ID: 999666368

View in Genome Browser
Species Human (GRCh38)
Location 5:153917232-153917254
Sequence ACTATCCAAGGCCCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999666365_999666368 -4 Left 999666365 5:153917213-153917235 CCTTATCCGGGCTATCTGGACTA No data
Right 999666368 5:153917232-153917254 ACTATCCAAGGCCCACAAGCTGG No data
999666366_999666368 -10 Left 999666366 5:153917219-153917241 CCGGGCTATCTGGACTATCCAAG No data
Right 999666368 5:153917232-153917254 ACTATCCAAGGCCCACAAGCTGG No data
999666363_999666368 0 Left 999666363 5:153917209-153917231 CCTTCCTTATCCGGGCTATCTGG No data
Right 999666368 5:153917232-153917254 ACTATCCAAGGCCCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999666368 Original CRISPR ACTATCCAAGGCCCACAAGC TGG Intergenic