ID: 999675724

View in Genome Browser
Species Human (GRCh38)
Location 5:154000213-154000235
Sequence GGGTGGGGATGAAGAGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1679
Summary {0: 1, 1: 3, 2: 29, 3: 237, 4: 1409}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999675718_999675724 7 Left 999675718 5:154000183-154000205 CCAGAAATGGGGAAAGGTGGGTG 0: 1
1: 0
2: 1
3: 41
4: 245
Right 999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG 0: 1
1: 3
2: 29
3: 237
4: 1409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999675724 Original CRISPR GGGTGGGGATGAAGAGAAGT TGG Intronic
900088218 1:908661-908683 GGGAGGGGATGAGGGGAAGGTGG + Intergenic
900115397 1:1025863-1025885 GGGTTGGGATGGACAGAGGTGGG - Intronic
901011697 1:6206084-6206106 GGGTGGGAGTGAGGAGAGGTAGG + Intronic
901262385 1:7883386-7883408 GGGAGGGGGTGAAGAGAGGTTGG + Intergenic
901835423 1:11921052-11921074 GGGAGGGGAGGAAGAGTAGAGGG + Intronic
901916706 1:12505784-12505806 GGGATGGGATCTAGAGAAGTTGG + Intronic
902104252 1:14020405-14020427 GGATGGGGGTGAAGTGAAATGGG - Intergenic
902128046 1:14233907-14233929 TGGAGGGGATGTAGAGAAATAGG + Intergenic
902209345 1:14893535-14893557 GGGTGTGGAGGAAGGGAAGATGG - Intronic
902323246 1:15683332-15683354 GGAAGGGGAGGAAGATAAGTGGG + Intergenic
902659861 1:17893446-17893468 GGGAGGGGATGAGGAGAAAAGGG - Intergenic
902671748 1:17979561-17979583 GGGGTGGGATGGAGGGAAGTAGG - Intergenic
902787281 1:18740996-18741018 GGAGGGAGATGAAGAGAGGTTGG + Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
903225762 1:21893472-21893494 GGTTGGGGAGGAAGAGAACAGGG + Intronic
903537379 1:24076082-24076104 GGGTGGAGTTCAAGGGAAGTTGG - Intronic
903549661 1:24149181-24149203 GTGTGGGGATGGAGGGAGGTGGG + Intergenic
903852326 1:26315580-26315602 GGGCGGGGAGGGAGAGAAGAGGG - Intronic
904048425 1:27623368-27623390 TGGTGGGGAAGAGGAGGAGTGGG - Intronic
904209380 1:28876423-28876445 AGGGGAGGATGAAGAGAACTGGG + Intergenic
904309385 1:29617949-29617971 GGGTGGTGATGAAGAAAGGTTGG + Intergenic
904831218 1:33307696-33307718 AGGTGGGGATGGAGTGAGGTTGG - Intronic
904848105 1:33435931-33435953 GGGAGGGAATGAAGAGAAAGGGG + Intergenic
904861918 1:33544673-33544695 GGGGGAGGATGAAGAGAAGTGGG + Intronic
905188475 1:36214411-36214433 CAGTGGGGATGAAGAAAAGTGGG - Intergenic
905246715 1:36620108-36620130 GGATGGGGATCAAGAGATCTGGG - Intergenic
905894855 1:41538938-41538960 GGGTGGGGAAGCCGAGCAGTGGG + Intronic
906466350 1:46083788-46083810 TGGTGAGGATGTAGAGAAATTGG + Intronic
906522379 1:46475080-46475102 GTCTGGGGAGGAAGAGGAGTAGG + Intergenic
907000050 1:50843514-50843536 AGCGGGGGATGAAGAGAGGTTGG - Intronic
907310387 1:53535656-53535678 GGGTGGATAAGAAGAGAAGGGGG - Intronic
907334629 1:53692134-53692156 AGGTGGGGAAAAAGAGAGGTTGG - Intronic
907347070 1:53791015-53791037 GGAGGAGGATGGAGAGAAGTAGG - Intronic
907672745 1:56491267-56491289 GGGGGGAAATGAAGAGAAGTTGG - Intergenic
908427898 1:64026134-64026156 GAGTGAGAATGAAGACAAGTTGG - Intronic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909101247 1:71352174-71352196 AGGAGGGGATGAAGAGAGGTTGG - Intergenic
909405020 1:75279178-75279200 AGGGAGAGATGAAGAGAAGTTGG - Intronic
909432331 1:75603622-75603644 GGGTGAGGCTGCAGAGAAATGGG - Intronic
909506427 1:76395828-76395850 GGCTGGGGATGAAGAGAGGCTGG + Intronic
909519559 1:76551806-76551828 GGAGGGGTATGAAGAGAGGTTGG - Intronic
909574079 1:77153360-77153382 GGAGGAGAATGAAGAGAAGTTGG + Intronic
909594200 1:77386813-77386835 AGGGGAGGATGAAGAGAAATAGG - Intronic
909705506 1:78579022-78579044 GGGTGGGAATAAAGAAATGTAGG - Intergenic
909779048 1:79519989-79520011 GGGAGGGGGGGAAGAGAAGAAGG + Intergenic
909814821 1:79978579-79978601 TGGTGGTGAAGAAGAGAGGTGGG - Intergenic
909991899 1:82233930-82233952 GGGTGGGGAGGGAGAGCATTAGG - Intergenic
910020821 1:82587376-82587398 GGGATAGGATGAAGAGAAGAGGG - Intergenic
910024830 1:82637651-82637673 GGGTGGGAAGGGAAAGAAGTGGG + Intergenic
910045653 1:82911111-82911133 GGGGAAGGATGAGGAGAAGTTGG - Intergenic
910124889 1:83829664-83829686 GGGGGTGGGTGTAGAGAAGTAGG - Intergenic
910128576 1:83874607-83874629 GGATGTGGATGTGGAGAAGTTGG - Intronic
910409975 1:86932306-86932328 TGGGGAGAATGAAGAGAAGTGGG + Intronic
910473526 1:87580596-87580618 GGGTGGGGAGGGGGAGGAGTGGG + Intergenic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910710951 1:90179861-90179883 GGATGGGGAGGCAGAGAAGAAGG - Intergenic
910974189 1:92888666-92888688 TGGTGAGGATGTGGAGAAGTAGG - Intronic
911082435 1:93946775-93946797 GGGGTGGAATGAAGAGAGGTTGG - Intergenic
911113083 1:94212686-94212708 AGGTAGGGATGAAGATAAGATGG - Intronic
911238583 1:95439389-95439411 AGGGAAGGATGAAGAGAAGTTGG - Intergenic
911509859 1:98798428-98798450 GGGAAGGGATAAAAAGAAGTTGG - Intergenic
911613484 1:99983210-99983232 GGAGTGGAATGAAGAGAAGTTGG + Intronic
911688930 1:100809102-100809124 CAGTGGGGATGCAGAGCAGTGGG + Intergenic
911854746 1:102862176-102862198 GGGAGGGAATTAAGAGAGGTTGG - Intergenic
911970684 1:104431811-104431833 AGGGGAGGATAAAGAGAAGTAGG + Intergenic
911993194 1:104729129-104729151 GGGGAAGGATGAAGAGAAGTGGG - Intergenic
912200726 1:107454906-107454928 GGGTGGAGAGGAAGAGAGCTGGG - Intronic
912231634 1:107799825-107799847 AGGGAGGGATGAAGAGAAGTTGG - Intronic
912232656 1:107813736-107813758 GGTGGGGGTTGAAGAGAGGTTGG - Intronic
912580796 1:110719243-110719265 GAATGGAGATGAAGAGAACTGGG + Intergenic
912592583 1:110840341-110840363 TGGTGAGAATGTAGAGAAGTTGG + Intergenic
912639015 1:111326279-111326301 GGTGGGGGATGAAGAGAGATAGG - Intergenic
912699244 1:111864167-111864189 GGATGGGGAAGAAGAGAAGAAGG + Intronic
912870068 1:113295547-113295569 GGGTTGGGGTGAAGAGACATTGG + Intergenic
913223870 1:116681394-116681416 GGGTGGGGATGAGATGGAGTGGG + Intergenic
913429475 1:118775101-118775123 TGGTGAGGATGAAGAGAACTTGG - Intergenic
913462366 1:119101073-119101095 AGGGGAGGATGAAGAGAAGTGGG + Intronic
913593848 1:120354692-120354714 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
913645625 1:120851246-120851268 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914081087 1:144412280-144412302 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914093407 1:144524294-144524316 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914096278 1:144546810-144546832 GGGTGGGGCGGAAGAGCAGAAGG - Intergenic
914176002 1:145280814-145280836 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914213624 1:145604797-145604819 GGGTGGGGTTGGAGAGATGTTGG + Intergenic
914218911 1:145659568-145659590 TGGTGGGGATGTGGAGAAATTGG - Intronic
914221350 1:145684780-145684802 GGGTGGGGATGAAGAGAGCTAGG - Intronic
914302238 1:146387153-146387175 GGGTGGGGCGGAAGAGCAGAAGG + Intergenic
914305121 1:146409608-146409630 GGGTGGGGCGGAAGAGCAGACGG + Intergenic
914448946 1:147773677-147773699 GGGTGGGCAGGAAGAGACTTAGG - Intergenic
914471494 1:147982443-147982465 TGGTGGGGATGTGGAGAAATTGG - Intronic
914473916 1:148007647-148007669 GGGTGGGGATGAAGAGAGCTAGG - Intergenic
914596937 1:149163217-149163239 GGGTGGGGCGGAAGAGCAGACGG - Intergenic
914985905 1:152457077-152457099 GGCTGGGGGTGAAGAGTGGTGGG - Intergenic
915105076 1:153529169-153529191 GGGGGAGGATAAAGAGAAGTTGG + Intergenic
915551525 1:156638195-156638217 GGGAGGGGATGTGGAGCAGTAGG - Intergenic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915611252 1:156995084-156995106 GAGAGGGGGAGAAGAGAAGTAGG - Intronic
915850644 1:159318279-159318301 GGTTGTGGATGAAGAGAGGTTGG + Intergenic
915858298 1:159414221-159414243 GGGTGGTGATGAAGAGAAGTTGG - Intergenic
915975258 1:160381875-160381897 GGGGGGTGATAAAGAGAATTAGG - Intergenic
916021937 1:160800314-160800336 GGGGGATGATGAAGAGAAGTGGG - Intronic
916070736 1:161168232-161168254 GGTGGGGTATGAAGAGAAGAGGG - Intronic
916478490 1:165193135-165193157 GTAGGGGAATGAAGAGAAGTTGG + Intergenic
916492630 1:165315349-165315371 GGGTAGAGATGAAAGGAAGTAGG - Intronic
916522467 1:165577068-165577090 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
916881662 1:169024689-169024711 GGGAGGGGAGGAAGAGGAGGAGG + Intergenic
917049320 1:170901034-170901056 GGGTGGGGGTGCAGGGGAGTGGG + Intergenic
917261037 1:173169753-173169775 CAGTGGGGATGAAGAGAGGTTGG + Intergenic
918031307 1:180814894-180814916 GGGTGGGGATGGAGTGTAGAAGG + Intronic
918136924 1:181681945-181681967 AAGTGTGGCTGAAGAGAAGTAGG - Intronic
918343200 1:183584006-183584028 TAGTGGGGATGGAGAGAAATAGG + Intronic
918492279 1:185094050-185094072 GAGTAAGAATGAAGAGAAGTAGG - Intronic
918735607 1:188058914-188058936 AGGAGGGGATAAAGAGAGGTTGG - Intergenic
918758727 1:188373509-188373531 GGGAGAGGATGTAGAGAAATAGG + Intergenic
918974053 1:191457666-191457688 GGGAAGGGATAAAGAGAGGTTGG + Intergenic
919034507 1:192289300-192289322 GGGTGGGAATGAATAGGAGTTGG + Intergenic
919051178 1:192513349-192513371 CTGTGTGGATGTAGAGAAGTAGG + Intergenic
919066990 1:192704792-192704814 GTAGGAGGATGAAGAGAAGTTGG - Intergenic
919144741 1:193619859-193619881 TGGTGAGGATGAGGAGAAGAGGG + Intergenic
919157302 1:193782605-193782627 GGCAGGGGATGAAGGGAGGTTGG + Intergenic
919314293 1:195952004-195952026 TGGTGGGGCAGAAGCGAAGTGGG - Intergenic
919569016 1:199222385-199222407 TGGTGGGGAGGAAGAGCAGTAGG + Intergenic
919595745 1:199559991-199560013 GTGGGGGGATGGAGAGAGGTTGG + Intergenic
919744727 1:201001362-201001384 GGCAGAAGATGAAGAGAAGTAGG + Intronic
920010371 1:202862591-202862613 AAGTGGGGATGAAGAGGAGATGG - Intergenic
920135640 1:203767253-203767275 GGGAGGGGTTGCAGAGATGTTGG - Intronic
920274032 1:204790574-204790596 CAGTGGGGATGAAGGGAACTAGG - Intergenic
920626087 1:207601550-207601572 TGGTGAGGATGTAGAGAAATTGG - Intronic
920877152 1:209847367-209847389 GAGTGGGGATAGAGAGAAGATGG - Intronic
921088691 1:211821687-211821709 GGGTGAGGAAGAAGAGAAAGGGG + Intronic
921149234 1:212386476-212386498 GGGCAGGGATGAGGAGAAGCAGG - Intronic
921848293 1:219907090-219907112 GGGTGGGGACGAGGTGAAGGTGG - Intronic
921956220 1:220985728-220985750 TGGTGAGGATGAAGAGAAACTGG - Intergenic
922028275 1:221773733-221773755 TGGTGGGGATGAGGAGAAAGGGG + Intergenic
922082163 1:222308047-222308069 GGGTGGGGATGGTGAGGAGGAGG - Intergenic
922318035 1:224459610-224459632 GGGTGGGGGTGGAGTGAAGCTGG + Intronic
922373164 1:224931554-224931576 GTGGGAGGATGAACAGAAGTGGG - Intronic
922443301 1:225675405-225675427 GGGTGAGGATTTAGAGAAATTGG + Intergenic
922520356 1:226245351-226245373 TGGTGAGGATGTAGACAAGTAGG - Intronic
922554396 1:226521870-226521892 GAGGGGGTATGAAGAGAAGGTGG - Intergenic
922660833 1:227429153-227429175 GGGAGGGGATGGGGAGAGGTGGG - Intergenic
922710778 1:227829269-227829291 TGGTGAGGATGAAGAGAAAAGGG - Intronic
922859509 1:228804161-228804183 AGGGGAGGATGAAGAGAACTTGG - Intergenic
922907754 1:229187711-229187733 CTGTAGGGATGAAGAGAAGTAGG - Intergenic
923007464 1:230062964-230062986 TGGTGAGGATGTAGAGAAATTGG - Intronic
923024944 1:230196701-230196723 GGGATGGGATGAGGAGAAGCGGG - Intronic
923072392 1:230577740-230577762 GGAGGGGGAGGAAGAGAAGGAGG - Intergenic
923090611 1:230737886-230737908 GGCTGGGGATGGGGTGAAGTGGG - Intergenic
923105114 1:230848418-230848440 GGAAGGGGATGAAGAGAGGTTGG + Intronic
923130479 1:231070531-231070553 GAAGGGGGATGAAGAGACGTTGG + Intergenic
923465526 1:234245094-234245116 GGGTAGGAGTGAAGTGAAGTTGG - Intronic
923515932 1:234698131-234698153 GTTTGGTGATGAAGAGAAGGAGG - Intergenic
923628421 1:235633268-235633290 GGCTGGGGATGGAGACAAGCAGG + Intronic
923684762 1:236146372-236146394 GGGTGGGGAGGAAGAGAGGATGG + Intronic
923964515 1:239122390-239122412 TGGTAGGAATGAAGAGAAGCTGG + Intergenic
924088118 1:240475210-240475232 GGGTGGGGAATAAGAGAAGGAGG + Intergenic
924257386 1:242195935-242195957 GTGAGGGGCTGAAGAGAAGAGGG + Intronic
924287273 1:242500675-242500697 GGGAAGGGAAGAAGAGAAGAAGG + Intronic
924484744 1:244470521-244470543 TCGTGGGGATGTAGAGAAATGGG + Intronic
924487492 1:244499977-244499999 TGGTGAGGATGCAGAGAAATAGG - Intronic
924488071 1:244506889-244506911 GGGTGGTGGTGAAGAGAGGCTGG - Intronic
924543026 1:244999102-244999124 GGGAGGGGAAGAATAGAAGGAGG + Intronic
1062894873 10:1095546-1095568 GGGTGGCAGTGAAGAGAAGGTGG + Intronic
1062957925 10:1552388-1552410 GAGAGTGGGTGAAGAGAAGTGGG + Intronic
1063267387 10:4468867-4468889 GTGTGGGAATGAAGAGCTGTTGG - Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063848577 10:10160173-10160195 GGGAGGGGAAGAAGAGGAATTGG + Intergenic
1064305135 10:14158674-14158696 GGAGGAGGAGGAAGAGAAGTAGG + Intronic
1064334949 10:14431233-14431255 AGGAGATGATGAAGAGAAGTTGG + Intronic
1064787167 10:18910883-18910905 GGTTGGGGATAAAGAGGATTGGG + Intergenic
1065021039 10:21501567-21501589 GGGTGGGGAGGAAGAGGAGCAGG + Intergenic
1065501787 10:26390530-26390552 CGGAGGGGATGAAGAGAGGTTGG + Intergenic
1065617998 10:27548560-27548582 GCAAGAGGATGAAGAGAAGTTGG + Intergenic
1065728512 10:28690053-28690075 GGAGGGGGATGAAGAGAGCTTGG - Intergenic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065994542 10:31045206-31045228 TGGGAGGGATGAAGAGAGGTTGG - Intergenic
1066006265 10:31148835-31148857 GGGAGAGGTTGAAGAGAAGTGGG + Intergenic
1066426165 10:35309400-35309422 AGGTGGAGAGGAAGAGCAGTGGG + Intronic
1066658215 10:37713842-37713864 GGCTGGGGAGGGAGGGAAGTGGG - Intergenic
1067092620 10:43276630-43276652 GGGTGGGGCTGGGGAGATGTTGG - Intergenic
1067297086 10:44980745-44980767 GGGTGGGGCTGGAGGGCAGTGGG + Intronic
1067688471 10:48482911-48482933 AGAGGGGGATGAAGAGAGGTTGG - Intronic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1068049094 10:51926554-51926576 GGGTGGGGAAGCAAAGAGGTGGG - Intronic
1068152138 10:53146019-53146041 TGGTGAGGATGTAGAGAAATAGG - Intergenic
1068295502 10:55067220-55067242 TTGTGGGGATGAAGGGAGGTTGG - Intronic
1068484814 10:57644249-57644271 GGGAGGTGATGAAGACAGGTGGG + Intergenic
1068519887 10:58066467-58066489 CAGGTGGGATGAAGAGAAGTGGG - Intergenic
1068583209 10:58766273-58766295 GGGTGGGGATGAAAAGGGGATGG + Intronic
1069259093 10:66371662-66371684 AGTTGGGGATGATGAGAAGCAGG - Intronic
1069291649 10:66787421-66787443 GGGTGAGGTTGGACAGAAGTTGG + Intronic
1069311922 10:67048144-67048166 GGCAGGGGATGAACAGAGGTAGG - Intronic
1069318093 10:67132929-67132951 GAGGGGGTATGAAGAGAGGTTGG + Intronic
1069855370 10:71437860-71437882 GGGTGGGGATGATGGCCAGTTGG - Intronic
1070798252 10:79229802-79229824 GGGTGGGGAAGCAGAGAGGCGGG + Intronic
1071002828 10:80850144-80850166 GTGGGGGGATCAAGAGAAGCTGG + Intergenic
1071128202 10:82360166-82360188 GGTTGGGGAAGAAGGGGAGTGGG + Intronic
1071913139 10:90258395-90258417 GGGTAGGAAGAAAGAGAAGTTGG - Intergenic
1072636328 10:97180818-97180840 GGGTGGGGCAGAAGAGAGCTCGG - Intronic
1072755104 10:98014805-98014827 TGGTGAGGATGTAGAGAAATTGG + Intronic
1072905268 10:99447164-99447186 GCAGGGGGATGAAGGGAAGTTGG + Intergenic
1073064090 10:100748286-100748308 GGGAGGGGAGGGTGAGAAGTGGG + Intronic
1073119138 10:101111009-101111031 GGGTGGGGGTGGAGAAAAGTAGG + Intronic
1073602400 10:104859927-104859949 TGGAGAGGATGTAGAGAAGTAGG + Intronic
1073689264 10:105789497-105789519 AGGGGAGGATTAAGAGAAGTAGG + Intergenic
1073856935 10:107687151-107687173 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1074064998 10:110006751-110006773 GGGGGGGGATGAAGATGAGGCGG + Intronic
1074084169 10:110195009-110195031 GGGTCGGGAAGAGGAGAACTGGG - Intergenic
1074172689 10:110958821-110958843 AGTTGGGGATGAACAGGAGTAGG - Intronic
1074291120 10:112138650-112138672 GGGTGGGGACGCAGAGAAATGGG - Intergenic
1074331228 10:112511688-112511710 GAGGGAGGATGAAGAGAAGCAGG - Intronic
1074579435 10:114704641-114704663 GGGTGGGGAGAAAGAGAAAACGG + Intergenic
1075066407 10:119291788-119291810 GGATGAGGAGGAAGAGAAGAAGG - Intronic
1075112188 10:119596524-119596546 GGGTGGGGAGGAAGGGGAGGGGG + Intronic
1075383352 10:122036914-122036936 TGGTGAGGATGTAGAGAAATTGG - Intronic
1075570696 10:123540348-123540370 GCGTGGGGATGAACAGAGTTGGG - Intergenic
1075722439 10:124595224-124595246 GGGTGGGGAAGAACAGAGCTGGG - Intronic
1076062247 10:127422115-127422137 TGTTGGGGGTGCAGAGAAGTTGG - Intronic
1076732441 10:132445473-132445495 GGCTGGGGATGAAGAAGAGTGGG + Intronic
1077010818 11:378534-378556 GGGTGGGGAAGGACAGGAGTTGG + Intronic
1077204250 11:1334462-1334484 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1077529920 11:3090326-3090348 GGGTGGGGAAGAAAGGGAGTGGG - Intronic
1078124429 11:8546573-8546595 TGGGGGGGATGAAGAGAGGTTGG - Intronic
1078462493 11:11525155-11525177 GGGTGGGGAGGAGGAGAGGTAGG + Intronic
1078471966 11:11595542-11595564 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1078719851 11:13874529-13874551 GGTAGGAGATAAAGAGAAGTTGG - Intergenic
1078805413 11:14695653-14695675 GGGTGGGGAAGCAGAGCATTAGG - Intronic
1078938438 11:15973735-15973757 GGGTTGGGATTAAGAGAGTTGGG + Intronic
1078970900 11:16410006-16410028 GGGTGGGGATGGGGAGGAATAGG + Intronic
1079098026 11:17523350-17523372 GGGTGGTGGGGATGAGAAGTGGG + Intronic
1079131409 11:17748930-17748952 GTGTGGGGCTGGAGAGAAGTTGG + Intronic
1079133446 11:17762811-17762833 GGGTGGGAATGGAGAGACGAAGG - Intronic
1079485421 11:20931323-20931345 GGGTGGAGAAGAAGAGAATGAGG + Intronic
1079812542 11:25013233-25013255 GGAGGAGGATGAAGAGGAGTGGG + Intronic
1079828631 11:25232387-25232409 GAATGGGGACAAAGAGAAGTTGG - Intergenic
1079869145 11:25774280-25774302 CGGTGAGGATGTAGAGAAATTGG - Intergenic
1079990508 11:27241494-27241516 GGGTGTGGATGCAGAGAGGGTGG + Intergenic
1080085599 11:28277910-28277932 GAGAGAGGATGAAGAGAAGTGGG + Intronic
1080389100 11:31827340-31827362 GGGTGGGGAGGAGGAGCAGGAGG - Intronic
1080673711 11:34405423-34405445 GGGTGGAGGAAAAGAGAAGTGGG - Intergenic
1080815519 11:35752647-35752669 GCATGGGGATGGAGAGAGGTAGG - Intronic
1081156092 11:39692919-39692941 GGCTGAGGAGGAAGAGAAGGGGG - Intergenic
1081207330 11:40291521-40291543 GGGTGGAGTTGGAGAGAAGTAGG + Intronic
1081265680 11:41018438-41018460 GGGTTGTGCTGAAGAGAAATTGG - Intronic
1081502153 11:43677571-43677593 GGGTGGGGAGGAATAGCATTAGG - Intronic
1081651818 11:44828880-44828902 GGGTCGTGATGGAGAGAAGAGGG - Intronic
1081749547 11:45500118-45500140 TGTTGGGGATGTAGAGAAGATGG + Intergenic
1081878545 11:46428191-46428213 GGGAGGGGAAGAAGAGGAGAGGG + Intronic
1081974782 11:47226244-47226266 TGGTGGGGAAGTAGAGAAGTTGG - Intronic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1082901150 11:58254094-58254116 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1083000128 11:59283772-59283794 AGGTGGGGAAGAAAAGAAGACGG + Intergenic
1083196526 11:61091826-61091848 GGGTGGGGAGGGGGAGAAGGAGG - Intergenic
1083293954 11:61705306-61705328 GTGCGAGGGTGAAGAGAAGTGGG - Intronic
1083300236 11:61736245-61736267 GGGTGGGCAGGAACAGAAGCAGG - Intronic
1083458351 11:62794215-62794237 GGATGGGGATGCACTGAAGTAGG - Intronic
1083605006 11:63973277-63973299 GGGTAGGAAGGAAGGGAAGTTGG + Intergenic
1083877383 11:65531466-65531488 GGGTGGGAATGAAGTGATGGCGG - Intronic
1084043758 11:66557349-66557371 GGGTGGGGATGGACAGGAGGAGG - Intronic
1084941332 11:72614961-72614983 GGGAGGGGAGGAAGAGAAAGAGG - Intronic
1085830995 11:79900864-79900886 TGGCTGGGATGAAGAGAGGTTGG + Intergenic
1085861314 11:80239265-80239287 GGGTGGTGAGGGAGAGAAGGAGG + Intergenic
1086073087 11:82820578-82820600 AGATGGAGATGAGGAGAAGTGGG - Intergenic
1086138063 11:83462612-83462634 GAGGGGAGATGAAGAGAAGCTGG + Intronic
1086229213 11:84548409-84548431 GGGTGGGGATGGATAGCATTGGG - Intronic
1086314831 11:85580366-85580388 GAGTGGGAAGAAAGAGAAGTTGG - Intronic
1086361783 11:86068294-86068316 GGGTGGGAAGGAAGAGCAGAAGG + Intronic
1086499120 11:87434173-87434195 GCCTGAGGATGAAGAGAAGAGGG + Intergenic
1086571311 11:88287662-88287684 GGGAGAGGATAAAGAGATGTTGG - Intergenic
1086621382 11:88890118-88890140 GGGTGGGGATGTGGGGATGTGGG - Intronic
1086735049 11:90295845-90295867 GGCTGAGGATGAAGGGAAATAGG + Intergenic
1086976227 11:93136357-93136379 TGGTGAGGTTGCAGAGAAGTAGG + Intergenic
1087122779 11:94592114-94592136 GGGTGGGGAGGAAAAGGAGATGG - Intronic
1087159175 11:94932467-94932489 GAGTGGGGAGGAAGAGCATTAGG + Intergenic
1087313976 11:96584715-96584737 GAGAGGGGATGAGGAGAGGTTGG + Intergenic
1087451961 11:98335182-98335204 GGATGAGGATGTAGAGAATTTGG - Intergenic
1087605548 11:100373224-100373246 GTGGGAGGATGAAGAAAAGTTGG - Intergenic
1088626142 11:111732038-111732060 GGGTGGGGAAGGAGAGCAGCAGG + Intronic
1088989075 11:114935739-114935761 GGGAAGGGAGGAAGAGAAGGTGG + Intergenic
1089070245 11:115694408-115694430 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1089162740 11:116452086-116452108 GGGAGGGGATTGAGAGAAGATGG - Intergenic
1089580350 11:119477795-119477817 GTCTGGGGGTGAAGAGAGGTGGG + Intergenic
1089626885 11:119756558-119756580 TGGTGAGGATGTAGAGAACTTGG + Intergenic
1090333750 11:125949739-125949761 AGGTGGGGCAGAAGAGAGGTAGG - Intergenic
1090502957 11:127279694-127279716 GGAGGGGGAAGAAGAGAAGGAGG - Intergenic
1090590657 11:128263456-128263478 GAGAGGGCATGAAGAGAAGTTGG - Intergenic
1090732363 11:129582848-129582870 TGGTGAGGATATAGAGAAGTTGG - Intergenic
1090806993 11:130209006-130209028 GGGTGGGTATGAAGGGAAGCAGG + Intronic
1090853370 11:130589999-130590021 GGAGGAGGATGAGGAGAAGTGGG - Intergenic
1091022079 11:132109334-132109356 GGGAGAGGATGTAGAGAAATGGG - Intronic
1091034356 11:132219813-132219835 GGGTGGGAGTGAAGAGGAGGGGG - Intronic
1091131333 11:133149561-133149583 GGGTGGGGGTTGAGAGAATTTGG - Intronic
1091171830 11:133526469-133526491 GGGTGGTGAAGAAGAGAGGAGGG + Intronic
1091252913 11:134158802-134158824 GAAGGGGGATGAAGAGAAGTTGG - Intronic
1091387274 12:103328-103350 GGGTGGGGCTCAGGAGAAGGAGG + Intronic
1091402366 12:188862-188884 GGGTGGGGATGGAGGGAACGGGG - Intergenic
1091446617 12:547206-547228 GCGTGGGGGTGAGGAGAGGTGGG + Intronic
1091622075 12:2096736-2096758 GGCTGGGGAGGAAGAGAAAATGG - Intronic
1091635802 12:2195623-2195645 GGGTAGGGATGAAGGCAAGGAGG + Intronic
1091770622 12:3148879-3148901 AGGAGGGGATGAGGAGAAGAGGG + Intronic
1092145981 12:6215006-6215028 GGGTGAGGATGCAGAGAGGTGGG - Intronic
1092593121 12:9969104-9969126 GGTGGGGGATAAAGATAAGTTGG + Intronic
1092639702 12:10492091-10492113 GGGAGGGGATAAAGAGAGATTGG - Intergenic
1092796096 12:12111336-12111358 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
1093136185 12:15454209-15454231 TGGTGGGGATGTGGAGAAATTGG - Intronic
1093365854 12:18297665-18297687 GGGAGAGGATGAAGAGAGGTGGG - Intronic
1093737986 12:22645845-22645867 GGGGGGTGATGAAAAGAAGTTGG - Intronic
1093838657 12:23868690-23868712 GGGTGGGAATGAAGGGATATGGG - Intronic
1094091901 12:26660036-26660058 GGATGGGAATGAAGAGAACGAGG + Intronic
1094308508 12:29050202-29050224 GGGGCAGGGTGAAGAGAAGTTGG + Intergenic
1094360672 12:29627468-29627490 TGGTTGGGATGTAGAGAAATAGG + Intronic
1094440320 12:30468774-30468796 GAGGTGGGAGGAAGAGAAGTGGG - Intergenic
1094523790 12:31218786-31218808 GGGTGGGGCTGAAGAGAGCCTGG + Intergenic
1095271816 12:40227437-40227459 GGGGAGGGATAAAGAGAAGGTGG - Intronic
1095310621 12:40692943-40692965 GGGTGGGGAAGCAGAGAGGTCGG + Intronic
1095342416 12:41107146-41107168 AGATGGTGATGAAGAGAGGTTGG - Intergenic
1095716547 12:45352313-45352335 GAGTGGGGAGGGAAAGAAGTGGG - Intronic
1095948101 12:47765364-47765386 GGGTGGGAAGGCAGAGCAGTGGG - Intronic
1096262961 12:50104337-50104359 GGGGTGGGAAGATGAGAAGTGGG + Intronic
1096750688 12:53756984-53757006 GAGAGGGGAAGAAGAGATGTTGG - Intergenic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096861564 12:54532430-54532452 GTAGGGGGATGGAGAGAAGTGGG + Intronic
1096934382 12:55255301-55255323 TGGTGAGGATGTGGAGAAGTAGG + Intergenic
1097170489 12:57110214-57110236 GGCTGGGGAAGAAGAGGGGTTGG - Intronic
1097257441 12:57690227-57690249 GTGTGGGGTTGAGGAGAAGTGGG - Intergenic
1097595735 12:61627407-61627429 AGGGGAGGATGAAGAGAAGTGGG + Intergenic
1097880674 12:64683464-64683486 GTGTGGGGAGGTAGAGAAGTGGG + Intronic
1097967344 12:65595348-65595370 GTGGGGGGATGGGGAGAAGTAGG - Intergenic
1098006219 12:65999496-65999518 GGGTGGAGATAAAGAAAGGTAGG - Intergenic
1098010552 12:66046206-66046228 GGGTGGGGAAGAAAAGAAACTGG - Intergenic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098556113 12:71820885-71820907 GGGTGGGGTTGGAGAGATATTGG - Intergenic
1098908494 12:76185864-76185886 AAGTGGGGGTGAAGAGAAGGTGG - Intergenic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099182274 12:79482524-79482546 AGGTGGGGAGGAAGGGAAGGTGG + Intergenic
1099182735 12:79486356-79486378 GGGTGGGGATGAAGAGCGGCAGG - Intergenic
1099290591 12:80771867-80771889 GGGGTAGGATGAAAAGAAGTAGG - Intergenic
1099400682 12:82199728-82199750 GGGGGAGGATAAAGAGAGGTTGG + Intergenic
1099609252 12:84845814-84845836 AGGTGGGGTAGAAGAGAAGCAGG - Intergenic
1099678412 12:85791403-85791425 GAGTGGGGAGGAATAGCAGTAGG + Intergenic
1100112306 12:91260398-91260420 GAGGGAGAATGAAGAGAAGTGGG + Intergenic
1100218224 12:92476019-92476041 GGTAGGGTATGAAGAGCAGTGGG + Intergenic
1100244912 12:92747900-92747922 AGAAGGGGATGAAGAGAGGTCGG + Intronic
1100287868 12:93184507-93184529 GGGTGGGGATGGAGAGAGAAAGG + Intergenic
1100432649 12:94544363-94544385 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1100776727 12:97983414-97983436 AGTGGGGAATGAAGAGAAGTTGG + Intergenic
1100854601 12:98747960-98747982 GAGTAGGGATGAAGAGAGATTGG + Intronic
1100931665 12:99617150-99617172 GGGTGAGGATGTGGAGAAATAGG + Intronic
1100934481 12:99647768-99647790 AGGTTGGGAAGAAGAGCAGTGGG + Exonic
1101464551 12:104934865-104934887 CGGTGGGGAGGAAGAGGAATGGG + Intronic
1101761953 12:107665870-107665892 GGGTGGGGAAGAAGAAAAAGTGG + Intergenic
1101764336 12:107684222-107684244 GGGTGTGGAAGTGGAGAAGTGGG + Intergenic
1101931059 12:109014674-109014696 TGGTGAGGATGTAGAGAAATTGG - Intronic
1102129136 12:110511582-110511604 GGGTGAGTATGAAGAGAGGTTGG + Intronic
1102443354 12:112980382-112980404 AGGAGGAAATGAAGAGAAGTTGG - Intronic
1102517295 12:113458397-113458419 GGGTGGGGAAGGGGAGCAGTTGG - Intergenic
1104078991 12:125413974-125413996 TGGTGAGGATGTAGAGAAATTGG - Intronic
1104321165 12:127752371-127752393 TGGTGAGGATGAGGAGAAATGGG - Intergenic
1104615793 12:130267476-130267498 GTGGGGAGATGAAGAGAGGTTGG - Intergenic
1104726783 12:131082704-131082726 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
1104759984 12:131291533-131291555 GGGGGAGGATGAAGAAAAGTTGG + Intergenic
1104819736 12:131668765-131668787 GGGGAAGGATGAAGAAAAGTTGG - Intergenic
1104956271 12:132467442-132467464 TGTTGGGGATGTAGAGAAATTGG + Intergenic
1105211056 13:18257293-18257315 GGGTGGAGATGGAGAGAGTTAGG + Intergenic
1105334119 13:19448667-19448689 TGGTGAGGATGAAGAGAAAAGGG + Intronic
1105433486 13:20358169-20358191 GAGTGGGGAGGATGAGAAGGGGG - Intergenic
1105860814 13:24410692-24410714 TGGTGAGGATGAAGAGAAAAGGG - Intergenic
1105911622 13:24873678-24873700 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1105922763 13:24981240-24981262 TGGTGAGGATGAAGAGAAAAGGG + Intergenic
1106310261 13:28548024-28548046 AGGGGTGGATGAAGAGAAGTTGG + Intergenic
1106466718 13:30020181-30020203 GTGTGGGGATGAGGAGGTGTGGG - Intergenic
1106495760 13:30272948-30272970 GGGTGTGGTTGTAGAGAGGTGGG - Intronic
1106539610 13:30678199-30678221 GGGAGGGGATGGGCAGAAGTTGG + Intergenic
1106555417 13:30804453-30804475 AGGTGGGGAGGAGGCGAAGTCGG + Intergenic
1106731740 13:32548407-32548429 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1106956211 13:34942189-34942211 GGGTGGGTGGGAAGAGAAGGAGG + Intergenic
1106998715 13:35519903-35519925 GTGTGGGGATAAAGAGAGTTTGG - Intronic
1107223482 13:38016844-38016866 GAGTGGAGGTGAAGAGAGGTTGG - Intergenic
1107458521 13:40578050-40578072 GGGAAGGGTGGAAGAGAAGTTGG - Intronic
1107535909 13:41331655-41331677 GGGGAGAGATGAAGAGAGGTTGG + Intronic
1107897042 13:44975534-44975556 TTGTGGGGATGGAGAGAACTAGG - Intronic
1107932307 13:45316306-45316328 GGAGGGGGAGGAAGAAAAGTGGG + Intergenic
1107986716 13:45782550-45782572 GGGTGGGGATGAAAAGCAACAGG - Exonic
1108118483 13:47157669-47157691 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1108163003 13:47662399-47662421 GGGTGAGGATGCAGAGAAAAGGG + Intergenic
1108596191 13:51951688-51951710 GAGTGGGGATGAGGAGGAGGAGG + Intronic
1108638223 13:52357256-52357278 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1108638493 13:52360097-52360119 GGGTGGAGAGGAGGAGAGGTTGG - Intergenic
1108645333 13:52421380-52421402 AGGAGGGGATGGAGAGAGGTTGG + Intronic
1108716648 13:53085915-53085937 GTGTGGGGAGGAGGAGAAGGAGG + Intergenic
1109370834 13:61417095-61417117 GGGTGGGGAGGAGGTGGAGTGGG - Intronic
1109593600 13:64520918-64520940 GTGTGGTGGTAAAGAGAAGTTGG - Intergenic
1109725386 13:66334170-66334192 GTGGAGGGATGAAGAGAGGTTGG - Intronic
1109998904 13:70168495-70168517 GGCAGGGGATAAAGAGAAGTTGG - Intergenic
1110207942 13:72939380-72939402 GGGTGGGGGCAAAGAGGAGTGGG - Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110314255 13:74086966-74086988 GGGTGAGGAAGAGGAGGAGTTGG + Intronic
1110594736 13:77307810-77307832 GGGCAGGGATGTAAAGAAGTAGG - Intronic
1110724686 13:78806715-78806737 AGGAGGGAATGAAGTGAAGTTGG + Intergenic
1110865823 13:80395118-80395140 GGGAGGGCATGAAGAAAGGTTGG - Intergenic
1110965536 13:81690241-81690263 AGGTGGGGAGGAAGAGGAGGAGG + Intergenic
1111203358 13:84969610-84969632 GAAGGAGGATGAAGAGAAGTTGG - Intergenic
1111227877 13:85298842-85298864 AGGGGTTGATGAAGAGAAGTTGG + Intergenic
1111247737 13:85562946-85562968 AGTTGGGGATGGAGAGAAATGGG + Intergenic
1111254607 13:85649777-85649799 GGAATGGGATGAAGAGAGGTAGG + Intergenic
1111846071 13:93510292-93510314 GAGGGAAGATGAAGAGAAGTGGG - Intronic
1112180980 13:97080060-97080082 GGAGGAGGATGAAGAGAGGTTGG + Intergenic
1112229774 13:97577326-97577348 TGATGGGGATGTGGAGAAGTTGG - Intergenic
1112455262 13:99555362-99555384 GGGTGGGGAAGGGGAGGAGTAGG - Intronic
1112566800 13:100558836-100558858 GAGAGGGGATGGAGAGAGGTTGG + Intronic
1112588888 13:100745721-100745743 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1112750109 13:102574415-102574437 GGGTGGGGATGAGGAGATCTTGG - Intergenic
1112849547 13:103688153-103688175 AGGAGGGGATAGAGAGAAGTTGG - Intergenic
1112885760 13:104168936-104168958 AGGAGAGTATGAAGAGAAGTTGG + Intergenic
1112904705 13:104402539-104402561 GAGGGGGGTTGAAGAGATGTTGG + Intergenic
1113237895 13:108301646-108301668 GGGTGGAGGTGAAAAGACGTTGG + Intronic
1113251137 13:108453761-108453783 GGCAGGGGGTGAAGAGAGGTTGG + Intergenic
1113322228 13:109245252-109245274 GGGAACGGAGGAAGAGAAGTGGG - Intergenic
1113391303 13:109899950-109899972 AGGGAGGGATGAAGAGAAGGAGG - Intergenic
1113425114 13:110201275-110201297 GGGGGAGGAGGAAGAGAAGGAGG + Intronic
1113425121 13:110201296-110201318 GGGGGCGGAGGAAGAGAAGGAGG + Intronic
1113514453 13:110882059-110882081 GGGTTGGCTGGAAGAGAAGTAGG - Intronic
1113574023 13:111382002-111382024 GGGTGGGGTTGCAGAGACGGTGG + Intergenic
1114240773 14:20865618-20865640 TGGAGAGGATGCAGAGAAGTAGG + Intergenic
1114300182 14:21368932-21368954 AGGCGAGGATGAAAAGAAGTGGG + Intronic
1114361019 14:21972801-21972823 CGGTGAGGATGTAGAGAAATAGG + Intergenic
1114700603 14:24674222-24674244 GGGTGGGGAGCAGGAGAAATGGG - Intergenic
1114703756 14:24705421-24705443 GGGTGGGGGTGGGGAGCAGTGGG + Intergenic
1114908347 14:27160043-27160065 GGGTGAGTAGGATGAGAAGTAGG + Intergenic
1115300238 14:31877224-31877246 GGGTGGGAAAGAAGAAAAGTTGG - Intergenic
1115339870 14:32282050-32282072 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1115695224 14:35890607-35890629 AGGAGGGGATGAAGAGAGGTTGG - Intronic
1115815515 14:37160582-37160604 GGGCAAGGATAAAGAGAAGTAGG + Intronic
1115842970 14:37492729-37492751 TGGTGTAGATGAAGAGATGTTGG - Intronic
1115873285 14:37831058-37831080 GCGAGGGGATGAAGACAGGTTGG - Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1115975769 14:38995429-38995451 GGGTGGGCATAAAGGGAAGAGGG - Intergenic
1116569374 14:46496176-46496198 GGCTGGGGATAAAGATATGTTGG - Intergenic
1116660719 14:47707087-47707109 GGCTGGGGATAGGGAGAAGTGGG + Intergenic
1116982890 14:51190089-51190111 GGGAAGGGAAGAAGAGAACTAGG - Intergenic
1117124132 14:52603076-52603098 AGGGGAGGATGAAGAGAAGTTGG - Intronic
1117164340 14:53018697-53018719 GAGGGATGATGAAGAGAAGTGGG - Intergenic
1117399596 14:55346650-55346672 GGCTGGGGAAGAAGAGAGCTGGG + Intronic
1117473206 14:56067552-56067574 AAGTGGGGATGGAGAGAACTGGG + Intergenic
1117608801 14:57461408-57461430 GGAGGGGGATGAAGAGAGGCTGG + Intergenic
1117702523 14:58427674-58427696 GGGCGGGTTTGAAGGGAAGTGGG + Intronic
1117840588 14:59856650-59856672 GATTGGGGGTGGAGAGAAGTCGG - Intronic
1117846776 14:59920072-59920094 GGGTGGGGAGGAGGAGAAAAGGG - Intronic
1117954240 14:61110555-61110577 TGGTGGGGCTGAAGCGAAGTTGG - Intergenic
1117960486 14:61157036-61157058 GAGTGGGAAGGAAGAGATGTGGG + Intergenic
1117996960 14:61487094-61487116 GGGTGGTGCTGGAGATAAGTGGG + Intronic
1118372328 14:65147818-65147840 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1119072304 14:71598930-71598952 GGGGGAGGATGAAGAGAGGGTGG - Intronic
1119124880 14:72116502-72116524 GGATGGGGATGAAGAGAGGGAGG - Intronic
1119343037 14:73897039-73897061 GGAAGGGGATGAAGAGAACTGGG + Intronic
1120039197 14:79733134-79733156 AGGTGGGGGTGAAGGGAAGATGG + Intronic
1120572535 14:86139272-86139294 GAGTGGCAATGAAGAGAGGTTGG + Intergenic
1120803704 14:88722122-88722144 TGGTGAGGTTGAAGAGAAATAGG + Intronic
1120884453 14:89441083-89441105 GGTTGGGGAGGAAGGGAAGCCGG - Intronic
1120969685 14:90197037-90197059 GGGTGGGGCTGAGTAGAATTAGG - Intergenic
1121190689 14:92026727-92026749 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
1121798742 14:96756073-96756095 GGGTGGGCAAGAAGGGAAGGCGG + Intergenic
1122136767 14:99637921-99637943 GGTTGGTCATGAAGAGCAGTGGG - Intergenic
1122149104 14:99715008-99715030 GTGGGGGGATGAAGAGAAGTTGG + Intronic
1122329530 14:100903318-100903340 GGCTGGGGATGAAGTGATGCCGG + Intergenic
1122448241 14:101783171-101783193 GGGAGGGGAGAAAGAGAAATGGG - Intronic
1122968891 14:105144450-105144472 GGGTGGGTGTGCAGAGCAGTGGG - Intronic
1124385541 15:29205452-29205474 TGGTGAGGATGTAGAGAAGTTGG - Intronic
1124659705 15:31536849-31536871 GAGGGACGATGAAGAGAAGTGGG + Intronic
1124888172 15:33706814-33706836 GGTTGAGGATGTAGAGAAGTTGG - Intronic
1124957749 15:34370836-34370858 GGGAGGGGATGAAGAGGAGGAGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125387110 15:39149581-39149603 GGGTGGGGAAGAAAAGAAGCAGG + Intergenic
1125762908 15:42109929-42109951 GGAGGGGGAGGAAGAGAAGAAGG - Intergenic
1125883868 15:43214213-43214235 GAGTGGGGAGGAAGAGAAGATGG + Intronic
1126019361 15:44385310-44385332 GGGAGGGGATGTGGAGAAATTGG - Intronic
1126137434 15:45405168-45405190 GTGAGGGGATGAAGACAGGTTGG - Intronic
1126252483 15:46585231-46585253 GGGGAGGGATGAAGAAAAGATGG - Intergenic
1126549801 15:49915318-49915340 TGCGGGGGATGAAGAGAGGTTGG + Intronic
1126741903 15:51785681-51785703 GAGTAGGGACAAAGAGAAGTTGG + Intronic
1126995556 15:54439914-54439936 GGGGTGAAATGAAGAGAAGTTGG - Intronic
1127082563 15:55394898-55394920 GAGGGGTGAGGAAGAGAAGTTGG - Intronic
1127340155 15:58033031-58033053 GGGAGAGGATGAAGAGAGGTAGG + Intronic
1127559870 15:60125570-60125592 GGAGGGAGATGAAGAGAGGTTGG + Intergenic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128304219 15:66587266-66587288 GGAGGGGGAGGAAGAGAAGGAGG - Intronic
1128338722 15:66805022-66805044 GGGGTGGGATGAAGGGAAGGTGG + Intergenic
1128430474 15:67588298-67588320 AGGTGGGGATGAAAAGAAACAGG - Intronic
1128511818 15:68318247-68318269 GAGTGGAGGTAAAGAGAAGTGGG - Intronic
1128982587 15:72197933-72197955 AGGTGGGGAAGGAGAGAAGCTGG - Intergenic
1129028779 15:72604152-72604174 GGATGGGGAGGTAGAGGAGTTGG + Intergenic
1129156137 15:73719378-73719400 GGGAGGGGATGATCAGGAGTAGG - Intergenic
1129406413 15:75322001-75322023 TGGTGTGGATGAAGAGTAGGAGG - Intergenic
1129535944 15:76313814-76313836 GGGTGGGGAGGTAGGGAAGGAGG - Intergenic
1129831833 15:78675793-78675815 GAGTGGGAATGAAGAGGTGTGGG - Intronic
1129935856 15:79449803-79449825 TGGTAGGGATGGAGAGAAGGAGG - Intronic
1130128712 15:81117824-81117846 GGATGGTGAAGAAGAGGAGTTGG - Intronic
1130396212 15:83504377-83504399 GGGTGGGTATGAAGACCAGAAGG - Intronic
1130844319 15:87730394-87730416 GGCTGGGGTTGAAGAGACATGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131149325 15:90037048-90037070 TGGTGGGGAGGACGGGAAGTGGG + Intronic
1131291713 15:91112143-91112165 GGGTGGGGATAGGGAGAAGGGGG + Intronic
1131544452 15:93304342-93304364 GGGTGAGGATGAAGAGAGGCTGG - Intergenic
1131582675 15:93660561-93660583 AGGGGAGGATGAAGAAAAGTTGG - Intergenic
1131830961 15:96354321-96354343 GGGTGGGGTTGAAGGCGAGTGGG - Intergenic
1131996311 15:98136023-98136045 GGGTGGGGAGGGAGAGCATTAGG + Intergenic
1132338933 15:101065962-101065984 GGGTGGGGATGAGGAGTAGGAGG - Exonic
1132435720 15:101800210-101800232 GAGTGGGGATGGAGAGAACAGGG + Intergenic
1132908337 16:2295780-2295802 GGGTGGGCATGAAGAGACCTGGG - Intronic
1133402671 16:5500141-5500163 GGGAGGGGAGGAAGGGAAGGAGG - Intergenic
1133411539 16:5573100-5573122 GGATGGAGATGACGAGAATTGGG + Intergenic
1133729781 16:8569439-8569461 GGGTGAGGAGGAAATGAAGTCGG + Intergenic
1133787879 16:8986979-8987001 GGGAGTGCATGAAGGGAAGTAGG - Intergenic
1133848432 16:9478927-9478949 AGGTTGAGAGGAAGAGAAGTGGG - Intergenic
1134363515 16:13554883-13554905 GGGTGAGGAAGAAAAGAAGAAGG + Intergenic
1134417006 16:14052863-14052885 GAGTGGGGATGAGGACAGGTTGG - Intergenic
1134427410 16:14164183-14164205 TGCTGGGGATGAAGAGAGATTGG - Intronic
1134821528 16:17251257-17251279 GGGTGAGGATGAACAGAAGGGGG - Intronic
1135036544 16:19082949-19082971 GGGCGGGGATGGGGAGAAATAGG + Intergenic
1135053345 16:19210418-19210440 GGGAGAGGATAAAGAGAAGTGGG - Intronic
1135191501 16:20358238-20358260 CAGTGGAGATGAAGGGAAGTGGG + Intergenic
1135248293 16:20876963-20876985 GAGGGGAGATGAAAAGAAGTGGG + Intronic
1135254441 16:20929762-20929784 AGGTGGGGATGTAGGGAAGGTGG - Intergenic
1135418857 16:22290657-22290679 CGGTGAGGATGAAGAGAAAGAGG + Intergenic
1135867082 16:26113749-26113771 GGGTCAGGAGGAAGAGAAGGAGG - Intronic
1135896682 16:26411568-26411590 GGGTGGGGATGGGGAGATGTAGG + Intergenic
1135956469 16:26960334-26960356 GGCTGGGGATGAAGAGCTGCAGG + Intergenic
1135967131 16:27045417-27045439 AGGTGGGCATGAAGACAGGTTGG - Intergenic
1136001269 16:27295798-27295820 GGGTTGGGATGTTGAGAAATTGG - Intergenic
1136486388 16:30574841-30574863 AGAGGTGGATGAAGAGAAGTTGG - Intronic
1136712795 16:32253765-32253787 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136730343 16:32405933-32405955 GGGAAGGGATGAAGGGAAGAAGG - Intergenic
1136755121 16:32675664-32675686 GGGTGGGGCTGAGGAGGAGGCGG + Intronic
1136812992 16:33194705-33194727 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136819468 16:33304785-33304807 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136826031 16:33361320-33361342 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1136831097 16:33460091-33460113 GGGTGGGGCTGAGGAGGAGGCGG - Intronic
1137263714 16:46851903-46851925 GGGAGGGCAGGAGGAGAAGTGGG - Intergenic
1137281036 16:46976899-46976921 GGGTTGGGATGGAGAGGAGGTGG + Intergenic
1137407453 16:48200748-48200770 AGGTGAGAATGAAGAGAGGTTGG + Intronic
1137465569 16:48705889-48705911 GGGGAGGGATAAAGAGAAGTTGG - Intergenic
1137578187 16:49617706-49617728 GGGAGAGGAGGGAGAGAAGTGGG - Intronic
1137709419 16:50555942-50555964 GGGTGGGGGGGAAGGGACGTGGG - Intronic
1137771934 16:51023498-51023520 GGGTGGGGGTTAAGAGAATCAGG + Intergenic
1137784448 16:51126296-51126318 GGGTGGGAATGAAAAAAAGGTGG + Intergenic
1137853562 16:51770631-51770653 AGGAGGGGACCAAGAGAAGTGGG - Intergenic
1137872990 16:51968519-51968541 GGGAGGGGATGAATAGGATTTGG - Intergenic
1137957343 16:52845368-52845390 GGGCGGGGATGAAGACAGGTTGG - Intergenic
1138458146 16:57132938-57132960 GAGTGGGGATGAAGAGCGGGGGG + Intronic
1138634692 16:58328376-58328398 GGGTGGGGATGGGGAGAAATGGG - Intronic
1138755116 16:59475187-59475209 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1138807854 16:60112451-60112473 GGATGGGAATGAAGAGAAGTGGG - Intergenic
1139197029 16:64931182-64931204 GGGTGGAAATGGGGAGAAGTAGG + Intergenic
1139218956 16:65159031-65159053 GTGGAGGGATGAAGAGAGGTAGG + Intergenic
1139258205 16:65563736-65563758 GAGGGAGGATGAAGAGAAGTGGG - Intergenic
1139494699 16:67307920-67307942 GGAAGGAGATGAAGAGAATTTGG - Intronic
1139676299 16:68526277-68526299 GAGTGGGGAGGAAGAGATGAGGG - Intergenic
1140818219 16:78639879-78639901 GTGTGAGGATGAAGAGTAATAGG + Intronic
1140896627 16:79330568-79330590 GGGTGGGGAGGAACACCAGTGGG + Intergenic
1140914673 16:79483104-79483126 GGGAGGGGAGGGAGGGAAGTAGG - Intergenic
1140963994 16:79946033-79946055 AGGTAGGGAAAAAGAGAAGTGGG + Intergenic
1140988450 16:80183593-80183615 GGGGGAGGATGAGGAGATGTTGG + Intergenic
1141055552 16:80810491-80810513 GGTTGGGAAAGAAGAGAACTGGG + Intergenic
1141600790 16:85124853-85124875 GGGTGAGGATACAGAGAAATTGG + Intergenic
1141632268 16:85294674-85294696 GGGTGGGGAGGGAGGGAAGGGGG - Intergenic
1141870263 16:86780547-86780569 GGGTCGGGAAGAAGGGAAGGCGG - Intergenic
1142137759 16:88459548-88459570 AGGGGGGAATGAAGAGAAGGAGG - Intronic
1202991569 16_KI270728v1_random:17675-17697 GGGTGGGGCTGAGGAGGAGGCGG - Intergenic
1203057263 16_KI270728v1_random:936003-936025 GGGTGGGGCTGAGGAGGAGGCGG + Intergenic
1142483928 17:234802-234824 GGCTGGGGGTGAGGAGAAGGAGG + Intronic
1143023405 17:3928110-3928132 GTGTCGGGCTGGAGAGAAGTGGG - Intronic
1143622073 17:8086448-8086470 AGCTGGGGATGGAGAGAAGGAGG - Intronic
1143642552 17:8207462-8207484 GAGTAGGGATGAAGACAAGTGGG - Intronic
1143658354 17:8310564-8310586 GGGTAGGGATGAGGACAAGACGG - Intronic
1143838673 17:9713405-9713427 GGGGGCAGATGAAGAGAGGTGGG - Intronic
1143892113 17:10110405-10110427 GAGGGGGGATGAAGAGAGTTTGG + Intronic
1143914000 17:10275577-10275599 GGGTGGGGATCATGGGAGGTAGG + Intergenic
1143943676 17:10570391-10570413 AAGTAGGGATAAAGAGAAGTTGG - Intergenic
1144074637 17:11705588-11705610 GGAGGGTGATGAAGAGAGGTAGG + Intronic
1144243026 17:13332688-13332710 TGGTGAGGATGAAGAGAAAAGGG - Intergenic
1144415883 17:15046102-15046124 AGAAGGGGATGAAAAGAAGTTGG - Intergenic
1144944331 17:18962072-18962094 GGGTGGAGATCAAGAAATGTGGG - Intronic
1145158887 17:20560963-20560985 GGGTGAGGAGGGAGAGGAGTGGG - Intergenic
1145959117 17:28876023-28876045 GGGTGAGGAGGAAGAGCAATTGG - Intergenic
1146095907 17:29930093-29930115 GGGTGGGGGTGAAGGGAACGGGG + Exonic
1146210500 17:30938776-30938798 AAGGGAGGATGAAGAGAAGTGGG + Intronic
1146783376 17:35696349-35696371 TGAGGGGAATGAAGAGAAGTAGG + Intronic
1146815780 17:35941130-35941152 TGGTGAGGATGTAGAGAAATTGG - Intronic
1147301917 17:39536196-39536218 GAGTGGGGAGAAAGAGAAATAGG - Intronic
1147484628 17:40800777-40800799 CAGTGGGGATGCAGAGAAGATGG + Intergenic
1147502597 17:40979753-40979775 GTAAGGGGATGAAGAGAGGTTGG + Intronic
1147711359 17:42468513-42468535 GTGGGGGGATGAAGAGAGGTTGG - Intronic
1147998944 17:44376395-44376417 GGGAGGGGATGAGGAGAAACAGG + Intronic
1148028145 17:44602298-44602320 GGGTGGGGAAAGAGAGAAGGTGG + Intergenic
1148573082 17:48686167-48686189 AGGGGAGGATGAAGAGAGGTGGG + Intergenic
1148688654 17:49514322-49514344 AGGTTGTGATGAAGAAAAGTGGG + Exonic
1149043630 17:52219623-52219645 GTGTGTGGATGAAGACAAGAAGG + Intergenic
1149127312 17:53251186-53251208 TGAGGGGGATGAAGAGAGGTTGG - Intergenic
1149145061 17:53480388-53480410 AGGTGAGAATGAGGAGAAGTTGG - Intergenic
1149568753 17:57657401-57657423 GGCTGGGGAGTAAGAGAAGAGGG + Intronic
1149931097 17:60756398-60756420 GGGGGTGGATAAAGAGAGGTTGG - Intronic
1150070165 17:62143571-62143593 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1150194244 17:63278486-63278508 TGGTGAGGATGTAGAGAAATTGG + Intronic
1150582508 17:66487653-66487675 TGGTGGGGATGCAGAGAAAAGGG - Intronic
1150628610 17:66859846-66859868 GGGTGGAGAGGGAGAGAAGAGGG - Intronic
1150908137 17:69360546-69360568 GGGAGGGGACGAAGAGAGGTTGG + Intergenic
1150935348 17:69629064-69629086 GGCTGGGGCTGAAGGGAAGGGGG + Intergenic
1151155970 17:72123249-72123271 GGGTGGGGGAGCAGAGAAGAAGG - Intronic
1151189490 17:72387754-72387776 GGGGAGGGGTGGAGAGAAGTGGG + Intergenic
1151746322 17:76013743-76013765 GGGTGGGAATGAAGACACGGAGG - Intronic
1151766763 17:76137000-76137022 GGCTGGGGAGGAACAGAACTGGG - Exonic
1151929872 17:77225593-77225615 GGGTGGGGATTATGAGATTTGGG + Intergenic
1152022483 17:77787824-77787846 GTTTGAGGATGAAAAGAAGTTGG + Intergenic
1152199406 17:78936288-78936310 GGGTGGGGAGGGAGAGTGGTCGG + Intergenic
1152369073 17:79874111-79874133 TGGTGGGGATGCACAGAAATAGG - Intergenic
1152706670 17:81847197-81847219 GGCTGGGGATGGGGAGGAGTGGG - Intronic
1152717668 17:81907661-81907683 GGCTGGGGATGGGGAGCAGTGGG + Intronic
1153273977 18:3350164-3350186 GGCTGGGAATGAAGAGAAACGGG + Intergenic
1153344865 18:4014408-4014430 TTGTGGGGGTGAAGAGATGTTGG + Intronic
1153427041 18:4976120-4976142 GGAGGGAGATGAAGAGAAGTAGG + Intergenic
1153859364 18:9185334-9185356 CTTTTGGGATGAAGAGAAGTTGG + Intronic
1154126778 18:11698729-11698751 TCCTGGGGATGAAGAGAAGAGGG + Intronic
1154203595 18:12318264-12318286 GGGAAGGGGTGGAGAGAAGTTGG + Intronic
1154251416 18:12748093-12748115 GGGTGGGAATGAAGAGCTGCTGG - Intergenic
1154295235 18:13141569-13141591 GGATTGGGAGGATGAGAAGTGGG - Intergenic
1154970868 18:21407975-21407997 AGATGGGGATGAAGAGAGGTTGG + Intronic
1155124754 18:22861793-22861815 TGAGGGAGATGAAGAGAAGTGGG + Intronic
1155222921 18:23701709-23701731 CGCTGAGGATGAAGAGAAGCGGG + Intronic
1155407309 18:25503074-25503096 AGGTGGGCATGAAAAGAGGTTGG + Intergenic
1155445371 18:25906257-25906279 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1155448060 18:25933657-25933679 GGGGGGAAATGAAGAGAGGTTGG - Intergenic
1155562835 18:27098316-27098338 TGGTGAGGCTGAAGAGAAATAGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1155662045 18:28260811-28260833 GGGTGGAGATGAAGAGAAGTTGG + Intergenic
1155979276 18:32163859-32163881 GGGTGGGGGAGGAGAGAAGGGGG + Intronic
1155981681 18:32186810-32186832 AGGAGGAGATGAAAAGAAGTTGG - Intronic
1156213592 18:34974749-34974771 GGAGGAGGATGAAGAGAAGGAGG + Intergenic
1156425411 18:37005962-37005984 GAGGGAGGATGAGGAGAAGTTGG + Intronic
1156754978 18:40512614-40512636 TGGAGGGGATGTGGAGAAGTGGG - Intergenic
1156861582 18:41842643-41842665 GGGAGGCCAGGAAGAGAAGTAGG + Intergenic
1157137862 18:45074919-45074941 TGATGAGGATGCAGAGAAGTTGG - Intergenic
1157264543 18:46206733-46206755 GGAGGAGAATGAAGAGAAGTGGG - Intronic
1157328446 18:46686013-46686035 GGATGGGGCTGGAGAGAAGAAGG + Intronic
1157398064 18:47360209-47360231 ATGGGGGGATGAAGAGAGGTTGG - Intergenic
1157483556 18:48071498-48071520 TGGTGAGGATGTAGAGAAATTGG + Intronic
1157563777 18:48666084-48666106 TGGTGGGGATGTGGAGAAATTGG - Intronic
1157615137 18:48982417-48982439 CGGTGGGGAGGAAGGGAAGCAGG - Intergenic
1158583931 18:58712546-58712568 GGGGGTGGATGAAGAGAGGTTGG + Intronic
1158610361 18:58935093-58935115 GAGTGGGGAGGAGGAGGAGTGGG - Intronic
1158610367 18:58935109-58935131 GAGTGGGGAGGAGGAGGAGTGGG - Intronic
1158610373 18:58935125-58935147 GAGTGGGGAGGAGGAGGAGTGGG - Intronic
1158610379 18:58935141-58935163 GAGTGGGGAGGAGGAGGAGTGGG - Intronic
1158610385 18:58935157-58935179 GAGTGGGGAGGAGGAGGAGTGGG - Intronic
1158613617 18:58966016-58966038 GGTTTGGGATGTGGAGAAGTGGG + Intronic
1158725575 18:59968741-59968763 GGGTGGAGAGGAAGGGAAATCGG + Intergenic
1158845341 18:61436389-61436411 TGGTGAGGATGTGGAGAAGTTGG - Intronic
1159111658 18:64066099-64066121 GAAGGGGGATGAAGAGAGGTTGG - Intergenic
1159327270 18:66938460-66938482 GAGTGGTAAGGAAGAGAAGTGGG - Intergenic
1159483201 18:69017778-69017800 GGGAAGGAATGAAGAGATGTTGG - Intronic
1159825425 18:73202877-73202899 GGGTCGGGAAGAAGAGATGTGGG + Intronic
1160065693 18:75572342-75572364 TGGTGAGGAGGAAGAGAAATAGG - Intergenic
1160122225 18:76140798-76140820 GGGAGGGGACAGAGAGAAGTGGG + Intergenic
1160214826 18:76919541-76919563 GGCGGGGGATGAACAGAGGTTGG - Intronic
1160628945 18:80232143-80232165 GGGTGGAGATAAAGAGTGGTAGG + Intronic
1161218957 19:3109187-3109209 GTGTGAGGGTGAAGAAAAGTGGG + Intronic
1161425087 19:4198660-4198682 GGGTGGGGGGGAACAGAGGTTGG + Intronic
1161490442 19:4558183-4558205 GGCTGGGGGTGAAGAGAGGGTGG + Intronic
1161641711 19:5427777-5427799 GGGTGGGGAAGAGGAGGCGTAGG + Intergenic
1161903311 19:7136059-7136081 CGGTGAGGATGAGGAGAAATCGG - Intronic
1161994953 19:7706293-7706315 GGGTGGGGAGGAAGGGCAGTAGG + Intergenic
1162024719 19:7887533-7887555 GGGTGGGGAGGCAGAGAAGCTGG + Intergenic
1162159361 19:8699952-8699974 GGTTGGGGATGGAGAGAGGCAGG + Intergenic
1162222893 19:9193754-9193776 GGAGGGGGTTGAAGAGAAGTTGG + Intergenic
1162524156 19:11197666-11197688 GGGTGGGGATGGAGAGACGCTGG + Intronic
1162548494 19:11345462-11345484 GGGTGGGGATGGAAATAAGAGGG - Intronic
1162927753 19:13938559-13938581 GGGTGGGGATGGAGGGATGGGGG + Intronic
1163038426 19:14585005-14585027 GGATGGGGATGAAGATGAGGTGG - Intronic
1163319698 19:16566893-16566915 TGGTGAGGATGAAGTGAAGTAGG + Intronic
1163520473 19:17788595-17788617 GAGAGGGGAGGAAGAGAAGGTGG + Intergenic
1163655197 19:18541847-18541869 GGGTGAGGAGGAAGAGGAGGAGG - Exonic
1163775367 19:19214167-19214189 AGGTGGGGGTGAAGTGAAGGAGG + Intronic
1164441134 19:28281771-28281793 GGTTGGAGAAGAAGAGAAGAGGG - Intergenic
1164600533 19:29560465-29560487 GGGAGGGAACCAAGAGAAGTGGG - Intronic
1164658345 19:29940900-29940922 GGCTGGGGATGGAGAGAGGATGG + Intronic
1164738551 19:30560047-30560069 GGATGGGGATGATGAGGAGGAGG - Intronic
1165183055 19:33989429-33989451 GGGAAGGGATGAAGAGAAGATGG - Intergenic
1165263803 19:34643428-34643450 GGGGGGAGATGAAGAGAGGGAGG + Intronic
1165269675 19:34695207-34695229 GGGAGGGAATGAAGAGAGCTAGG + Intergenic
1165345534 19:35246804-35246826 TGGTGGGGATGTGGAGAAATTGG + Intergenic
1165491500 19:36126043-36126065 AGGTGGGAATGATGAGAAGATGG - Intergenic
1165718359 19:38061717-38061739 GGGCGGAGATGAAGAGAGATGGG + Intronic
1165772609 19:38387855-38387877 GGGTGCGGGTGAAGGCAAGTGGG + Intronic
1165773218 19:38390016-38390038 GGGTGGGGACGGAGAGATGGGGG + Intronic
1166022617 19:40046109-40046131 GGTGGGGGATGAAGAGGAGTTGG + Intronic
1166121896 19:40691368-40691390 GGGTGGGGAAGGCGAGAAGGAGG + Intergenic
1166198953 19:41223787-41223809 GGGAGGGGAGGGAGAGAAATGGG + Intronic
1166516931 19:43454125-43454147 GGGTGGAAGTGAAGAGATGTGGG + Intergenic
1166890281 19:45987571-45987593 GGGTGAGGATGGAGAGGAGGTGG - Intergenic
1167063989 19:47170478-47170500 GGGGGGCGGTGAAGAGAAGTTGG - Intronic
1167087749 19:47321877-47321899 GTGTGGGGGTGGAGGGAAGTGGG - Exonic
1167169131 19:47819696-47819718 GGGTGGGGGTACAGAGAGGTGGG - Intergenic
1167220619 19:48196172-48196194 GGGTGGGGGTCAAAAGAAGAAGG + Intronic
1167253947 19:48415976-48415998 GGGTGGGGGCGATGAGGAGTGGG - Intronic
1167473060 19:49686034-49686056 AGGAGGGGATGAAGCGAGGTGGG + Intronic
1167569664 19:50279139-50279161 GGGTGGGGTGGGGGAGAAGTGGG - Intronic
1167620195 19:50556262-50556284 GGGTGGGGGTGAGGTGCAGTGGG + Intronic
1167726336 19:51215674-51215696 AGATGGGGCTAAAGAGAAGTGGG - Intergenic
1167727642 19:51227352-51227374 TGGTGAGGATGTAGAGAAGAGGG - Intronic
1167775650 19:51553020-51553042 GGGAGGGGAGGAAGAGGAGGGGG + Intergenic
1167885412 19:52495873-52495895 GGGAGTGGGGGAAGAGAAGTAGG + Intronic
1167986433 19:53321744-53321766 CGTGGGGGATGAAGAGAGGTTGG - Intergenic
925095862 2:1201400-1201422 GGGGGGAGGTGAAGAGAAGTTGG + Intronic
925365382 2:3307703-3307725 AGGCAGGGATGAAGAGAAGCTGG + Intronic
925459951 2:4053262-4053284 GAGTGAGGATGAAGAAAGGTTGG - Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926451668 2:13011799-13011821 GAGTGGGGATGAACAGAGGTGGG - Intergenic
926768330 2:16344863-16344885 GCGGGGGAATGAAGAGAGGTTGG + Intergenic
926907472 2:17819496-17819518 GGTAGGGGATAAAGAGAGGTTGG - Intergenic
927035487 2:19170916-19170938 AGGGGAGGATGAAGAGAGGTTGG - Intergenic
927158488 2:20236187-20236209 GGGTGGGGATGACAGGAAGCTGG + Intergenic
927181877 2:20452449-20452471 GGGTGGGGAGGGAGATAATTGGG + Intergenic
927185148 2:20477013-20477035 GTGTGGGAAAGAAAAGAAGTTGG + Intergenic
927428614 2:23007993-23008015 GGGTGGGGCTGAAGGGGAGAGGG + Intergenic
927734431 2:25506150-25506172 GGGGAAGGATGAAGAGAGGTTGG + Intronic
927884536 2:26710393-26710415 GGGTGCAGATGAAGAGCAGTGGG + Intronic
928022624 2:27716038-27716060 GGGAGGGGAGGAAGGGAAGGGGG - Intergenic
928142412 2:28741286-28741308 GGATGGTGTTGAAGAGAAGTTGG + Intergenic
928144198 2:28757041-28757063 GGGAGGGAATGGAGAGAAATGGG - Intronic
928169846 2:28996376-28996398 GGGGTGGAATGAAGAGAGGTTGG - Intronic
928252190 2:29690915-29690937 TGGTGGTGAAGATGAGAAGTGGG - Intronic
928354099 2:30593040-30593062 CGGGAGGGATGTAGAGAAGTTGG - Intronic
928613164 2:33010379-33010401 TGGGGGGGATGAAGAGAAATTGG + Intronic
928660851 2:33500451-33500473 CGGTGGAGATGAAGGGCAGTGGG + Intronic
928909324 2:36402700-36402722 AGCTGGAGATGAAGAGAATTAGG + Intronic
928926537 2:36585505-36585527 GGGTGGGGAGGGAGAGCAGAAGG + Intronic
928935698 2:36675528-36675550 TGGTGAGGATGTAGAGAAATTGG + Intergenic
929072899 2:38051658-38051680 GGGAGAGGATGAAGAGAGGTTGG - Intronic
929096452 2:38267294-38267316 GGATGAGAAAGAAGAGAAGTTGG - Intergenic
929564498 2:42976057-42976079 GGCTGTGCATGCAGAGAAGTAGG + Intergenic
929609296 2:43258040-43258062 GTGTGAGGATCAAGAGCAGTAGG - Intronic
929647335 2:43640576-43640598 TGGTGAGGATGTAGAGAAATGGG - Intronic
929716008 2:44310291-44310313 TGGTGAGGATGAAAAGAAATTGG - Intronic
930254480 2:49074523-49074545 TGGTGAGGATGAAGAGAAAAGGG + Intronic
930540099 2:52694882-52694904 GGTTGGGGATGGAGAGAACAGGG + Intergenic
931134570 2:59382894-59382916 GTGAGAGGATGAAGAGAGGTTGG + Intergenic
931301111 2:60979294-60979316 GGATGGGGAGGAGGAGAAGGAGG - Intronic
931329888 2:61270041-61270063 GGGATGGGATGAAGAGAGATTGG - Intronic
931381489 2:61757692-61757714 GGTGGGGGTTGAAGGGAAGTGGG - Intergenic
931829754 2:66038536-66038558 GTGTGAGGATGAAGAGCAGCAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
932693341 2:73932247-73932269 GTGGGGTGATGAAGAGTAGTGGG - Intronic
932806124 2:74784981-74785003 GGGTGGGGATAAAGAGTAACTGG + Intergenic
932881208 2:75503782-75503804 GAGGGAGGATGAAGAGAAGCGGG + Intronic
933019102 2:77168682-77168704 GAATGGGGGTGAAGAGAGGTTGG - Intronic
933053860 2:77636362-77636384 GGGAAGGGATTAAGAGAGGTTGG - Intergenic
933067876 2:77820600-77820622 GGGTGGAGATGAAAAGATGGGGG + Intergenic
933350026 2:81142083-81142105 GAGAGGGGATGAAGAGAAGTTGG - Intergenic
933679216 2:85084307-85084329 GGGTGGGGTGGGAGAAAAGTAGG + Intergenic
933946035 2:87286845-87286867 GGGTTGGGTTCAAGAGAATTGGG + Intergenic
934698397 2:96417297-96417319 TGGTGAGGATGCAGAGAAGTAGG - Intergenic
934846168 2:97662665-97662687 GGGTTGCGATGAAGAGTGGTGGG - Intronic
934874340 2:97901800-97901822 GAGGGAGGATGAAGAGAGGTAGG + Intronic
934905338 2:98196123-98196145 GGGTGGGGATGGGGAGATGTTGG + Intronic
935124265 2:100209168-100209190 AGAAGGGGATGAAGAGAGGTTGG - Intergenic
935135377 2:100295828-100295850 GAGAGGGGAGGAAGTGAAGTAGG + Intronic
935275978 2:101475466-101475488 TGGTGAGGATGTAGAGAAATTGG + Intergenic
935686231 2:105686182-105686204 GCGGGGAGATGAAGAGAGGTTGG + Intergenic
935688309 2:105706437-105706459 GGGGGAGGATGAAGAGAGGTTGG + Intergenic
935749573 2:106219400-106219422 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
935974891 2:108568655-108568677 AGGTGGGGATGTGGAGAAATTGG - Intronic
935999357 2:108811123-108811145 GGGAGGGGAAGAAGGGAAGAAGG - Intronic
936121725 2:109751917-109751939 GGCGGGGGATGAAGGGCAGTAGG - Intergenic
936222970 2:110619555-110619577 GGCGGGGGATGAAGGGCAGTAGG + Intergenic
936679797 2:114757147-114757169 GGGTGGGGAGGGAGAGAGGTGGG + Intronic
936735318 2:115434809-115434831 AGGGAGGGATGAAGAGAAGTTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936806538 2:116339236-116339258 GAGTGGAGAAGAAGAGAATTTGG - Intergenic
936993007 2:118386096-118386118 AAGTGGGGATGAAGAGAGGGAGG + Intergenic
937131372 2:119516564-119516586 GGGTGGGAATGGAGAGATATAGG + Intronic
937219412 2:120333186-120333208 GGGTGTTGATGAAGAGAAGAGGG - Intergenic
937299054 2:120827395-120827417 TGGTGAGGATGTGGAGAAGTTGG + Intronic
937399548 2:121570175-121570197 GGGTGGGGAGGGAAAGAAGGAGG - Intronic
937464288 2:122116749-122116771 GAGGGAGTATGAAGAGAAGTGGG - Intergenic
937638392 2:124183827-124183849 AGATGGGGAGGAAGATAAGTAGG + Intronic
938546934 2:132342139-132342161 GGGTGTGTAGGAGGAGAAGTAGG - Intergenic
938584509 2:132676319-132676341 GGGAGTGGATGAGGTGAAGTAGG - Intronic
938604673 2:132880159-132880181 GAGAGGGGATGAAGAGACATTGG + Intronic
938660518 2:133481959-133481981 GAGGGTGGGTGAAGAGAAGTGGG - Intronic
938823644 2:134983175-134983197 GGTGGGCGATGAAGAGAGGTGGG - Intronic
938828570 2:135031648-135031670 ATGTGGGGAAGAAGGGAAGTGGG + Intronic
938866657 2:135428892-135428914 TGGTGGGGTTGAAGAGAAATGGG + Intronic
939593055 2:144089783-144089805 AGGGGAGGATGAACAGAAGTGGG + Intronic
939783882 2:146484202-146484224 GGAGAAGGATGAAGAGAAGTGGG + Intergenic
939888053 2:147702804-147702826 GAGTGGGGAGGAAGAAAACTTGG + Intergenic
940316965 2:152336020-152336042 GCGTGGGCGTGAAGAGAAGGTGG + Intronic
940324428 2:152410652-152410674 GGGTGGGGGTGAAGGGATGGTGG - Intronic
940555451 2:155221155-155221177 GGGTGGGGAGGAAGTGGAGATGG + Intergenic
940781708 2:157940283-157940305 AGGTGGGAATGAGGAGAAGGGGG - Intronic
941153121 2:161940171-161940193 GGGAGGAGAGGAAGGGAAGTGGG - Intronic
941188026 2:162341740-162341762 GGTTGGGGATGGAGAGAAAAGGG + Intronic
941610975 2:167661906-167661928 GGGTGGGTTTGAAGACAAGTAGG + Intergenic
943012486 2:182467154-182467176 GGGAGGGGAGGAAGAGAAAGAGG + Intronic
943126302 2:183796897-183796919 TGGAGAGGATGAAGAGAAATAGG + Intergenic
943175657 2:184470086-184470108 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
943372455 2:187031727-187031749 AGTTGGGGATGAAGAGAGTTAGG + Intergenic
943572454 2:189589826-189589848 GAGTAAGGATGAAGAGAAGTTGG - Intergenic
943689449 2:190854518-190854540 GGGTGGGGAAGAAAATAAATGGG + Intergenic
943769978 2:191705640-191705662 GGGTGCGCATGCAGAGAAGTGGG + Intergenic
944117411 2:196204297-196204319 TGGTGAGGATGTAGAGAAATTGG - Intronic
944155007 2:196598513-196598535 GGGAGGGGATGGAGAGAGGAGGG + Intergenic
945175988 2:207043951-207043973 AGGTGGGGAGGAAGAAAAGAAGG + Intergenic
945363820 2:208926627-208926649 TGGTGAGTATGAAGAGAAGCTGG + Intergenic
945374908 2:209068283-209068305 AGGGGAGGATGAAGAGAGGTTGG + Intergenic
945410393 2:209499771-209499793 GGGTGGGGAGGAAAAGGAGAGGG + Intronic
945635088 2:212339147-212339169 GGTTGGGGAGGGAGAGAATTAGG - Intronic
945686989 2:212983546-212983568 AGTGGGGGATGAAGAGAGGTTGG + Intergenic
945802937 2:214456172-214456194 TGGTGAGGATGAAGAGAAAAAGG - Intronic
945865941 2:215175768-215175790 GAGAGGGCATGAAGAGAGGTTGG - Intergenic
945975154 2:216264633-216264655 GGGTGTGGAGAGAGAGAAGTGGG + Intronic
945983875 2:216339306-216339328 GGGTGGAGATGAGGAGCAGAGGG - Intronic
946262653 2:218507696-218507718 GGGAGGGGAAAAAGAGAGGTTGG + Intronic
946298373 2:218805250-218805272 GGGTGGGGAAGAGGATACGTAGG - Intronic
946605943 2:221404866-221404888 AGTGGGGAATGAAGAGAAGTTGG - Intergenic
946800707 2:223413323-223413345 GGGTGGGAAGGTAGAGAAGGAGG - Intergenic
946907558 2:224431024-224431046 AGATGGTGATGAAGAGCAGTGGG - Intergenic
947201033 2:227614855-227614877 GGATGCGGATGAAGTGAAGAAGG + Intronic
947249169 2:228081795-228081817 GGGTGGGGTTGAGAAGATGTTGG + Intronic
947440009 2:230111209-230111231 TGGGCAGGATGAAGAGAAGTGGG + Intergenic
947544083 2:230998734-230998756 TGGTGAGGATGTAGAGAAGCTGG + Intronic
947641968 2:231711946-231711968 AGGTGGGGAGGAAGAGGAGGAGG + Exonic
948106069 2:235414685-235414707 GAGTGGGTATGAAGGGAACTGGG + Intergenic
948221187 2:236270965-236270987 GGGTGGGAGGGAAGAGAAGAGGG + Intergenic
948314189 2:237014589-237014611 AGGTGGGGAGGATGGGAAGTCGG - Intergenic
948321218 2:237071433-237071455 GGGTGGGAATGAGTAGAACTTGG + Intergenic
1168857589 20:1019678-1019700 GGGTGGGGGTGAATAGCAGATGG - Intergenic
1168868368 20:1108323-1108345 GGATGGAGACAAAGAGAAGTAGG + Intergenic
1169032924 20:2425982-2426004 AGGCAGGAATGAAGAGAAGTTGG - Intronic
1169170760 20:3463058-3463080 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1169220939 20:3822360-3822382 GAGTGGGGACGCAGAGAAATAGG + Intronic
1169322793 20:4648134-4648156 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1169539135 20:6580901-6580923 GGGTGGGGTTGAGGTAAAGTGGG - Intergenic
1169597978 20:7222652-7222674 TGGGGGGGATGAAAAGAGGTTGG - Intergenic
1170064501 20:12296055-12296077 GTGTGGGAATGAAGAGAGATTGG - Intergenic
1170123064 20:12932226-12932248 TGGTGAGGATGAAGAGAAACTGG - Intergenic
1170170794 20:13409950-13409972 AGGAGGGAATGAAGAGAGGTCGG - Intronic
1170240234 20:14157528-14157550 GAGGGGGGATGAAGAGAGGTTGG - Intronic
1170335581 20:15267168-15267190 GAGTGGGGATGCAGAGGAGAGGG - Intronic
1170376114 20:15701807-15701829 GGTTGGGGAGAAAGAGAAGGGGG - Intronic
1170456238 20:16536351-16536373 TGGGGGGAGTGAAGAGAAGTAGG + Intronic
1170490616 20:16869870-16869892 GGGTTGGGAGGAAGTGGAGTTGG + Intergenic
1170634082 20:18089594-18089616 AAGTAGGGGTGAAGAGAAGTTGG + Intergenic
1170801938 20:19597702-19597724 GAGGGGAGATGAAGAGAGGTTGG - Intronic
1171064422 20:22000118-22000140 AGGTGGTGATGAAGAGGGGTTGG + Intergenic
1171101669 20:22389421-22389443 GGGTGGGAATAAAGAGATGTAGG + Intergenic
1171104909 20:22423558-22423580 GTGTGAGGATGAAGTGGAGTAGG - Intergenic
1171111039 20:22482788-22482810 GGAGGGGGAGGAAGAGAACTGGG - Intergenic
1171247555 20:23624542-23624564 GGGGGAGGATGAAGAGAAGTGGG + Intergenic
1171875799 20:30574872-30574894 GGGTGTGTAGGAGGAGAAGTAGG - Intergenic
1172017595 20:31887277-31887299 GGGGAGGGAGGGAGAGAAGTTGG - Intronic
1172054809 20:32146749-32146771 CGGTGAGGATGAGGAGAAGTTGG - Intronic
1172077570 20:32310950-32310972 GGGTGGGGAAGAGGAGGAGGAGG + Exonic
1172338789 20:34138828-34138850 GAGTGGGGAGGAAGAGAGTTTGG + Intergenic
1172383420 20:34515752-34515774 GGGAGGGTATGAAGGCAAGTGGG - Intergenic
1172422987 20:34833583-34833605 AGATGGGGAGGAAGAGAAGGAGG - Intergenic
1172433691 20:34913533-34913555 GGGTGGGGCTCTGGAGAAGTAGG + Intronic
1172694391 20:36812185-36812207 GGGTGAGGATGAGGAGGAGGAGG - Intronic
1173143677 20:40506625-40506647 GGGGGGGGATGTGGAGAAGTTGG - Intergenic
1173693807 20:44989244-44989266 TGGCGAGGATGCAGAGAAGTTGG - Intronic
1173937054 20:46875860-46875882 GGAAGGGGATGAACAGAAGCTGG - Intergenic
1173941069 20:46911796-46911818 TGGGGGTGATGAAGAGAAGCTGG + Intronic
1174536266 20:51253949-51253971 GGTGGGGGATGAAGGGAGGTGGG - Intergenic
1174630859 20:51955843-51955865 GGTTGGGGATGAAGAGAGGATGG + Intergenic
1174839543 20:53888577-53888599 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1174917721 20:54670641-54670663 GGAGGAGGATGAAGAGAAGTGGG + Intergenic
1174957794 20:55119732-55119754 TGCAGGGAATGAAGAGAAGTTGG - Intergenic
1174969622 20:55259514-55259536 GCGTGGGGAGGAAGATAAGTGGG - Intergenic
1175345263 20:58268521-58268543 GGGTGGGAATGAAGAGGAGCGGG + Intergenic
1175387437 20:58606200-58606222 GGGTGCGGATGGGGAGATGTGGG - Intergenic
1175415888 20:58800684-58800706 GGGTGCTTAGGAAGAGAAGTGGG + Intergenic
1175857306 20:62129015-62129037 GGGAGGAGATGGAGAGAGGTGGG + Intronic
1175891596 20:62318277-62318299 GGGAGGGGAGGAAGAGGAGGAGG + Intronic
1176017993 20:62946732-62946754 GTTTGAGGATGAAGATAAGTTGG + Exonic
1176738941 21:10579994-10580016 TGGTGAGGATGAAGAGAAAAGGG - Intronic
1176897493 21:14398812-14398834 GAATGGGGATGAAGAGAGGTTGG - Intergenic
1177219856 21:18178680-18178702 GGGTGGGGATGAAGACCTGTAGG - Intronic
1177974776 21:27834290-27834312 GGGTGAGATTGAAAAGAAGTTGG - Intergenic
1178017108 21:28360063-28360085 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1178070185 21:28956131-28956153 AGCAGGGGATGAAGAGAGGTCGG + Intronic
1178095512 21:29211104-29211126 TGGTGAGGATGTAGAGAAATTGG + Intronic
1178190389 21:30273287-30273309 GGGTGGAGATAAAGAGGAATGGG - Intergenic
1179027713 21:37693580-37693602 GAGTGGGCAGGAAGAGAGGTGGG + Intronic
1179133492 21:38660304-38660326 GGGTGCGGATGGAGAGGAGGGGG - Intronic
1179253031 21:39689565-39689587 GGAGGGGGATGAAGAGAGGTTGG - Intergenic
1179366571 21:40764458-40764480 TGGTGAGGATGCAGAGAAATAGG + Intronic
1179383627 21:40921576-40921598 GAGAAGGGATCAAGAGAAGTTGG + Intergenic
1179587855 21:42385072-42385094 GGGTGGGGAGGAAAAGAGGAAGG - Intronic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180047510 21:45316413-45316435 GGGTGGGGGTGGAGAGCATTAGG + Intergenic
1180629219 22:17215808-17215830 CATGGGGGATGAAGAGAAGTTGG + Intronic
1180930234 22:19585301-19585323 GGAGGAGGATAAAGAGAAGTTGG - Intergenic
1180977636 22:19857850-19857872 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
1180993308 22:19951740-19951762 GAGTGGGGAGGAAGAACAGTGGG + Intronic
1181117252 22:20640171-20640193 GGAGGGGAATGAAGAGAAGTTGG + Intergenic
1181498914 22:23304702-23304724 CGGTGAGGATGTAGAGAAATGGG - Intronic
1181674979 22:24445497-24445519 GTGTGGGGAGGAGGAGAAGGTGG - Intergenic
1182109063 22:27710129-27710151 GGGTGTGAATGACGGGAAGTGGG + Intergenic
1182232617 22:28850014-28850036 GGGGGGTGATGAAGAGAGGTGGG - Intergenic
1182378265 22:29864770-29864792 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1182566275 22:31202456-31202478 GGGTGGGGATGAGAATAACTGGG - Intronic
1183085406 22:35483783-35483805 GGGAGGGGAAGAAGAGAGGAAGG + Intergenic
1183087255 22:35493988-35494010 AGCTGGGGAGGAGGAGAAGTGGG - Intergenic
1183130711 22:35832492-35832514 GGCAGGGGATGGAGAGAGGTTGG + Intronic
1183152312 22:36047506-36047528 GGATGGGGATGGAGAGAATGAGG - Intergenic
1183377055 22:37471492-37471514 GGATGGGGGTGGAGAGGAGTTGG - Intronic
1183616174 22:38947079-38947101 GGTTGGGGATGATGGGAAATGGG - Intergenic
1183672511 22:39281376-39281398 GGAGGGGGATGGAGAGCAGTGGG - Intergenic
1183724559 22:39581217-39581239 AAGTGGGGAGGCAGAGAAGTGGG + Intronic
1184449465 22:44574484-44574506 GGGTGGGGAGGAAGAAGAGGAGG + Intergenic
1184609051 22:45590810-45590832 GGTAGGGGAGGAAGGGAAGTGGG + Intronic
1184667987 22:45998539-45998561 GGGTGGGGATGAGGAGCGGCAGG - Intergenic
1184742778 22:46438702-46438724 GGAAGGGGCTGAAGAGAAGTGGG + Intronic
1184945563 22:47801601-47801623 GGATGGGGAGGATGAGAAGCAGG - Intergenic
1185160619 22:49226979-49227001 TGGTGAGGATGTAGAGAAATGGG + Intergenic
1185314423 22:50172698-50172720 GGGTGGTGAAGAAGAGAAAAGGG - Intronic
949092858 3:50033-50055 GGGGGAGAATGAAGAGAGGTTGG - Intergenic
949649924 3:6145502-6145524 GGGTGGGGCAGGAGGGAAGTAGG - Intergenic
949687606 3:6594400-6594422 GGGTGAGGATGTAGAGAAAAGGG - Intergenic
949753354 3:7379909-7379931 GGGTGATGATGAAGGGAAGGCGG - Intronic
949860354 3:8499589-8499611 GTGAGGGGATGAACAGAGGTTGG + Intergenic
949863217 3:8525190-8525212 GGCTGAGGATTAAGAGAAATGGG - Intronic
949949845 3:9220041-9220063 GGGCGGGGAGGAAGAGAGGTTGG + Intronic
950333166 3:12173378-12173400 GGGTGGAGGTGCAGATAAGTGGG - Intronic
950505542 3:13392205-13392227 GGATCGGGGTGAAGAGAAGCAGG - Intronic
950616819 3:14166501-14166523 GGGTGGGGGTGAAGGGAGGGTGG - Intronic
950634783 3:14307234-14307256 GGGTGGGGATGCAGGGGAGGTGG + Intergenic
950725411 3:14913922-14913944 GTGTGGGGAAGAAGAGAAGCAGG - Intronic
950773531 3:15331635-15331657 GGTTGGGCATGAAAAGAAATCGG - Intronic
951606165 3:24437389-24437411 GGGGGAAGATGAAGAGAAGTTGG + Intronic
952017548 3:28976209-28976231 GGGTGGGGAGGAGGAGAAGGAGG - Intergenic
952339474 3:32433369-32433391 GGTTGGGGATGAAAAGAACATGG + Intronic
952490202 3:33863409-33863431 GGGTGGGGATGAAGAGAGGGTGG - Intronic
952549006 3:34454741-34454763 TGGTGAGGATGCAGAGAAATAGG - Intergenic
952754720 3:36856316-36856338 AGGTGGGGAGGAAGAGGAGGAGG - Exonic
952767776 3:36969793-36969815 GAATGGGGGAGAAGAGAAGTGGG + Intergenic
952835363 3:37597445-37597467 TGGTGGAGGTGAAGAGAAGAGGG + Intronic
952882061 3:37991387-37991409 GGGTGGGGAGGGAGAGAGGGAGG + Intronic
953013200 3:39047883-39047905 GGGTGAGGATGCAGAGAAAAGGG + Intergenic
953121854 3:40052164-40052186 AGGAAGGGATGAAGAGAAGTTGG - Intronic
953135103 3:40175454-40175476 AGGGAGGGAGGAAGAGAAGTGGG - Intronic
953193501 3:40711500-40711522 GGGGGAGGATGAAGAGAAGTGGG - Intergenic
953500382 3:43427275-43427297 GGGTGGGGATTGATAAAAGTGGG + Intronic
954102387 3:48385105-48385127 GAGGGGGAATGAAGAGATGTTGG - Intronic
954167813 3:48774566-48774588 GTGGGTGGATGAAGAAAAGTTGG - Intronic
954466479 3:50658091-50658113 GAGTGGGGCTGAGGAGATGTTGG + Intergenic
954569894 3:51631962-51631984 GGAGGGGGAGGAAGAGACGTTGG - Intronic
954667151 3:52261780-52261802 TGGTGAGGATGCAGAGAAATTGG + Intronic
954842331 3:53522898-53522920 GGAGGGGGATGAAGAGAGGTTGG - Intronic
954921386 3:54194088-54194110 GGTGGGGGATAAAGAGAGGTTGG + Intronic
954959085 3:54548853-54548875 GAGTGAGGAAGAAGAGAAGATGG - Intronic
954967448 3:54624002-54624024 GGGTGTGGAGGAGGAGAAGAGGG + Intronic
955088146 3:55722703-55722725 AGGTGGGCATGGAAAGAAGTAGG - Intronic
955460145 3:59173184-59173206 GGCAGGGGGTGAAGAGAGGTTGG - Intergenic
955632048 3:60985152-60985174 GGGAGGAGGTGAAGAGTAGTGGG - Intronic
955898798 3:63729421-63729443 GAGTGGGGATAAAGAGAGGCTGG + Intergenic
956330010 3:68096045-68096067 GGGGGAGAATGAAAAGAAGTTGG - Intronic
956330652 3:68103154-68103176 AGGTGAGGATGAGGGGAAGTGGG + Intronic
956331336 3:68113291-68113313 AGGTGGTGCTGCAGAGAAGTAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956729346 3:72182596-72182618 GGGTGAGGAGGAAGAGAAAGAGG + Intergenic
956839336 3:73122644-73122666 TGGTGAGGATGCAGAGAAATTGG + Intergenic
956990496 3:74757420-74757442 GGGCTGGGATGGAGGGAAGTGGG - Intergenic
957157709 3:76566725-76566747 GGGTGGAGAGGAAGAGAAGTGGG + Intronic
957413962 3:79877069-79877091 AGGTAGGGAAGAAAAGAAGTTGG - Intergenic
957446556 3:80319373-80319395 AGTTGGGGATGGAGAGATGTAGG - Intergenic
957558077 3:81785639-81785661 GGGTTGGAAGGAAGAGAGGTGGG + Intergenic
957618161 3:82559797-82559819 GGAGGAGGAAGAAGAGAAGTAGG + Intergenic
957941370 3:87008921-87008943 GAGGGGTGATGAAGAGAAGTTGG - Intergenic
957963345 3:87289471-87289493 AGGAGTGGATGAAGAGAGGTTGG + Intergenic
958040983 3:88226331-88226353 AGAGGGGGATGAAGAGAGGTAGG - Intergenic
958639271 3:96783930-96783952 GAGAGGGGCTGAAAAGAAGTTGG - Intergenic
958831136 3:99090955-99090977 GAGAGGGGATGAAGAGGAGTTGG + Intergenic
958878448 3:99641763-99641785 GGGTCTGGTTGAAGAGAAGGAGG - Intronic
958961625 3:100515850-100515872 GGAGGAGGATGAAGAGAGGTTGG + Intronic
959481943 3:106884416-106884438 TGGTGAGGATGAAGAGAAAAGGG + Intergenic
959599772 3:108168626-108168648 GGATGGGGAGGGAGAGCAGTAGG - Intronic
959760307 3:109955262-109955284 GAGAGGAGATGGAGAGAAGTTGG - Intergenic
960221311 3:115112435-115112457 GGGAGAGGATGAAGAGAGGTTGG - Intronic
960386458 3:117026871-117026893 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
960431607 3:117575968-117575990 TGGAGGGGATGAAGAGAAGTTGG - Intergenic
960454778 3:117857284-117857306 AGTTGGAGATGGAGAGAAGTAGG - Intergenic
960499905 3:118424485-118424507 AGGAGAGGATAAAGAGAAGTTGG + Intergenic
960807553 3:121598674-121598696 TGGTGGAGATGGAAAGAAGTGGG + Intronic
960864940 3:122190047-122190069 GACTGGGTAGGAAGAGAAGTGGG + Intronic
960930915 3:122848945-122848967 GTGGGAGGATGAAGAGAAGTTGG - Intronic
960947305 3:122975408-122975430 GGGTGGTGGGGAGGAGAAGTGGG - Intronic
961221516 3:125204584-125204606 TTGGGGGGATGAAGAGAGGTTGG + Intronic
961631035 3:128298711-128298733 GGGATGGGATAAAGAGAGGTTGG - Intronic
962063457 3:131953755-131953777 GAATGGGGGTGAAGAGAGGTTGG + Intronic
962147017 3:132850218-132850240 TGGTGGGGATGCAGTGAAATGGG - Intergenic
962528648 3:136258246-136258268 GGGTGGGAGTGAGGAGAAGGTGG + Intronic
962585644 3:136840488-136840510 GGGAGGGGAGGAAGAGGAGGAGG - Intronic
962598536 3:136971464-136971486 GTGGGAGGATGAAGAGACGTAGG - Intronic
962743315 3:138379156-138379178 GTGGGGGGATGAAGAGAAGTTGG - Intronic
962777473 3:138676325-138676347 TGGTGAGAATGAAGAGAAATTGG + Intronic
963224966 3:142853176-142853198 GGCTGAGGAAGAAGAGAAGAAGG + Intronic
963548291 3:146688778-146688800 AGGGGAGGATGAAGAGAGGTTGG - Intergenic
963615373 3:147530058-147530080 AGGAGGAGATGAAGAGAGGTTGG + Intergenic
963960303 3:151302666-151302688 GAATGGGTATGAAGAAAAGTAGG - Intronic
964245071 3:154642262-154642284 TGGAGGAGATGAAGAGAATTGGG - Intergenic
964601623 3:158507242-158507264 AGTGGAGGATGAAGAGAAGTTGG + Intronic
964736066 3:159919204-159919226 TGGTGAGAATGCAGAGAAGTGGG + Intergenic
965138285 3:164802916-164802938 GGGTAAGAATGAAGAGAAGTTGG - Intergenic
965404535 3:168252845-168252867 TGGTGGGTATGGAGAGAGGTTGG + Intergenic
965447367 3:168791692-168791714 ATGGGGAGATGAAGAGAAGTTGG + Intergenic
965631524 3:170738214-170738236 GGGGGAGGATGAAGAGAGGTTGG + Intronic
965667590 3:171111518-171111540 TGGTGAGGATGCAGAGAAGAGGG + Intronic
965721813 3:171670147-171670169 GGGTGGAGATAAAGAGAGGATGG + Intronic
965908249 3:173737889-173737911 TGGTGAGGATGCAGAGAAGTTGG - Intronic
966029963 3:175333687-175333709 CCGGGGGGATGAAGAGAGGTTGG + Intronic
966094237 3:176179322-176179344 TGGTGAGGATGAAGAGAAAAGGG + Intergenic
966178575 3:177166567-177166589 GAGTGTGAAGGAAGAGAAGTAGG - Intronic
966295993 3:178424196-178424218 AGTTGGGGATGAAGAAGAGTTGG - Intronic
966981027 3:185135504-185135526 GGGAGGGGATGAATAGAAGTTGG + Intronic
967254529 3:187576207-187576229 GGGTAGGGATGAGGTGAGGTCGG - Intergenic
967300791 3:188010122-188010144 GGTTGGGGCAGAAGAGAAGTAGG - Intergenic
967437917 3:189472171-189472193 GGGTGAGGATGTGGAGAAATTGG - Intergenic
967650302 3:191977559-191977581 TGGTGAGGATGTAGAGAAGTTGG + Intergenic
967768772 3:193311542-193311564 GGGTGGGGAGGGAAAGAAGGAGG + Intronic
967944182 3:194789342-194789364 GGGTGGGAATGAAGAAAGGTTGG - Intergenic
968227238 3:196980896-196980918 TGGTGAGGATGAAAAGAAATAGG + Intergenic
968256278 3:197275752-197275774 AGGAGGGGAGGAAGACAAGTTGG + Intronic
968647806 4:1749010-1749032 CGGTGGGGAGGGAGAGCAGTGGG - Intergenic
968692857 4:2004313-2004335 GAGTGGGGAGGAAGAGGACTGGG + Intronic
968983411 4:3863053-3863075 GGGTGGGGAGGGAGAGATGGGGG + Intergenic
969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG + Intergenic
969494840 4:7520624-7520646 GGGCGTGGATGCAGAGAGGTGGG + Intronic
969661578 4:8532673-8532695 GGGTGGGGGTGAGGGGAGGTGGG + Intergenic
969728066 4:8937272-8937294 GAAAGGAGATGAAGAGAAGTTGG + Intergenic
970473652 4:16400978-16401000 GGCAGGGCATGAACAGAAGTGGG + Intergenic
970923359 4:21421143-21421165 TGGTGAGGATGTAGAGAAGAGGG + Intronic
971052424 4:22876260-22876282 CAGTGGAGATGAAGAGAGGTGGG - Intergenic
971109054 4:23562041-23562063 GGGGGGAGATAAAAAGAAGTTGG - Intergenic
971149994 4:24021515-24021537 GGGTAGGGAGGGTGAGAAGTGGG + Intergenic
971188680 4:24405929-24405951 GAGTGGGGAGGAAGAAAAGAAGG - Intergenic
971341966 4:25778849-25778871 GGGGTGGGATGAAGTGAGGTAGG + Intronic
971468461 4:26991431-26991453 AGAGGGGAATGAAGAGAAGTTGG + Intronic
971530917 4:27687638-27687660 TGGTGAGGATGCAGAGAAATGGG - Intergenic
971682007 4:29712158-29712180 AGGAGGGGATAAAGAGAGGTTGG - Intergenic
972351685 4:38242155-38242177 GGCTGGGGGTGGAGTGAAGTAGG - Intergenic
972393335 4:38634052-38634074 GAGTGGAAATGAAGAGAAATGGG - Intergenic
972415713 4:38838595-38838617 GTGAGGGAATGAAGAGAGGTTGG + Intronic
972807857 4:42548679-42548701 GGGAAGGGATAAAGAGAGGTTGG - Intronic
972864414 4:43212950-43212972 GGGGGGGGAGGAAGAGCACTGGG - Intergenic
972954916 4:44377231-44377253 GCCAGGGGAGGAAGAGAAGTGGG - Intronic
973065898 4:45792066-45792088 GAAGGAGGATGAAGAGAAGTGGG + Intergenic
973257005 4:48123796-48123818 TGCTGAGGATGAAGAGCAGTTGG - Intronic
973629583 4:52807508-52807530 TGGTGAGGATGCAGAGAAATAGG + Intergenic
973942688 4:55926414-55926436 GGGAGGGGAAGAATGGAAGTGGG - Intergenic
974142762 4:57908701-57908723 AAGTGGGGATGGAGAGAAGCAGG + Intergenic
974244769 4:59300552-59300574 GGAGGAGGAAGAAGAGAAGTTGG + Intergenic
974453844 4:62100765-62100787 GGGAGGGAAGGAAGAGGAGTTGG - Intergenic
974495822 4:62625254-62625276 GGCTGGGGAAGTAGAGAATTTGG + Intergenic
975092125 4:70416242-70416264 GGGTGGGGAGGGAGAGCATTAGG + Intergenic
975379263 4:73679324-73679346 GAGTGGGGATGAAAAAGAGTGGG + Intergenic
975656589 4:76647277-76647299 TGGTGGTGATGAAGAGATGTTGG + Intronic
976122974 4:81803146-81803168 GGGTGGGGAAGAGGAGAAAAAGG - Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
976520720 4:86022232-86022254 TGGTGAGGATGTAGAGAAATTGG - Intronic
976623684 4:87155519-87155541 GGGGGAGGATGAAGACAAGTAGG + Intergenic
976748967 4:88434527-88434549 GGTTGGGGATGGAGAGGAGATGG + Intronic
977332374 4:95653592-95653614 GAGCAGGGATGAAGAGAAGGGGG - Intergenic
977457230 4:97276724-97276746 GCGTGGTGATGATGAAAAGTAGG - Intronic
977628680 4:99217353-99217375 TGGAGAGGATGATGAGAAGTGGG - Intronic
977739384 4:100459553-100459575 GGGTGGGAATGAGAAGATGTTGG - Intronic
977759429 4:100714391-100714413 GGGAAGGGATGAAGATAAGTTGG - Intronic
977939226 4:102840580-102840602 GAGGGGGGATGAAGAGACGTTGG + Intronic
977943318 4:102881291-102881313 GGGAGAGAATGAAGAGAGGTTGG + Intronic
978119326 4:105059592-105059614 GGGTGGGAATGGGGAGAAGAGGG + Intergenic
978142478 4:105333340-105333362 AGGAAGGGATGAAGAGAAGTTGG + Intergenic
978210191 4:106125763-106125785 AGATGGGGATGAAGAGAGGCTGG + Intronic
978613902 4:110574138-110574160 GGGGAGGGATGAAAAGAGGTTGG + Intergenic
978925714 4:114240580-114240602 TGGTCGGGATGCAGAGAAGAGGG - Intergenic
979308818 4:119178256-119178278 GGGTGTAAATAAAGAGAAGTTGG - Intronic
979402224 4:120262451-120262473 GGGTGAGGAGGAAGGGTAGTGGG + Intergenic
979763764 4:124439567-124439589 GGAGGGGGATGAAGAGAGCTGGG - Intergenic
980098852 4:128521201-128521223 GGGTGGAGAGGAAGAGAGGAAGG - Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980282054 4:130735337-130735359 GGGTGGGGAGGAAAAGAGGGAGG + Intergenic
980313309 4:131163439-131163461 GGAAGGGAATGAAAAGAAGTGGG - Intergenic
980687302 4:136244667-136244689 TGGAGAGGATGAAGAGAAATGGG + Intergenic
980769899 4:137357262-137357284 GGGGAGGGATGAAGAGACGCTGG + Intergenic
981147476 4:141342144-141342166 TGCTGAGGATGCAGAGAAGTTGG + Intergenic
981255450 4:142656208-142656230 GGGTGAGAATGGAGAAAAGTGGG - Intronic
981528898 4:145733513-145733535 GGCTGGGGAGGAAGAGTGGTAGG - Intronic
981564595 4:146085853-146085875 GGTTGGGGATGAAAAGAGGTTGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981680952 4:147397188-147397210 GGGATGGGTTGAAGAGATGTTGG + Intergenic
982044946 4:151435248-151435270 AGGAGAGAATGAAGAGAAGTTGG - Intronic
982107350 4:152022543-152022565 GGCTGTGGATGAAGAGCAGTAGG - Intergenic
982176817 4:152713466-152713488 GAGAGAGGATGAAGAGAAGTTGG + Intronic
982276262 4:153639768-153639790 GGGTGGGGTTGACGGGGAGTAGG + Intergenic
982440754 4:155433049-155433071 GGGAAGGGATGAAGAGAAGTGGG - Intergenic
982490875 4:156027866-156027888 AGTTGAGGATGAAGAGAGGTAGG + Intergenic
982543088 4:156699288-156699310 AGGGAGGGATGAAGAGAAGTTGG + Intergenic
982653409 4:158116525-158116547 TGGGAGGGATGAAGAGAGGTTGG + Intergenic
982852199 4:160332722-160332744 AGGTGGGGGTGAAGAGAAGTTGG - Intergenic
983428312 4:167615881-167615903 GGGAGGGAATTAAGAGATGTTGG - Intergenic
983526532 4:168765884-168765906 GGGTTGGGAGGAAGAGAAGAGGG + Intronic
983765152 4:171471062-171471084 TGGGAGGGATGAAGAGAGGTTGG - Intergenic
983907326 4:173197734-173197756 GGCTGTGGTTGGAGAGAAGTGGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984011282 4:174374847-174374869 GGGGGAAGATGAAGAGAAGATGG + Intergenic
984092616 4:175392755-175392777 TGGTGAGGATGCAGAGATGTTGG + Intergenic
984199747 4:176703487-176703509 TGGGGGGAATGAAGAGAGGTTGG + Intronic
984209553 4:176829059-176829081 GGGTAGGGATAAAGAGAATAGGG + Intergenic
984675125 4:182538698-182538720 TAGTGGAGTTGAAGAGAAGTGGG + Intronic
984783582 4:183548087-183548109 GGGAGGAGATGGAGAGATGTTGG - Intergenic
985080839 4:186262420-186262442 TGGTGAGGACGAAGAGAGGTTGG - Intergenic
985305390 4:188533794-188533816 GGGTGGGGAGGAAAAGGAATAGG + Intergenic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
985715723 5:1459882-1459904 TAGTGGGGATGCTGAGAAGTGGG - Intronic
985773928 5:1830747-1830769 GGAGGGGGAGGAAGAGAAGGAGG - Intergenic
985812289 5:2098992-2099014 GTGTGGGGCTGCAGAGGAGTTGG - Intergenic
985817834 5:2139698-2139720 GGGTGGGACAGAAGAGAACTGGG + Intergenic
986092406 5:4523262-4523284 GGGTGGTGATGGCGAGAAGTGGG + Intergenic
986380943 5:7185265-7185287 GGTGGGGGATGAACTGAAGTGGG - Intergenic
986639349 5:9857155-9857177 AGGAGGAGATGAAGAGAAGTTGG + Intergenic
986717684 5:10535569-10535591 GGGTGGGGTGGAAGGGTAGTGGG + Intergenic
987245008 5:16039953-16039975 GGGAAAGGAGGAAGAGAAGTTGG - Intergenic
987489947 5:18567498-18567520 GGGAGGGAATGAAGATAGGTTGG - Intergenic
987544435 5:19294633-19294655 GGGTGGAGATGAAGAGAGATTGG - Intergenic
987652829 5:20766265-20766287 AAGAGGAGATGAAGAGAAGTTGG + Intergenic
987797010 5:22640994-22641016 AGGTGAGGGTGAAGTGAAGTGGG - Intronic
987822896 5:22989013-22989035 GGATAGGCATGAAGAGAAATCGG + Intergenic
988249185 5:28732894-28732916 GAGTGGGGATGGGGAGATGTTGG - Intergenic
988609429 5:32711195-32711217 GGGTGGGGGTGGGGAGATGTGGG - Intronic
988641725 5:33048246-33048268 AGCAGGGGATGAAGAGAAGTTGG + Intergenic
988704816 5:33714807-33714829 GGCAGAGTATGAAGAGAAGTTGG + Intronic
988742729 5:34095219-34095241 AAGAGGAGATGAAGAGAAGTTGG - Intronic
989187617 5:38640408-38640430 GGGTGGGGCTTGAGAGAAGAAGG - Intergenic
989397274 5:40971218-40971240 TGGTGGGGATGTGGAGAAATAGG - Intronic
989809046 5:45650055-45650077 GGGGCAGGATGAATAGAAGTAGG - Intronic
989825952 5:45855054-45855076 GGCTGGGGATGATATGAAGTAGG - Intergenic
990249946 5:53903392-53903414 GGGTGGGGAAGCAGAGCAGGTGG + Intronic
990461055 5:56031478-56031500 TGGTGAGGATTAAGAGAGGTTGG + Intergenic
990770034 5:59233028-59233050 GGAGGGGAATGAAGAGAGGTTGG + Intronic
990842014 5:60092301-60092323 GGGAGGAGATGAAGAGAATTTGG + Intronic
991057285 5:62334495-62334517 GGGGGAGGAGGAGGAGAAGTGGG - Intronic
991278226 5:64877421-64877443 TGGGGGGGATGAAGAGAGATTGG + Intronic
991293169 5:65053015-65053037 GCAGGGGGGTGAAGAGAAGTGGG - Intergenic
991329754 5:65481625-65481647 GGGTGGGGAGGGAGAGAAAGGGG - Exonic
991388262 5:66114147-66114169 TGGGGAGGATGCAGAGAAGTTGG + Intergenic
991648784 5:68830146-68830168 GGAAGGGGGTGAAGAGAAGTTGG - Intergenic
991707102 5:69369213-69369235 GGGGGGGGGTGGAGAGAGGTCGG - Intronic
992154258 5:73939484-73939506 GGGAGGGGAGGAAGAGAGGTAGG - Intronic
992216512 5:74529514-74529536 GTGGGAGGATGAAGAGAGGTTGG + Intergenic
992525111 5:77602091-77602113 GGGTGGGGATGAAGAGAGGTTGG - Intronic
992550228 5:77852627-77852649 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
992748381 5:79840479-79840501 GGGTGAGGAAGAAGAGGAGGAGG - Intergenic
992800556 5:80291884-80291906 GGGCTGGGAAGCAGAGAAGTTGG + Intergenic
992882890 5:81128128-81128150 TGGTGGGGAGGAAGGGAAGCGGG + Intronic
993258729 5:85629035-85629057 TGGTGGGGAAGTAGAGAAATTGG - Intergenic
993287978 5:86024816-86024838 GGAAGGGGTTAAAGAGAAGTTGG + Intergenic
993345854 5:86781269-86781291 GGTAGGAGATGAAGAGAACTTGG + Intergenic
993419871 5:87687616-87687638 TGGTGAGGATGTGGAGAAGTTGG - Intergenic
993626576 5:90232204-90232226 GTGTGAGGATAAAGAGAGGTGGG + Intergenic
993948413 5:94143155-94143177 AAGAGGGAATGAAGAGAAGTTGG - Intergenic
993962774 5:94320457-94320479 GGGGGTGGATGAAGACAGGTTGG - Intronic
994219279 5:97176301-97176323 AGGTAAGGATGAAGAGAAGTGGG - Intronic
994334152 5:98544772-98544794 GGGGGGGTATGAAGAGAAGTTGG - Intergenic
994455845 5:100006702-100006724 GGAGAGGGATGAAGAGAAATTGG - Intergenic
994994036 5:107036853-107036875 CTGGGGGGATGAAGAGAGGTGGG + Intergenic
995306779 5:110660968-110660990 AAGTGGGGAAGAAGAGAGGTTGG - Intronic
995415542 5:111908421-111908443 GAGTGGGGAGGAAGAGATGTGGG - Intronic
995522885 5:113027485-113027507 AGGTGGGAATGAAGGGAAATTGG + Intronic
995911827 5:117196705-117196727 GAGTAGTGAGGAAGAGAAGTGGG - Intergenic
996055118 5:118973969-118973991 AGGTGGGGAGGAAGAGGAGGAGG + Intronic
996144830 5:119961419-119961441 AGGCTGGGATAAAGAGAAGTTGG + Intergenic
996268257 5:121569833-121569855 GGGGGAGGATAAAGAGAAATAGG - Intergenic
996354349 5:122579784-122579806 GGGTGGGGGTAAGGAGAAGAGGG - Intergenic
997343481 5:133166032-133166054 GGGAGAGGATGTAGAGAAATTGG - Intergenic
997577676 5:134995268-134995290 GGCAGGGGATGAAGAGAGGTTGG - Intronic
997774473 5:136588432-136588454 GGGAAAGGATGAAGAGAAGTGGG + Intergenic
998192834 5:140042184-140042206 GGTTGGGGTTGGAGAGAAGAAGG - Intronic
998925305 5:147117339-147117361 GCGGGAGGATGAAGATAAGTGGG - Intergenic
999038395 5:148379620-148379642 GGGTGAGGATGTGGAGAAATTGG + Intergenic
999583499 5:153065118-153065140 GGGTGGGGCCAAAGAGCAGTTGG + Intergenic
999628176 5:153542046-153542068 AGATTGGGATGAAGAGAAGTAGG - Intronic
999675724 5:154000213-154000235 GGGTGGGGATGAAGAGAAGTTGG + Intronic
999748936 5:154611735-154611757 GGGTGGGGATGAGCAGAGGGTGG - Intergenic
999858008 5:155616395-155616417 GGGGGGTGGTGAAGAGAGGTTGG - Intergenic
1000032515 5:157416482-157416504 GAGGGGGGATGAAGAGAGGTTGG + Intronic
1000116466 5:158158624-158158646 TAGTGGGAATGAAGAGAAGAGGG - Intergenic
1000525766 5:162355757-162355779 GGCAGGGAATGAAAAGAAGTTGG - Intergenic
1000541252 5:162542624-162542646 GGGTGGGGAGGGAGAGCATTAGG + Intergenic
1000642708 5:163721892-163721914 AGTGGGGAATGAAGAGAAGTTGG - Intergenic
1000809931 5:165848641-165848663 GGGTGAGGAGGAAGAGATGAGGG - Intergenic
1000819404 5:165965043-165965065 TGGTGAGGATGCAGAGAAATAGG - Intergenic
1000993555 5:167935620-167935642 AGGTGGTGAAGGAGAGAAGTTGG + Intronic
1001064353 5:168524124-168524146 GAGGGAAGATGAAGAGAAGTGGG + Intergenic
1001173462 5:169443701-169443723 GGGTGAGGTTGAAGAGGAGCAGG + Intergenic
1001349948 5:170951086-170951108 GGGGCAGGATGAAGAGAGGTTGG + Intronic
1001376165 5:171260519-171260541 GGGAGAGGATGAAGAGAAGTAGG + Intronic
1001601556 5:172932284-172932306 GGGAGAAGATGAAGAGCAGTTGG + Intronic
1001626993 5:173144467-173144489 GGGTGGGGAGGGAAAGAAGGTGG + Exonic
1001645085 5:173274411-173274433 GAGTGGGGATGAGGATTAGTTGG - Intergenic
1001665046 5:173425666-173425688 GTGTGGAGATGAAGAGGTGTGGG + Intergenic
1001722869 5:173870803-173870825 GGGTGAGGCTGAAGAGCAGCAGG + Intergenic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002462619 5:179382949-179382971 GGGTGGTGATGTTGAGAAGGTGG - Intergenic
1002510539 5:179713466-179713488 GAGAGGGGTTGAAGACAAGTTGG + Intronic
1002587190 5:180256598-180256620 GGGTGGGGATGGTGAGCAGGAGG + Intronic
1002714261 5:181216628-181216650 GGGAAGGGGTGAGGAGAAGTTGG + Intergenic
1002883475 6:1273404-1273426 GGGTAGAAATGAAGAGAGGTTGG + Intergenic
1003062349 6:2873609-2873631 AGGTGGTGAAGAAAAGAAGTAGG - Intergenic
1003077548 6:2996563-2996585 GCGTGAGAATGTAGAGAAGTTGG + Intronic
1003078913 6:3005378-3005400 AGGTGAGGATGCGGAGAAGTTGG - Intronic
1003098527 6:3159742-3159764 GGGTGGGGGTGGGGAGAAGGTGG - Intergenic
1003252185 6:4439688-4439710 GAGTGGGGCTGAAAAGAGGTTGG + Intergenic
1003286051 6:4734681-4734703 GGATGGGGATGGAGGGAAGATGG + Intronic
1003326411 6:5094843-5094865 GAAGGGGGATGAAGAGGAGTTGG + Intergenic
1003487863 6:6595283-6595305 AGGTGGGGAAGAAGAGGAGAAGG + Intronic
1003494315 6:6650851-6650873 GGGAGAGTATAAAGAGAAGTGGG - Intronic
1003693670 6:8380062-8380084 GGGTGAGGCTGGGGAGAAGTTGG + Intergenic
1004351359 6:14893071-14893093 GGTTGGGGATGGAGGGAAGGAGG + Intergenic
1004655796 6:17659043-17659065 GGGTGTTGTTGTAGAGAAGTAGG - Intronic
1004735214 6:18399219-18399241 GGGTGGGAATGGGGAGATGTTGG - Intronic
1004883364 6:20030258-20030280 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1004979723 6:21009850-21009872 AGGTGGTGATGAAGAGAGATTGG + Intronic
1005306948 6:24523010-24523032 GGGTGGGGATAGAGAGGGGTGGG + Intronic
1005509999 6:26504262-26504284 TGGTGGGGAGGAGGAGAAATAGG - Intronic
1005705770 6:28451241-28451263 GTGTGGGGGTGAAGAGAGGTTGG - Intergenic
1005880200 6:30051753-30051775 GGGGGGTGATGAAGAGAGGTAGG - Intergenic
1005951368 6:30633798-30633820 GGGTGGGGAGAAAGAGGAGAAGG + Intronic
1006063386 6:31442342-31442364 GGGGGGGGAGGAAGAGGAGGAGG + Intergenic
1006088914 6:31616310-31616332 GGATGGGGATGGGGAGAAGGTGG - Intronic
1006185073 6:32176950-32176972 GGGAGTGGAGGAAGAGAAGAGGG - Exonic
1006191023 6:32209361-32209383 AGGGGGAGATGAAGAGAGGTTGG + Intronic
1006361175 6:33588240-33588262 GGGAGGGGATGAGAAGAAGGAGG - Intergenic
1006451793 6:34109606-34109628 GGGTGGGTTTGAACAGAAATCGG - Intronic
1006576903 6:35053240-35053262 AGGAGGGGAAGAAGAGAAGGTGG + Intronic
1006909461 6:37554806-37554828 AGGTGGGGAGGAAGACAGGTGGG + Intergenic
1007811377 6:44488495-44488517 GGGTGGGGATTGAGAGGAGGGGG - Intergenic
1007823704 6:44581450-44581472 GGGTCGGGGTGGAGAGAATTTGG + Intergenic
1008254904 6:49285885-49285907 GGATGTGGATGAGGAGAAATAGG - Intergenic
1008345842 6:50425525-50425547 GGGTGGGTAAAAAGAGAGGTTGG + Intergenic
1008648846 6:53543983-53544005 GGGGAGGGAAGATGAGAAGTTGG + Intronic
1008653924 6:53591749-53591771 GTGGGGGAATGAAGAGAAGTTGG - Intronic
1008924064 6:56873723-56873745 GAGGGGAGATGAAGAGAGGTTGG + Intronic
1009408345 6:63336078-63336100 GGGGGAGGATTAAGAGAAGTGGG + Intergenic
1009481791 6:64168304-64168326 GGGTGAGAATGTAGAGAAGTGGG + Intronic
1009636462 6:66271273-66271295 GAAGGAGGATGAAGAGAAGTTGG + Intergenic
1009912052 6:69942506-69942528 GAGTGGGGATAGGGAGAAGTTGG - Intronic
1010246604 6:73665368-73665390 AAGGGGGGATGAAGAGAAGTTGG + Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010405501 6:75500998-75501020 GTGGGGAGAGGAAGAGAAGTGGG + Intergenic
1010475155 6:76277521-76277543 AGGGGGAGATGAAGAGAGGTTGG - Intergenic
1010484758 6:76396817-76396839 GAGCGGGAATGAAGAGAGGTTGG + Intergenic
1010538807 6:77064916-77064938 TGGTGGAGATGAAGAGAAACTGG - Intergenic
1010566501 6:77420815-77420837 GGGAGGGGATGGAGAGATATTGG + Intergenic
1010957917 6:82112183-82112205 TGGGAGGGATGAAGAGAGGTTGG + Intergenic
1011067493 6:83343139-83343161 GTGGGAGGATGAAGAGAGGTTGG - Intronic
1011656528 6:89557011-89557033 GGAAGGGGAAGAAGAGAAATGGG + Intronic
1011764838 6:90609738-90609760 GTGGGGGGAGGAAGACAAGTGGG - Intergenic
1011809842 6:91118433-91118455 GGGTGGGCATCAATAGAAGGAGG - Intergenic
1012488433 6:99748793-99748815 GGCTGAGGAGGAAGAGAAGGAGG + Intergenic
1012573544 6:100761896-100761918 GGGTGGGAATAAAGGGTAGTTGG - Intronic
1012607890 6:101181114-101181136 GGATGGGGAGGCAGAGAAGGAGG + Intergenic
1012627861 6:101426456-101426478 GAGGGGGGATAAAGAGAGGTTGG - Intronic
1012637378 6:101561389-101561411 AGGGGGGGATGAAAAGAAGTTGG + Intronic
1012646460 6:101689748-101689770 GTGTGGGAATGGAGAAAAGTGGG - Intronic
1012680042 6:102168821-102168843 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1012746579 6:103098255-103098277 GTGGGAGGATGAAGAGAATTTGG - Intergenic
1013060869 6:106632590-106632612 TGGTGAGGATGGAGAAAAGTTGG - Intronic
1013065517 6:106681150-106681172 GAGGGGGGATGAAAAGAAGAAGG + Intergenic
1013263665 6:108472227-108472249 GGGAAGGGATGAGGAGAGGTAGG + Intronic
1013453533 6:110308946-110308968 GACTGGGGATGGAGAGAAGAGGG + Intronic
1013715800 6:112960012-112960034 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1013890339 6:115019497-115019519 TGATGGGGATGAAGTGGAGTTGG + Intergenic
1014059589 6:117055360-117055382 TGGAGTGAATGAAGAGAAGTTGG - Intergenic
1014299072 6:119657922-119657944 GGTTGGGGGTGAAGTGAGGTAGG - Intergenic
1014344632 6:120252700-120252722 TGGTGAGGATGCAGAGAAATAGG + Intergenic
1014724550 6:124959522-124959544 AGGGGCAGATGAAGAGAAGTTGG + Intergenic
1014725046 6:124962901-124962923 GGGAGGGGATGAACAGCAGGAGG + Exonic
1015369181 6:132431423-132431445 GAGGGGAGATGAAGAGAGGTTGG - Intergenic
1015653293 6:135487795-135487817 AGGAAGGGATGAAGAGAAGTTGG - Intronic
1015857832 6:137644569-137644591 GGGGGGAGATGAAGAGAAATGGG - Intergenic
1016460014 6:144272162-144272184 GGGTGGGTATGGGGAGAGGTAGG + Intergenic
1016730809 6:147425571-147425593 TGGTGAGGATGTGGAGAAGTAGG - Intergenic
1017553929 6:155542624-155542646 TTGTGGGGATGAAGAGGAATTGG + Intergenic
1017557804 6:155591274-155591296 AGGTGGGAATGAAGAGAAGTTGG - Intergenic
1017612846 6:156209473-156209495 GAGGGGAGATGAAGAGAAGCTGG - Intergenic
1017944870 6:159087772-159087794 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1018271193 6:162079659-162079681 AGGTGGGGAAGGAGGGAAGTGGG - Intronic
1018550640 6:164994293-164994315 GAGGGGGGATAAAGAGAGGTTGG - Intergenic
1018706888 6:166469984-166470006 GGGTGGGGATGTGCAGAGGTGGG + Intronic
1018858408 6:167692122-167692144 GGGTGGGGACGGAGAGAGGGAGG + Intergenic
1019264595 7:106792-106814 TGGAGGGAATGAAGAGAAGGTGG + Intergenic
1019517496 7:1446366-1446388 GGGGGAGGAGGAAGAGAAGGGGG + Intronic
1019621222 7:1993141-1993163 GGGCGGGGATGAGGAGAAGGTGG - Intronic
1019772565 7:2892999-2893021 GGGTGGGGCTGGAGAGAAGCAGG + Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020416930 7:7957154-7957176 GGCTGGGGGTGAGAAGAAGTTGG + Intronic
1020510622 7:9052508-9052530 GGGTGAGGATGGGGAGATGTTGG - Intergenic
1021127755 7:16872959-16872981 TGGTGAGGATGCAGAGAAGAGGG + Intronic
1021248377 7:18292804-18292826 GGGAGGTGCTGAAGAGAACTGGG + Intronic
1021309697 7:19078605-19078627 GAGGGGGAATGAAGAGAGGTTGG + Intronic
1021424547 7:20485079-20485101 AGGTGGGGATGGAGAGAAAAGGG + Intergenic
1021453983 7:20809790-20809812 GGTTGGGGGTTAAGAGAATTGGG + Intergenic
1021471732 7:21010601-21010623 GGGGGAGGATGAAGAGAGGTTGG + Intergenic
1021545464 7:21808515-21808537 GAGAGGGGATGCAGAGAAGTTGG - Intronic
1021580038 7:22142778-22142800 GGATGGGGATGGTGAGAAGGAGG + Intronic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021690378 7:23224954-23224976 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1021739737 7:23674269-23674291 GGGTCGGGAGAAAGAAAAGTTGG - Intergenic
1021788678 7:24178265-24178287 GGGTGGGGAGGAGGAGAAATTGG + Intergenic
1021804090 7:24338020-24338042 GGGGAAGGATGAAGAGAGGTTGG + Intergenic
1022200092 7:28108273-28108295 GGGTAAGCATGAAGAGAGGTTGG - Intronic
1022250289 7:28600523-28600545 GGGAGGGGATGATGAGGAGGAGG + Intronic
1022350135 7:29560608-29560630 GGTGGGGGATGAAGATAATTAGG - Intergenic
1022381339 7:29862806-29862828 AGGTGGGGAAGAAGAGAAGAGGG - Intronic
1022388027 7:29919806-29919828 GGGTGAGGATGTGGAGAAATTGG - Intergenic
1022527844 7:31049838-31049860 GGGTGGGGAGGCAGAGAAGAGGG + Intergenic
1022616163 7:31932573-31932595 GGGTGAGGATGTGGAGAAATAGG + Intronic
1022638213 7:32157203-32157225 GAGGGGGGTTGAAGAGAAGTTGG - Intronic
1022665906 7:32410363-32410385 GGGCGGGTAGGAAGAGAAGGAGG + Intergenic
1022891953 7:34710266-34710288 GGGTGAGGATCAAAAGAATTGGG - Intronic
1022982973 7:35622046-35622068 GGGGAGGCAGGAAGAGAAGTTGG + Intergenic
1023175164 7:37429153-37429175 GGGTTGGAAAGAAGACAAGTTGG - Intronic
1023175182 7:37429262-37429284 GAGTGGGGAAGAAGACAAGTTGG - Intronic
1023307049 7:38841569-38841591 GGAAGGAAATGAAGAGAAGTGGG - Intronic
1023372421 7:39525044-39525066 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1023760607 7:43462190-43462212 GGGAGGGGGTGAAGAGGAGGAGG - Intronic
1023765362 7:43505332-43505354 CAGTGGAGATGAAGTGAAGTGGG - Intronic
1024046223 7:45587432-45587454 CGGTGGGGTTAGAGAGAAGTTGG + Intronic
1024049407 7:45609327-45609349 GGCTGGGGATGGAGAGGAGGCGG + Intronic
1024246361 7:47473059-47473081 GGGTGTGGATGCTGAGCAGTCGG - Intronic
1024616714 7:51121152-51121174 TGGCGGGGATGTAGAGAAATTGG - Intronic
1024657514 7:51464206-51464228 GGATGGAGATGGAGAGAAGTGGG + Intergenic
1024855795 7:53777496-53777518 TGGTGGGGATGTGGAGAAATTGG - Intergenic
1024898533 7:54289769-54289791 GAGGGGTGATGAAGAGCAGTTGG + Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1025066490 7:55860391-55860413 GTGGGGGGATGAACAGAGGTTGG + Intronic
1025617608 7:63136252-63136274 GACTGGGGAGGAAGAGACGTGGG + Intergenic
1026390693 7:69898640-69898662 GGTTGGGGATGAGGGGAGGTGGG - Intronic
1026505973 7:70983495-70983517 GGGGAGGAATGAAGAGAGGTTGG - Intergenic
1026506608 7:70989950-70989972 GGGTGGGGATGCCAAGAAGCAGG - Intergenic
1026576991 7:71580692-71580714 TGCAGGGGATGAAGAGAAGTGGG + Intronic
1026638459 7:72104536-72104558 GGGTGGGGAGGGAGAGCATTGGG - Intronic
1027047166 7:74998688-74998710 TGGTGGGGGTGAAAGGAAGTTGG + Intronic
1027134798 7:75616579-75616601 GGGTGGGGAGGAGGAGGAGGAGG + Intronic
1027464375 7:78496743-78496765 GGGTGGTGATGATGTGAAGTAGG + Intronic
1027649121 7:80843060-80843082 GGGTGCAGATAAAGAGAAGTTGG + Intronic
1027810120 7:82885671-82885693 GGGTAGGGATGAAGGGAAATGGG + Intronic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028302552 7:89218886-89218908 GGCTGGGGAGGAAGAGAAAGAGG + Intronic
1028369690 7:90076868-90076890 GGGTGGGCCTGAAGTGAGGTAGG + Intergenic
1028382801 7:90217387-90217409 AGGAGGGGAGGAAGAGATGTTGG - Intronic
1028519510 7:91714623-91714645 GGGGAAGGATGAAGAGAAGTGGG + Intronic
1028520688 7:91727128-91727150 GGGTGGTAATGAAAAGAGGTTGG + Intronic
1028630618 7:92929702-92929724 GGGTGGGGCTAAAAACAAGTGGG - Intergenic
1028787514 7:94812670-94812692 AGGAGAGAATGAAGAGAAGTGGG + Intergenic
1028869678 7:95755697-95755719 GGCTGGGGATGCAGTGCAGTGGG + Intergenic
1028893830 7:96018614-96018636 GAGTGATGCTGAAGAGAAGTTGG + Intronic
1028967150 7:96814898-96814920 GGGTGGGGAGGGAGAGCATTAGG + Intergenic
1029214330 7:98934978-98935000 GGATGTGAATGAAGAGAAGGGGG + Intronic
1029335780 7:99898119-99898141 TGGTGGTGCTGAAGGGAAGTGGG - Intronic
1029419815 7:100466791-100466813 GGCTGGGGATGATGAGGAGATGG + Exonic
1029441625 7:100590009-100590031 GCTTGGGGTTGAAGAGAAGAGGG + Exonic
1029466480 7:100728499-100728521 GAGTTGGGAAGAAGGGAAGTTGG - Intergenic
1029530190 7:101120344-101120366 GGGAGGGGAGGAAGAGGAGGAGG + Intergenic
1029862519 7:103588402-103588424 GGAGGAGGATGAAAAGAAGTGGG + Intronic
1030241634 7:107332493-107332515 GGAAGGGGATGAAGAGGAGGAGG + Intronic
1030407795 7:109136635-109136657 TGGTGGGGATGAGGAGAAAAGGG - Intergenic
1030478344 7:110068353-110068375 GAGAGGGGATAAAGAGAAGTTGG - Intergenic
1030655703 7:112165288-112165310 AGGGGAGGATGCAGAGAAGTAGG - Intronic
1030988777 7:116274206-116274228 GGTTGGTGAAGAAGGGAAGTGGG + Intergenic
1031392195 7:121228995-121229017 GAGGGAGGATGAAGACAAGTGGG + Intronic
1031462945 7:122074112-122074134 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1031501432 7:122522694-122522716 GGATGGGGCTGAAGAGAGGTTGG - Intronic
1031502191 7:122532519-122532541 GGGTGGGGGTGGGGAGAGGTCGG - Intronic
1031570236 7:123350205-123350227 GGAGGGGGATGAAGAGAGGGTGG - Intergenic
1031679676 7:124655962-124655984 TGGTGAGGATGCAGAGAAATTGG + Intergenic
1031683505 7:124703930-124703952 GGGGGAGGATAAAGAGAAGTGGG - Intergenic
1031840977 7:126738847-126738869 GGAGGGGGAGGAAGAGGAGTAGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032169484 7:129572641-129572663 TAGTGGGGATGGAGAGATGTTGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032453095 7:132051592-132051614 TGGTGGGAATGAAGGGAAATAGG - Intergenic
1032703646 7:134403824-134403846 CTGTGGGGATGAAGAAATGTGGG + Intergenic
1032816577 7:135481943-135481965 GAGAGGGGATAAAGAGAAGTTGG + Intronic
1032853623 7:135816169-135816191 TGGTTGAGATGCAGAGAAGTGGG + Intergenic
1033039009 7:137901495-137901517 AGGTGGGGATGAGGAAAAGGAGG + Intronic
1033093024 7:138404329-138404351 AGGTGGGGAGGAAGAGGAGGAGG - Intergenic
1033258572 7:139822694-139822716 GTGTGGGGATGAAGAAGAGGGGG - Intronic
1033281953 7:140012367-140012389 GGGAGGTGATAAAGAGAAGCTGG + Intronic
1033447321 7:141434755-141434777 GGGTGTGGATGAAGAAAGATTGG - Intronic
1033797433 7:144863874-144863896 GGGTGGGGATAGAGAGATATTGG - Intergenic
1033869847 7:145738729-145738751 GGGTGGGGAAGGGGAGATGTTGG - Intergenic
1034076359 7:148235518-148235540 GGTTGGGGAAGCAGGGAAGTTGG - Intronic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1035162416 7:156960929-156960951 GGATTGGGATGAAGGGAAGGAGG + Intronic
1035659673 8:1337556-1337578 TGGTGGTGATGAAGAGGAGGAGG + Intergenic
1036116344 8:5964414-5964436 TGTAGAGGATGAAGAGAAGTTGG - Intergenic
1036206061 8:6806383-6806405 GGGTGGGGATGGAGGGTGGTTGG + Intergenic
1036207491 8:6815768-6815790 GGGAGGGGATGCAGAGAAGAAGG + Intronic
1036208642 8:6824304-6824326 AGGTGGGGAGGGAGAGAAGGGGG + Intronic
1036442078 8:8790219-8790241 GTGTTGGGATGAAGAGATTTTGG - Intronic
1036472845 8:9066155-9066177 AGGTGGGGAGGAAGAGGAGGAGG - Intronic
1036474115 8:9077538-9077560 GGGTGGTGGTGATGAGATGTGGG + Intronic
1037255931 8:16953556-16953578 GTGTGGGGATGAAAGGAGGTGGG + Intergenic
1037321872 8:17651204-17651226 GGGGTGGGATGAGGAGAGGTTGG + Intronic
1037376126 8:18230987-18231009 AGGTGGGGATGTAGAGAAGGTGG + Intergenic
1037764771 8:21765866-21765888 AGGTGGGGTTGAAAGGAAGTGGG - Intronic
1038042628 8:23737970-23737992 GGGTGGGGAGGAGGAGGAGGAGG - Intergenic
1038065458 8:23959147-23959169 GAAAGGGGATGAAGAGAGGTTGG - Intergenic
1038116917 8:24566980-24567002 GGGTGGGAAAGAAGAGAAAATGG - Intergenic
1038208961 8:25497575-25497597 GGTGGGGGATGAGGAGATGTTGG + Intronic
1038355111 8:26821740-26821762 GGGTGGGGCAGAAGGGAAGTGGG - Intronic
1038946445 8:32366326-32366348 GGGGGCAGATGAAGAGAAGTTGG - Intronic
1039049556 8:33480785-33480807 GGAGGGGGAGGAAGAGAAGTTGG - Intronic
1039076481 8:33694475-33694497 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1039313425 8:36344825-36344847 GGATGGGGATTTAGTGAAGTGGG + Intergenic
1039431042 8:37525249-37525271 GGGTAGGGATGCAGAGAAGCTGG - Intergenic
1039437940 8:37573527-37573549 GGGTGGGGCTGAAGAAGAGAGGG - Intergenic
1039734957 8:40321936-40321958 GGGTGGATAGGAAGAGAAGAGGG - Intergenic
1039842611 8:41304609-41304631 GGAGGAGGATGAAGAGCAGTGGG - Intronic
1039913526 8:41843379-41843401 GGGGGGAAATGAAGAGAAGTGGG - Intronic
1040071942 8:43195674-43195696 GGGTGTGGATGAGGAGGAGGAGG + Intronic
1040362148 8:46676086-46676108 GTGGGGGAATGAAGAGAGGTTGG + Intergenic
1040985031 8:53284580-53284602 GTGGAGGGATGAAGAGAGGTTGG + Intergenic
1040989326 8:53332674-53332696 TGGTGAGGATGCAGAGAAGTTGG - Intergenic
1041342751 8:56863395-56863417 GGGAGGGGAAAAAGAGAAGGGGG + Intergenic
1041342756 8:56863415-56863437 GGGAGGGGAAAAAGAGAAGGAGG + Intergenic
1041368904 8:57139382-57139404 AGAGGGGGATGAAGAGAAGTTGG - Intergenic
1041523463 8:58779736-58779758 AGGTGGAGATGAAGAGAAGTAGG - Intergenic
1041687905 8:60661084-60661106 GGTTGGAGATTCAGAGAAGTCGG - Intergenic
1041960587 8:63610957-63610979 GGGTGTGGAGGAATAGAGGTGGG + Intergenic
1041978413 8:63826412-63826434 GGGCGGGGAGGCAGAGAAATAGG + Intergenic
1042183828 8:66117701-66117723 GGGTCGGGTGGAGGAGAAGTGGG + Intergenic
1042566763 8:70119184-70119206 AGGAGAGGAGGAAGAGAAGTGGG - Intronic
1042785024 8:72537138-72537160 GGGGGAGGAGGAAGAGAAGGCGG + Intergenic
1043122304 8:76342411-76342433 GGGTGGGGAATCAGAGAATTGGG - Intergenic
1043135681 8:76521013-76521035 TGGTGAGGATGCAGAGAAATGGG - Intergenic
1043372558 8:79611709-79611731 GGGAGGGGATGGAGAGAACTGGG + Intronic
1043426914 8:80156875-80156897 GGGTCGGGTTGAAGAGGAGTGGG + Intronic
1043427081 8:80158261-80158283 GGTTGGGGTTGAAGAGGAGTGGG - Intronic
1043427087 8:80158282-80158304 GGGTGGAGTTGAGGAGAATTGGG - Intronic
1043563071 8:81517689-81517711 TGGGGGTGATGAAGAGAGGTTGG - Intergenic
1043701620 8:83295202-83295224 GGGAGAGGATGGAGAAAAGTGGG - Intergenic
1043754386 8:83984825-83984847 GGGTGGTGAGGAATAGAAATAGG + Intergenic
1043881597 8:85549635-85549657 GGGTAGGCATGGTGAGAAGTGGG + Intergenic
1044029134 8:87213204-87213226 TGGTATGGATGTAGAGAAGTTGG + Intronic
1044047152 8:87450315-87450337 GAGGGGGAATGAAGAGAGGTTGG + Intronic
1044363375 8:91314526-91314548 GGAAGAGGAAGAAGAGAAGTAGG - Intronic
1044516496 8:93144755-93144777 GGAGGGGGATGAAGAAAGGTTGG + Intronic
1044519113 8:93177259-93177281 GGGTGAGGATGAAGAGAACTGGG + Intergenic
1044638610 8:94354575-94354597 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1044645847 8:94442243-94442265 AGGTGGGGATTAAGAGAGGTTGG + Intronic
1045005344 8:97912629-97912651 GGGTGGGCCTGCAGAGACGTAGG + Intronic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045376556 8:101580435-101580457 AGGGAGGGATGAAGAGAGGTTGG - Intronic
1045532443 8:102997720-102997742 GGTGGAGGATGAAGAGAAATTGG - Intergenic
1045864208 8:106846085-106846107 AGGTGGCCATGAATAGAAGTGGG + Intergenic
1046120858 8:109844981-109845003 GAGTGGAGATGAAGAGAGGTTGG - Intergenic
1046133827 8:110000813-110000835 GAGTGGGAATGAAGTGAGGTTGG - Intergenic
1046167551 8:110457048-110457070 AACTGGGGATGAAGAGAAATGGG + Intergenic
1046281276 8:112035459-112035481 GGTGGGGAATGAAGAGATGTTGG + Intergenic
1046306805 8:112378662-112378684 AGGCAGGGATGAAGAGAGGTTGG + Intronic
1046368315 8:113267608-113267630 AGGGGAGGGTGAAGAGAAGTGGG + Intronic
1046493209 8:114980711-114980733 GGGAGGGGAAAGAGAGAAGTCGG - Intergenic
1046781318 8:118218509-118218531 GGGTGGGGGTGGGGAGATGTTGG - Intronic
1046912482 8:119644301-119644323 GCGTGGAGAGGAAGACAAGTGGG + Intronic
1047072802 8:121365825-121365847 AGTAGGGGATGAAGAGAGGTCGG + Intergenic
1047247850 8:123160428-123160450 GGGAGAGGAAGAAGGGAAGTTGG + Intergenic
1047547227 8:125830328-125830350 AGGGGAGGATGAAGAGATGTTGG - Intergenic
1047755400 8:127914320-127914342 TGGTGAGGATGTAGAGAAATTGG + Intergenic
1047798664 8:128285588-128285610 GGGAGGGGAAGAAGAGGAGAGGG + Intergenic
1048022326 8:130550756-130550778 GGGTGAGGATAAAAAGAGGTTGG - Intergenic
1048155575 8:131945914-131945936 GTGGAGGGATGAAGAGACGTTGG - Intronic
1048263101 8:132962103-132962125 TGGTGGTGATGAAGTGAAGAAGG + Intronic
1048639768 8:136342325-136342347 TGGGGAGGATGAAGAGAAGCTGG - Intergenic
1049129727 8:140827547-140827569 GGGTGGGGATGGAGAGCAGTAGG + Intronic
1049144509 8:140988787-140988809 AGGTGGCGCTGCAGAGAAGTAGG + Intronic
1049161011 8:141097640-141097662 GTGGGGGAATGAAGAGAGGTTGG - Intergenic
1049343155 8:142124526-142124548 GGGAGTGGGTGAATAGAAGTGGG - Intergenic
1049587835 8:143440207-143440229 GGGAGGGGATGAGGAGGAGGAGG + Exonic
1049609922 8:143550146-143550168 AGGTTGGGCTGGAGAGAAGTGGG - Intergenic
1049673869 8:143881122-143881144 GGGTGTGGAGAAAGAGAATTTGG - Intergenic
1049776476 8:144408184-144408206 TGGTGGGGATGGAGGGAGGTAGG - Intronic
1050218447 9:3357602-3357624 AAGGGAGGATGAAGAGAAGTTGG + Intronic
1050489699 9:6175299-6175321 AGGTAGGGATGAAGAGAAGTTGG + Intergenic
1050606574 9:7307634-7307656 GGAGGGGGATGAAAAGAAGTTGG - Intergenic
1051075537 9:13230160-13230182 TGGTGAGGATGTAGAGAAGCTGG + Intronic
1051470169 9:17430682-17430704 GCGTCGGGGTGAAGAGAACTTGG - Intronic
1052014055 9:23444347-23444369 GGGTTGGGATGAAGTGAGTTGGG - Intergenic
1052395154 9:27929504-27929526 GGGTGGGGGTGGAGGGAAGGAGG + Intergenic
1052658547 9:31398245-31398267 AGGGGGAGATGAAGAGAAGTTGG - Intergenic
1052723038 9:32195575-32195597 TGGGGATGATGAAGAGAAGTGGG - Intergenic
1052734815 9:32330652-32330674 AGGAGGGGATGAAGAGAAGTTGG + Intergenic
1052779933 9:32771011-32771033 GGGAAGGGATAAAGAGAAGTTGG + Intergenic
1052832132 9:33224634-33224656 GGGGAAGGATGAAGAGAAGTGGG - Intronic
1053099294 9:35356765-35356787 GGCTGGGGGCAAAGAGAAGTGGG - Intronic
1053462257 9:38280135-38280157 AGGTGGGGAGGTAGAGAAGCTGG + Intergenic
1054696667 9:68367299-68367321 GGGTGGGCATGAAGGGGAGAGGG - Intronic
1054733259 9:68722928-68722950 ACGAGGGGATGAAGAGAAATTGG - Intronic
1054896830 9:70322953-70322975 GGGAGGGGAGGGAGATAAGTTGG - Intronic
1055310552 9:74975018-74975040 GAGTGGCTATGAAGAGAGGTTGG + Intergenic
1055652906 9:78424424-78424446 GGGCAGGGATGAAGAGAGGTTGG - Intergenic
1055804329 9:80076137-80076159 GGTGGGGGATGGAGAGAAGGAGG - Intergenic
1056628540 9:88274032-88274054 GGGTGGGGATGGAGGGAGGCTGG + Intergenic
1056759999 9:89407721-89407743 GAGTGTGGATGAGGAGCAGTTGG - Intronic
1057298737 9:93864347-93864369 GGGAGGGGAGGAGGAGGAGTGGG - Intergenic
1057492584 9:95533059-95533081 TGGTGGGGATGTGGAGAAATGGG + Intergenic
1057775470 9:98005125-98005147 TGGTGTGGATGAAGAGGAGGAGG + Exonic
1057778798 9:98033430-98033452 GGGTGGGGCTGGAGGGAAGTGGG + Intergenic
1057980423 9:99656019-99656041 GGTGGGGGATGAAGAGAGGTTGG + Intergenic
1058266482 9:102905238-102905260 CGGTGAGGATGCAGAGAAATAGG + Intergenic
1058287118 9:103192014-103192036 GGGTGGGAATGAAGAGAAGCTGG + Intergenic
1058363862 9:104184182-104184204 GGGTTGAGAAGAAGAGGAGTTGG + Intergenic
1058366355 9:104213797-104213819 GGGTGGGAATGGGGAGAAGTTGG - Intergenic
1058617623 9:106850223-106850245 GGAGGGGGAAGAGGAGAAGTTGG - Intergenic
1058728718 9:107828711-107828733 TGGGGAGGAGGAAGAGAAGTTGG - Intergenic
1058928651 9:109695877-109695899 TGGGGGTGATGAAGAGAGGTTGG + Intronic
1058934597 9:109757092-109757114 AGGTGGGGATAAAGAGTGGTTGG - Intronic
1059018190 9:110544900-110544922 TATGGGGGATGAAGAGAAGTTGG - Intronic
1059033731 9:110730877-110730899 GGGTGGGGAGGAAGAGGATGAGG - Intronic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1059739958 9:117140553-117140575 GGAGGAGGAGGAAGAGAAGTAGG + Intronic
1060025605 9:120168228-120168250 GGGTGGGTATGCAGAGAAGAGGG - Intergenic
1060146424 9:121256529-121256551 AAGAGAGGATGAAGAGAAGTTGG + Intronic
1060218715 9:121753422-121753444 GGCTGGGGTGGAAGAGAAGGTGG - Intronic
1060298443 9:122359356-122359378 AGGTGGGGAGGAGGAGAAATGGG - Intergenic
1060353553 9:122881668-122881690 GGGTGGGGATGGAGAGGACAGGG + Intronic
1060383228 9:123197244-123197266 GGGTGGGGAAGAAGTGGAGATGG + Intronic
1060399648 9:123340740-123340762 AGGTGGGGATGGAAAGAAGAAGG + Intergenic
1060559330 9:124529910-124529932 GGGTGGGGATGAAATGGGGTAGG + Intronic
1060571995 9:124650449-124650471 AGTGGGGGATGAAGAGAGGTTGG + Intronic
1060595745 9:124847620-124847642 AGGGGAGGATGAAGAGAGGTTGG - Intergenic
1061091267 9:128427914-128427936 TGGTGGGGATCAGGAGAGGTGGG + Intronic
1061255610 9:129453236-129453258 GGATGGGGATGAAGGGATGGAGG + Intergenic
1061465788 9:130778440-130778462 GGGTGAGGAGGTGGAGAAGTGGG + Intronic
1061578460 9:131522461-131522483 GGGAGGGGATGAAGAGATGTGGG + Intronic
1061599868 9:131661052-131661074 TGTTGTGGATGAAGAGAAGGGGG + Intronic
1062078295 9:134604189-134604211 GGGAGGGGAAGAAAAGAAGGTGG + Intergenic
1062544064 9:137053910-137053932 GGGTGGGGACGCACAGCAGTAGG + Exonic
1203772805 EBV:58084-58106 GGATGGGGATGAAGAGGGGAGGG + Intergenic
1185520712 X:736495-736517 GAGTGGGGATGAGGAGATGGGGG - Intergenic
1185802829 X:3029124-3029146 GGAAGGGGAGGAAGAGAAGGAGG - Intronic
1185850681 X:3483328-3483350 TGGTGGGGATGCAGAAAAGAGGG - Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186155179 X:6717833-6717855 TGGTGAGGATGCAGAGAAGAGGG - Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186344959 X:8682668-8682690 GCGTGGGGATGAAGAGCAAGTGG - Intronic
1186374293 X:8981685-8981707 CGGTGAGGAGGAAGAGTAGTAGG - Intergenic
1186414133 X:9368881-9368903 GGGTGGGAAAGAAGAGACTTTGG + Intergenic
1186499072 X:10036492-10036514 GGCTGGGGATAAGGAGAAATGGG - Intronic
1186499079 X:10036522-10036544 GGCTGGGGATAAGGAGAAATGGG - Intronic
1186534800 X:10335506-10335528 GAGAGAGGATTAAGAGAAGTTGG + Intergenic
1186716234 X:12254936-12254958 GAGTGAGCATGAAGTGAAGTGGG - Intronic
1186927139 X:14346612-14346634 GAGGGAGGATGTAGAGAAGTTGG - Intergenic
1187178776 X:16922346-16922368 AGTGGGGGATGAAGAGACGTCGG + Intergenic
1187546687 X:20261158-20261180 GGGTGGGGGTGAAGAAAGGTTGG + Intronic
1187593979 X:20750511-20750533 TGGTGAGGATGTAGAGAAATGGG - Intergenic
1187596468 X:20778029-20778051 TGGTGGGGATGCAGAGAAAGAGG + Intergenic
1187669525 X:21655892-21655914 GGGTGGGGACGACGAGAGGGAGG - Exonic
1187864094 X:23708300-23708322 GGGTGGGGATCACCTGAAGTTGG + Intronic
1187894866 X:23971296-23971318 GTCGGGGGATGAAGAGAGGTTGG - Intergenic
1187968128 X:24632789-24632811 GGCTAGGGATGAAGAGAGGTTGG + Intronic
1187972886 X:24676331-24676353 GAGGGAGGATGAAGAGAAGTGGG + Intergenic
1188064368 X:25639830-25639852 GGAAGGGGATGAAAAGAGGTTGG + Intergenic
1188080652 X:25836006-25836028 AGGGAGGGATGAAGAAAAGTTGG - Intergenic
1188177323 X:27007062-27007084 AGAGGGGGATGAAGAGAAGTTGG + Intergenic
1188264900 X:28061140-28061162 GAAGGGGGATGAAGAGAGGTTGG - Intergenic
1188318717 X:28708816-28708838 GGGAGAGGATGAAGAGAAGTGGG + Intronic
1188466111 X:30483116-30483138 GAGGTAGGATGAAGAGAAGTTGG + Intergenic
1188510343 X:30928843-30928865 GGGGGAGGATGAAGAGAGGTTGG + Intronic
1188642121 X:32519327-32519349 TGGTGGGGGTGGAGAGTAGTTGG + Intronic
1189126757 X:38456312-38456334 GGGTGGGGACGAGGGGAAGGAGG - Intronic
1189213128 X:39301397-39301419 GGGTGGGCAAGCAGACAAGTGGG - Intergenic
1189214516 X:39311640-39311662 GGTGGGGGATGGAGAGAAGTGGG - Intergenic
1189286105 X:39853600-39853622 GGGTGGGGAAGGAGAGGAGAAGG + Intergenic
1189370509 X:40424560-40424582 TGGTGAGGATGTAGAGAAATTGG - Intergenic
1189475904 X:41355423-41355445 TGGTGAGGATGCAGAGAAATTGG - Intronic
1189483407 X:41410487-41410509 GGTTGGGAATGAGGAGAAGCAGG + Intergenic
1189686502 X:43569483-43569505 GGTAGTGGATGAAGAGAAATTGG + Intergenic
1189901231 X:45708500-45708522 AGGGGGGAATGAAGAAAAGTTGG + Intergenic
1189946250 X:46182309-46182331 GGGAGGGGATGGGGAGAGGTTGG + Intergenic
1189971175 X:46419872-46419894 GGGTGAGGAGGAAGAGAAAGAGG - Intergenic
1190063436 X:47224914-47224936 TGGTGGGGATGAAGGTCAGTGGG + Intronic
1190337297 X:49270127-49270149 GGATGGGGATGAAGGGGAGGAGG + Exonic
1190482955 X:50895831-50895853 AGGAGGGGATGAAGAGCAATTGG + Intergenic
1190531621 X:51384641-51384663 AGAGGGGGATGAAGAGAAGTGGG - Intergenic
1190619150 X:52267724-52267746 TGGGTGGGATGAAGCGAAGTTGG + Intergenic
1190635967 X:52434269-52434291 GGTTGGGGAAGAAGAGAGTTGGG + Intergenic
1190637028 X:52445411-52445433 TGGGTGGGATGAAGCGAAGTTGG - Intergenic
1190952317 X:55158402-55158424 AAGGGGGGATGAAAAGAAGTTGG + Intronic
1191042256 X:56095806-56095828 TGGTGGGGATGCAGAGAAAAAGG + Intergenic
1191053189 X:56216143-56216165 AAGTGAAGATGAAGAGAAGTAGG - Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192405894 X:70885948-70885970 TGGTGAGGATGTAGAGAAATTGG + Intronic
1192410424 X:70928709-70928731 TGGTGGGGAAGAAGAAAAGCTGG - Intronic
1192430886 X:71110856-71110878 GGGAGGGGATGAAGAAGAGGTGG - Intronic
1192487796 X:71545268-71545290 GGGTGGGGAGGAATAAAAGAAGG - Intronic
1192512699 X:71733774-71733796 GGGTTGGGAAGAAGAGAAGTTGG - Intergenic
1192513998 X:71747735-71747757 GGGTTGGGAAGAAGAGAAGTTGG + Intergenic
1192526711 X:71852227-71852249 GGGTTGGAAAGAAGAGCAGTTGG + Intergenic
1192536318 X:71931032-71931054 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1192769646 X:74174582-74174604 AGGAGGGGATAAAGAGAATTTGG - Intergenic
1193087275 X:77458035-77458057 GGGTGGGGGTAAAGAGAATGGGG - Intergenic
1193193800 X:78605834-78605856 AGGGAGAGATGAAGAGAAGTTGG + Intergenic
1193297288 X:79848077-79848099 GGGAGGAAATGAATAGAAGTTGG + Intergenic
1193482123 X:82039862-82039884 GGGTGGGGATGAAAACATCTTGG + Intergenic
1193655627 X:84193676-84193698 TGGTGAGGATGGAGAGAAGAGGG - Intergenic
1193782602 X:85722205-85722227 CGGGGGGGATGAAGAGAGGTTGG - Intergenic
1193787617 X:85778778-85778800 GAGTAGGGATGAACAGAAATAGG - Intergenic
1193838048 X:86371246-86371268 GGGTGGTGGTGAAGATAAATGGG - Intronic
1193850261 X:86529390-86529412 AGGAGGGGGTGAAGAGAGGTTGG - Intronic
1194524129 X:94956624-94956646 GAGTGGGGATGAAGAGAGGCTGG + Intergenic
1194639802 X:96390465-96390487 GGAGGGGGATGAAGATAAGTTGG - Intergenic
1194859842 X:98984232-98984254 GAAAGGGGATGAAGAGAGGTTGG + Intergenic
1194907979 X:99602602-99602624 AGGGGAGGATGAAAAGAAGTGGG + Intergenic
1195042018 X:101023313-101023335 GGTTAGGGATGAGGAGAAGATGG - Intronic
1195111115 X:101650475-101650497 AGCAGGGGATGAAGAGAGGTTGG + Intergenic
1195400902 X:104459912-104459934 GCGGGGGGATGAAGAGAGGTTGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195431176 X:104791215-104791237 GGGTGGGGGTGGAGAGAGGAGGG - Intronic
1195596084 X:106691503-106691525 AGGGAGGGATGAAGAGAAGTTGG - Intergenic
1195598918 X:106724254-106724276 TAGTGGACATGAAGAGAAGTGGG - Intronic
1195636702 X:107125105-107125127 GGGTGAGGAGGAAGAGGAGAGGG - Intronic
1195786879 X:108534601-108534623 GGGGGAGGATGAAGAGAACTGGG + Intronic
1195795209 X:108639894-108639916 TGGTGAGGATGTGGAGAAGTTGG + Intronic
1195799492 X:108691177-108691199 TGGGGAGGATGAAGAGAAGTGGG + Intronic
1195811100 X:108830906-108830928 GGAAGGGGATAAAAAGAAGTTGG + Intergenic
1195842404 X:109188557-109188579 GGGTGGGGATGCAGAGGTGTAGG + Intergenic
1196008541 X:110861604-110861626 AGGAGAAGATGAAGAGAAGTTGG + Intergenic
1196049302 X:111288495-111288517 GGGAGGGGCGGAAGAGAAGAGGG - Intergenic
1196132912 X:112176806-112176828 GAAGGGGGATGAAGAGAAGTTGG - Intergenic
1196370200 X:114969091-114969113 TGGTGGCACTGAAGAGAAGTGGG + Intergenic
1196560128 X:117136469-117136491 GAGAGGAGATGAAGAGAGGTTGG - Intergenic
1196575227 X:117309312-117309334 TAGAGGGGATGAAGAGAGGTTGG + Intergenic
1196840150 X:119852564-119852586 GGGTGGGGGTGAGGAAAAGAGGG - Intronic
1196845844 X:119896359-119896381 GGGTGGGTAGGAAGAGATGGGGG - Intronic
1196856120 X:119986630-119986652 GGGGGATGATGAAGAGAAGTCGG + Intergenic
1196856471 X:119989993-119990015 GGGTGAGGATGGAGGGAAGACGG + Intergenic
1196858435 X:120005294-120005316 GGGGGATGATGAAGAGAAGTGGG - Intergenic
1196883191 X:120219017-120219039 GAGGGAGGATGAAGAGAAGTTGG + Intergenic
1196886580 X:120251384-120251406 GGGGGGGGATGAAGCGAAGCAGG - Intronic
1197252418 X:124229619-124229641 GGGTGGGGATAGAGAGGAGCAGG + Intronic
1197264425 X:124352852-124352874 GGAAGGCGATGAAGAGAGGTTGG + Intronic
1197286942 X:124606949-124606971 GGATGAGGATGAGGAGAAGGAGG + Intronic
1197359630 X:125484252-125484274 TGGTGAGGATGTGGAGAAGTTGG + Intergenic
1197747149 X:129939332-129939354 GGGTGGGGGAGAAGAGGAGGAGG - Intergenic
1197798243 X:130320589-130320611 GAAGGGGGATGAAGAGAGGTTGG - Intergenic
1197939216 X:131771796-131771818 GGGTGGGGAGGCGGAGAAATTGG - Intergenic
1197940825 X:131787680-131787702 GGAGGGGAATGAAGAGAGGTTGG - Intergenic
1197946940 X:131849344-131849366 GAGGGTGGATGAAGAGAGGTTGG - Intergenic
1198080802 X:133237420-133237442 CGGTGGGGAGGAAGAGAAGGAGG + Intergenic
1198171550 X:134110800-134110822 TTGTGGAGATGAAGAGAGGTTGG - Intergenic
1198269012 X:135036476-135036498 GAGTGGGTATGAAGAGGACTGGG - Intergenic
1198629435 X:138618380-138618402 GAGTGGGGATAGAAAGAAGTAGG - Intergenic
1198724460 X:139662774-139662796 GGGGGAGGGTGAAGAGAAGTGGG - Intronic
1198813330 X:140559208-140559230 GGGGAAGGATGAAGAGAAGTTGG - Intergenic
1198895900 X:141454261-141454283 TGGTGGGGATGTAGAGAAAAGGG + Intergenic
1199167242 X:144691299-144691321 TGGCGGGGATGCAGAGAAATAGG - Intergenic
1199275000 X:145930567-145930589 GGAGCGGGAAGAAGAGAAGTTGG - Intergenic
1199880520 X:151970913-151970935 GGAAGGGGATGAAGGGAAGGAGG + Intronic
1199885135 X:152012954-152012976 GGGGAAGGATGAAGAGTAGTGGG + Intergenic
1199932837 X:152541994-152542016 TGGTGAGGATGCAGAGAAATTGG - Intergenic
1199973134 X:152875273-152875295 GGGAAGGGATAAAGAGAACTAGG + Intergenic
1200271058 X:154683864-154683886 GTTTGGGGATGGAGAGAAATTGG + Intronic
1201283398 Y:12359939-12359961 GGATGGGGATGAGGAGAAAAGGG + Intergenic
1201482408 Y:14454207-14454229 GAGAGGGGATGAAGAGACATGGG - Intergenic
1202051548 Y:20786415-20786437 AGGTGGGGTTGAGGAGATGTTGG - Intergenic
1202061191 Y:20890175-20890197 TGGAGAGGATGAAGAGAAATAGG + Intergenic
1202300585 Y:23409477-23409499 TGCTGGGGAAGAAAAGAAGTTGG - Intergenic
1202570226 Y:26261121-26261143 TGCTGGGGAAGAAAAGAAGTTGG + Intergenic