ID: 999665071

View in Genome Browser
Species Human (GRCh38)
Location 5:153904427-153904449
Sequence GCTAGGTGAACAGCCCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999665065_999665071 21 Left 999665065 5:153904383-153904405 CCTGCTTGACAAACAAGCAGCAG No data
Right 999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG No data
999665068_999665071 -5 Left 999665068 5:153904409-153904431 CCATTGCAGTAAGACTCAGCTAG No data
Right 999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG No data
999665066_999665071 -3 Left 999665066 5:153904407-153904429 CCCCATTGCAGTAAGACTCAGCT No data
Right 999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG No data
999665067_999665071 -4 Left 999665067 5:153904408-153904430 CCCATTGCAGTAAGACTCAGCTA No data
Right 999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG No data
999665064_999665071 22 Left 999665064 5:153904382-153904404 CCCTGCTTGACAAACAAGCAGCA No data
Right 999665071 5:153904427-153904449 GCTAGGTGAACAGCCCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999665071 Original CRISPR GCTAGGTGAACAGCCCTTCT GGG Intergenic
No off target data available for this crispr