ID: 999657489

View in Genome Browser
Species Human (GRCh38)
Location 5:153825059-153825081
Sequence GAGCAAATGAACGCGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999657489_999657491 16 Left 999657489 5:153825059-153825081 CCTGCAGGCGCGTTCATTTGCTC No data
Right 999657491 5:153825098-153825120 ACAGCTTTCTCCTGTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999657489 Original CRISPR GAGCAAATGAACGCGCCTGC AGG (reversed) Intergenic
No off target data available for this crispr