATGGCAGGCGGACTGGG + Intronic
915570667 1:156743614-156743636 GACCCCTTGGCAGCTGGACTAGG - Intronic
917672213 1:177283538-177283560 TCACCCATGGGAGATGGAATAGG + Intergenic
919967771 1:202546055-202546077 GCAGCTATGGAAGCTGGACTGGG + Intronic
921060279 1:211579117-211579139 GCGGCCACGGCAGCTGCACTCGG + Intergenic
923026017 1:230204865-230204887 CCACCCCTAGCAGCTGGAATGGG - Intronic
1067220429 10:44340163-44340185 CTTCCCATGGCAGGTGGACTTGG - Intergenic
1069633277 10:69910494-69910516 CCACCCCCAGCAGCTGGACTGGG + Intronic
1070255923 10:74813299-74813321 GCACCCAAGGCCCCTGGACTTGG - Intergenic
1070855153 10:79602890-79602912 GCACCCAGGGCAGCTGGAAAAGG + Intergenic
1071598816 10:86946313-86946335 GCTGCCAGGGCAGCTGGAATGGG - Intronic
1072896022 10:99367451-99367473 GAACCCAGGGTAGCTGGAATAGG + Intronic
1076491765 10:130866625-130866647 GCACCCAGGGCAACTGAGCTGGG - Intergenic
1077517162 11:3008941-3008963 TCACCCATGGCGGGTGGGCTGGG - Intronic
1077773845 11:5249797-5249819 TGACCCATGGCGTCTGGACTAGG + Exonic
1077774348 11:5254721-5254743 TGACCCATGGCGTCTGGACTAGG + Exonic
1079760453 11:24323121-24323143 GCTCTCATGTCAGATGGACTGGG - Intergenic
1083288532 11:61676678-61676700 GCACCTCTGGTAGCTGGACCAGG + Intergenic
1084694977 11:70747431-70747453 GCCCCCATGGCTCCTGGCCTGGG - Intronic
1085310502 11:75513889-75513911 GCTCCCATGGCACCTGGGCCAGG - Intronic
1085405323 11:76258192-76258214 GCTCACATGACAGATGGACTAGG + Intergenic
1089665239 11:120013952-120013974 GTACCCAGGGCAGCCGGAGTGGG + Intergenic
1091916756 12:4275421-4275443 GCAGCCTCGGCAGCTGGAGTCGG - Intronic
1092166418 12:6345482-6345504 GAACCCACGTCATCTGGACTTGG - Intergenic
1094497037 12:30995019-30995041 GCACCCATGGCACATGGGCCGGG + Exonic
1098848266 12:75564535-75564557 GACCCCATGGCAGCTGCCCTTGG + Intergenic
1102206357 12:111093604-111093626 TCACCCAGGGCAGCAGGGCTGGG + Intronic
1103694037 12:122799710-122799732 GGAACCATGGAGGCTGGACTGGG + Intronic
1105583959 13:21726711-21726733 GGCCCCATGGAAACTGGACTTGG + Intergenic
1105865994 13:24460362-24460384 GCCCCCTTGGCAGCGGAACTGGG + Intronic
1106268167 13:28128436-28128458 TCACCCAGGGCAGCTTGTCTGGG - Intergenic
1113702706 13:112399202-112399224 TCTCCCATTACAGCTGGACTTGG - Intronic
1119804521 14:77474305-77474327 ACACCCATGGGAGTTTGACTTGG + Intergenic
1121337350 14:93085457-93085479 GCACCCCTGGAAGCTGTTCTGGG - Intronic
1121377729 14:93430116-93430138 GCAGCCATCCCAGCTGGACAGGG - Intronic
1122113080 14:99515086-99515108 GGACCCATGGCAGCTGGGCCAGG + Exonic
1123012170 14:105354775-105354797 ACAGCCATGGCAGGTGGACAAGG - Intronic
1124212106 15:27771507-27771529 GCAGCCACCTCAGCTGGACTCGG - Intronic
1124995113 15:34716280-34716302 GCAGTCCTGGCAGCTGGACAGGG - Intergenic
1125908367 15:43414565-43414587 GAACCCATAGCAGCTGGGCCTGG + Intronic
1128222609 15:65979786-65979808 CCAACCATGGCAGCTGGGCAGGG + Intronic
1129330403 15:74824164-74824186 GCAGCCATGGGAGCTGGGGTGGG + Intronic
1131345961 15:91648219-91648241 GCATCTATGGAAGGTGGACTTGG + Intergenic
1136233643 16:28902226-28902248 TCACCCATAGCAGCTGCACCGGG - Exonic
1136568595 16:31084018-31084040 CTACCCAAGGCAGCTGGAGTGGG + Exonic
1137451167 16:48575825-48575847 ACCCCCATGGTAGCTGGTCTTGG - Intronic
1137490606 16:48928994-48929016 GCACCTCTGTCAGCTGTACTGGG + Intergenic
1137591943 16:49699165-49699187 GCACCCAGGGGAGCTGGGCGAGG + Intronic
1139902619 16:70340246-70340268 GCACACATGGCACTTGCACTTGG + Intronic
1140018826 16:71216858-71216880 CCACCCATGGAGTCTGGACTTGG - Intronic
1140063906 16:71593831-71593853 GCAACCAGGGCAGGTTGACTTGG - Intergenic
1141140384 16:81493261-81493283 GCAGCAGTGGGAGCTGGACTGGG + Intronic
1142254977 16:89009338-89009360 GGACCCATGACACCTGGCCTTGG + Intergenic
1143010987 17:3866083-3866105 GCCCCCTTGGCAGCTGCTCTCGG - Intronic
1144340273 17:14304145-14304167 CCACGCATGGCGGCTGGACCCGG + Intronic
1147187773 17:38722040-38722062 GCACCCGGGGCAGCGGGGCTGGG + Exonic
1148109419 17:45136374-45136396 CCACCCAGGGCATCTGGACTAGG - Intronic
1150566879 17:66349872-66349894 GGAGCCATGGCTGCTGGAATTGG + Intronic
1151665397 17:75542694-75542716 GCGCACAGGGAAGCTGGACTGGG + Intronic
1151940009 17:77286488-77286510 GCTCCCATGTCACCTGGACCTGG - Intronic
1151995963 17:77609449-77609471 TCACCCATGGCAGATGGAATGGG + Intergenic
1152738429 17:82008643-82008665 GCAGCGGGGGCAGCTGGACTGGG + Intronic
1152926681 17:83090599-83090621 GCAGCCATGGCAGCTGGGGCTGG - Intronic
1154965100 18:21348346-21348368 GTACCCATAGCAGCTGGGCATGG + Intronic
1156481893 18:37441572-37441594 GTCCCCATGGGGGCTGGACTAGG - Intronic
1160583394 18:79900172-79900194 GCCCCCATGGCATCCGGAATGGG + Intronic
1160965399 19:1745046-1745068 GCACCCTTGGCGGATGGACTGGG + Intergenic
1161089629 19:2353384-2353406 GCAGCCGGGGCAGCTGGGCTGGG - Exonic
1162430904 19:10627841-10627863 GCAGCCATGGCCTCTGGAGTGGG + Intronic
1163122799 19:15228029-15228051 GCAGCCAGGGCAGCTGGAACAGG + Exonic
1164144484 19:22503549-22503571 GCACCCATGCCCCCTGGGCTTGG + Intronic
1164449916 19:28351793-28351815 GCAGCTATGTCAGCTGGGCTCGG - Intergenic
1165996834 19:39849575-39849597 GCACCCCTGGCAGCTGAATGTGG + Intergenic
1166998354 19:46730483-46730505 GCACCTGTGGCAGATGGCCTCGG - Intronic
1167041674 19:47026484-47026506 CCAGCCAGGGCAGCTAGACTGGG + Intronic
1168623862 19:57901124-57901146 GCAGCCATGGCTGCTGGGCGCGG - Intronic
1168712422 19:58509522-58509544 GCCCCAAGGGCAGCTGGAGTAGG - Intronic
926018783 2:9476312-9476334 GCAGTCATAGCAGCTGGACTTGG - Intronic
926222269 2:10944006-10944028 GCACCCAAGGCAGATTAACTAGG - Intergenic
928689640 2:33786204-33786226 GCAGGCATGGAAGCTGCACTTGG - Intergenic
932815899 2:74861462-74861484 GCACCCATGGTGTCTGTACTAGG + Intronic
934524778 2:95044986-95045008 GCACAGATGGCAGCTGGAAATGG - Intronic
940415548 2:153415277-153415299 GGAGCCATGGTAGCTGGATTTGG + Intergenic
944483829 2:200182549-200182571 GCAGCCATGGGAGCTGGAAAAGG - Intergenic
946693100 2:222324617-222324639 GCACCAATGGCTTCTGGAATAGG - Intergenic
947866458 2:233401005-233401027 AGACCCAAGGCAGCAGGACTGGG + Intronic
1169985599 20:11440565-11440587 GCTCACATGGCAGCTGGCCAGGG + Intergenic
1173579070 20:44133142-44133164 GCTCCCATGGCTGCTGGTCCTGG + Intronic
1175423457 20:58850483-58850505 GCACCCATGGCAGCCTCCCTGGG + Intronic
1178117423 21:29431747-29431769 ACATTCATGGCAGCTGGAGTGGG + Intronic
1179059498 21:37966462-37966484 CCGCCCACGGCAGCTGAACTGGG + Intronic
1180129810 21:45820246-45820268 ACTGCCATGGCAGCCGGACTGGG - Intronic
1181475845 22:23167357-23167379 TCAACCATGGCTGCTGGGCTGGG - Intergenic
1184673529 22:46027963-46027985 GCACCCACGGCAGCCGGAGAGGG - Intergenic
950551923 3:13671250-13671272 GCATCTATGGTAGGTGGACTGGG + Intergenic
954765111 3:52908360-52908382 TCACACATGGCTGCTGGACGTGG - Intronic
958774176 3:98461513-98461535 TCAGCCATGGCAGATGGACACGG - Intergenic
959865816 3:111268705-111268727 TCACTCATGGCAGCATGACTAGG - Intronic
961379486 3:126487758-126487780 GCTCCCAGGGCAGCTGGGCTGGG - Intronic
961810939 3:129521311-129521333 CCACCTCTGGCAGGTGGACTGGG - Intergenic
962774952 3:138650198-138650220 GCACCCAGCCCAGCTGGAATTGG - Intergenic
964068761 3:152606949-152606971 GCACCCTTGGCATTTGCACTGGG + Intergenic
964275355 3:155003814-155003836 GCACCCAAGTCAGCTGGGCACGG - Intergenic
969832531 4:9809293-9809315 GCAACCAACGCAGCTGGGCTGGG - Intronic
970186721 4:13462896-13462918 TCACCCATGGCAGTTGGAGGTGG - Intronic
976735673 4:88306380-88306402 GGTTCCATGGCAGATGGACTTGG + Intergenic
979565840 4:122152915-122152937 GCAGCCTTGCCAGCTGCACTGGG + Intronic
984766473 4:183404155-183404177 GGCCCCAGGGCAGCTGCACTGGG - Intergenic
992408726 5:76484307-76484329 TCTGCAATGGCAGCTGGACTAGG - Intronic
992669959 5:79049444-79049466 GCACTCATTTCAGATGGACTTGG - Intronic
993032198 5:82717673-82717695 GAACCCATGCCAACTGTACTTGG + Intergenic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999654028 5:153795184-153795206 GCACCCATGGCAGCTGGACTTGG + Intronic
999744976 5:154584982-154585004 GCACAAAAGGCATCTGGACTGGG - Intergenic
1001523561 5:172413067-172413089 GCAGCCATTGAGGCTGGACTTGG + Intronic
1002427035 5:179182562-179182584 GCACCGATGCCAGCGGGCCTCGG - Intronic
1004319370 6:14620803-14620825 GGAGCCGTGGCAGCTGGACGAGG - Intergenic
1005948652 6:30614764-30614786 TCACCCCTGGCAGCTGAAGTGGG + Intronic
1006419434 6:33924097-33924119 GTACCCCTGGCACCTGGACAAGG + Intergenic
1007274539 6:40663635-40663657 GCCCCCCAGGCAGCTCGACTGGG - Intergenic
1007467633 6:42065714-42065736 GCTCCCATGACAGATGGTCTCGG - Intronic
1007702812 6:43774353-43774375 GCACCCATGGCAGAAGGAGGAGG + Exonic
1008436839 6:51486023-51486045 GCACCCACTGCAGCTCAACTAGG - Intergenic
1019359837 7:599032-599054 GGACCCAGGGAAGCTGGACCAGG + Intronic
1020070484 7:5223820-5223842 GCACCCAAGCCAGAGGGACTCGG + Intronic
1023870054 7:44258505-44258527 GCCCTCATCCCAGCTGGACTGGG - Intronic
1023949298 7:44829241-44829263 GCAGTTATAGCAGCTGGACTGGG + Intronic
1024425137 7:49216369-49216391 GCACCCCTGGCTCCAGGACTTGG + Intergenic
1024852809 7:53741156-53741178 GCACATATGTCAGCTGGAGTGGG - Intergenic
1027448387 7:78301128-78301150 GCACCCATGGAAGCATGACATGG - Intronic
1031198746 7:118650330-118650352 GCCCCCTTGGTAGCTGCACTTGG + Intergenic
1032020494 7:128405111-128405133 GCACGCAGGGCAACTGGCCTAGG + Intronic
1032114318 7:129103900-129103922 GACCCCATGGCAGCTGGCCGTGG + Intergenic
1033737192 7:144234178-144234200 GCTCCAATGACAGCTGGACCAGG - Intergenic
1033745865 7:144316768-144316790 GCTCCAATGACAGCTGGACCAGG + Intergenic
1034529668 7:151687931-151687953 ACACCCTTGGCAGCTGGCCGAGG - Intronic
1035083177 7:156234655-156234677 GCTCCCATGGCAGATGTGCTGGG + Intergenic
1037743584 8:21626365-21626387 GCACCTTTGGGAGCTGGCCTTGG + Intergenic
1038456804 8:27677310-27677332 GCTGCCAAGGCAGCTGGAATTGG + Intergenic
1040724992 8:50371389-50371411 GAAGCCATGGTAGCTGGAATGGG - Intronic
1042228781 8:66536523-66536545 GGACCCAGGGGAGCTGGGCTTGG + Intergenic
1042943560 8:74132046-74132068 GTATCCATGGCAGGTGGAGTTGG - Intergenic
1047495893 8:125408443-125408465 GGATCCATGGCAGCTGCACTTGG + Intergenic
1049510040 8:143022709-143022731 GCACCCAGGGCCGTAGGACTTGG + Intronic
1056758431 9:89397432-89397454 ACTCCCATGGGGGCTGGACTGGG - Intronic
1061495840 9:130973744-130973766 GCACCCATGACAGCTGGGGCAGG - Intergenic
1061757459 9:132824990-132825012 GTACCCATGGCAGGTGGTTTGGG - Intronic
1061819380 9:133217652-133217674 CCACCCAAGGCAGGTGGGCTGGG - Intergenic
1189963755 X:46350710-46350732 GGACCCATGGGAGCTGCACCTGG + Intergenic
1190997396 X:55623762-55623784 GGTCCCAGGGCTGCTGGACTGGG + Exonic
1195694299 X:107655353-107655375 GCACCCAGGGCAACAGGACTGGG + Intergenic
1196566434 X:117210368-117210390 GCACCCATGGACTCAGGACTCGG + Intergenic
1201459515 Y:14206681-14206703 GCACCCATGGCAGCTCAGCAAGG + Intergenic