ID: 999661916

View in Genome Browser
Species Human (GRCh38)
Location 5:153873650-153873672
Sequence CTGTGATTCTGGAGAGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999661913_999661916 15 Left 999661913 5:153873612-153873634 CCAATGTATAGCAATCAATGCAG No data
Right 999661916 5:153873650-153873672 CTGTGATTCTGGAGAGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999661916 Original CRISPR CTGTGATTCTGGAGAGATTC TGG Intergenic
No off target data available for this crispr