ID: 999654520

View in Genome Browser
Species Human (GRCh38)
Location 5:153799086-153799108
Sequence AAAGCTAGGCAGCTTGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999654520_999654529 13 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654529 5:153799122-153799144 TGCTATGGAATAGGAGAATGGGG 0: 1
1: 0
2: 1
3: 12
4: 221
999654520_999654532 25 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654532 5:153799134-153799156 GGAGAATGGGGTACCCTGAGGGG 0: 1
1: 0
2: 1
3: 35
4: 244
999654520_999654525 -2 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654525 5:153799107-153799129 TTTCTGGTGTGCAGCTGCTATGG No data
999654520_999654530 23 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654530 5:153799132-153799154 TAGGAGAATGGGGTACCCTGAGG 0: 1
1: 0
2: 0
3: 14
4: 158
999654520_999654528 12 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654528 5:153799121-153799143 CTGCTATGGAATAGGAGAATGGG 0: 1
1: 0
2: 1
3: 10
4: 169
999654520_999654526 4 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654526 5:153799113-153799135 GTGTGCAGCTGCTATGGAATAGG 0: 1
1: 0
2: 1
3: 8
4: 143
999654520_999654531 24 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654531 5:153799133-153799155 AGGAGAATGGGGTACCCTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 205
999654520_999654527 11 Left 999654520 5:153799086-153799108 CCCCTGACAAGCTGCCTAGCTTT 0: 1
1: 0
2: 1
3: 11
4: 208
Right 999654527 5:153799120-153799142 GCTGCTATGGAATAGGAGAATGG 0: 1
1: 0
2: 0
3: 15
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999654520 Original CRISPR AAAGCTAGGCAGCTTGTCAG GGG (reversed) Intronic