ID: 999676381

View in Genome Browser
Species Human (GRCh38)
Location 5:154007370-154007392
Sequence TACTCACATGTGGTGTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999676381_999676384 15 Left 999676381 5:154007370-154007392 CCAGGCCACACCACATGTGAGTA 0: 1
1: 0
2: 0
3: 10
4: 110
Right 999676384 5:154007408-154007430 GAATCACAGAATCATATTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999676381 Original CRISPR TACTCACATGTGGTGTGGCC TGG (reversed) Intronic
901935319 1:12622511-12622533 TACTCACCTGTGGCGGGGCATGG - Intergenic
903525361 1:23989441-23989463 CACTCACTTGCGGTGTGGGCTGG - Intergenic
905995318 1:42376332-42376354 CACTGACATCAGGTGTGGCCAGG + Intergenic
907912745 1:58841288-58841310 TCCTCACATCTGGTGTGCTCTGG - Intergenic
908318456 1:62957978-62958000 TACTCACATGAACTGTGGACAGG + Intergenic
913324572 1:117615562-117615584 TAGTCACATGTGGTGTCCCCTGG + Intronic
913520260 1:119638914-119638936 CACTGACATATGGTGTGCCCCGG + Intronic
917231105 1:172839023-172839045 TACTCACATTTGCTGTGGGACGG - Intergenic
918448044 1:184633877-184633899 TCCTCTCATGTGGAGCGGCCAGG + Intergenic
918633497 1:186747643-186747665 TAGTCACAGCTGGAGTGGCCAGG - Intergenic
921488199 1:215740980-215741002 CACTCACCTGCTGTGTGGCCCGG + Intronic
1063478340 10:6348190-6348212 TATTTGCATGCGGTGTGGCCTGG - Intergenic
1063864725 10:10351667-10351689 TACTCACAAGTTGTGTGCCCTGG + Intergenic
1063892772 10:10647322-10647344 TACCCACATGTGGAGCGGGCGGG - Intergenic
1064854594 10:19752313-19752335 TATTTACATGTGATTTGGCCAGG + Intronic
1065493753 10:26308344-26308366 GTCTCCCACGTGGTGTGGCCGGG + Intergenic
1068870811 10:61942332-61942354 TACTTGCAGGTGGTTTGGCCTGG + Intronic
1069447934 10:68491172-68491194 AACTAAAATGTGGTGTGGCCAGG - Intronic
1070614945 10:77962440-77962462 TATTCACATATGGTGAGGCCAGG + Intergenic
1071326048 10:84519364-84519386 AGCTCACATGTGTGGTGGCCTGG - Intergenic
1071509781 10:86254225-86254247 CACTCACAGGTGGTGAGGACAGG - Intronic
1073790208 10:106932503-106932525 TACACACATGTGGTGGGAACTGG - Intronic
1073983113 10:109177440-109177462 TACTCCCATGTGTTGTGGGAGGG - Intergenic
1076621204 10:131789243-131789265 TGCTCACCTGCTGTGTGGCCTGG - Intergenic
1078147619 11:8732517-8732539 TACTTACAAGTGCTGTGGCAGGG - Intronic
1079796436 11:24809285-24809307 TATTCACATGTGGAGTGGGAAGG + Intronic
1089319563 11:117615763-117615785 TTCCCACATGTGATGGGGCCAGG + Intronic
1092571654 12:9730979-9731001 TAGTAACATGTGTAGTGGCCAGG - Intronic
1094130305 12:27067873-27067895 TACTCTTGTGGGGTGTGGCCAGG + Intergenic
1094179764 12:27579880-27579902 TACTCTTGTGGGGTGTGGCCAGG + Intronic
1097763942 12:63500919-63500941 TTTTCACATGTGTTGTGGTCTGG - Intergenic
1102324641 12:111969535-111969557 TGCACACCTGTGGTGTGCCCAGG - Intronic
1103236747 12:119379308-119379330 CACTCAAATGTTTTGTGGCCTGG + Intronic
1104270724 12:127280279-127280301 TGGTCACATGTAGAGTGGCCGGG - Intergenic
1105840334 13:24248576-24248598 TACTCACTAGTGGTGTGAGCTGG - Intronic
1106629772 13:31459018-31459040 CACTCACAAATGGTGTGGCATGG - Intergenic
1107613170 13:42136845-42136867 TACTCACATCTGCTGTGGAAAGG - Intronic
1107943902 13:45399924-45399946 TACTGACATCTAGTGGGGCCAGG - Intronic
1108522450 13:51258657-51258679 TACTCACCTGTTGAGTGGCTAGG + Intronic
1108596773 13:51956247-51956269 TACTCACCTGGGGCGTGCCCAGG + Intronic
1110185145 13:72665162-72665184 TACACACATCTGTTGTAGCCTGG + Intergenic
1112199488 13:97261168-97261190 TAATCACATGTGCTGTGCACAGG - Intronic
1112727196 13:102318244-102318266 TACTCACATAGGGAGTGCCCTGG + Intronic
1114216753 14:20663045-20663067 TCCACACCTGTGCTGTGGCCAGG - Intergenic
1120842553 14:89098430-89098452 GACTTAGATGGGGTGTGGCCTGG + Intergenic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1122408997 14:101516690-101516712 GCCTCACATGGGGTGTGGGCTGG - Intergenic
1124583910 15:30987956-30987978 TAGCCACAGGTGATGTGGCCAGG + Intronic
1126112732 15:45185199-45185221 TCCTGACATGTGATGAGGCCTGG - Intronic
1128382417 15:67122782-67122804 AACTTACAAGTGGTGGGGCCAGG - Intronic
1129499458 15:76022097-76022119 TGCTCACCTGCTGTGTGGCCTGG + Intronic
1131699196 15:94915592-94915614 TGGTCACATTTGGTGTGGACAGG - Intergenic
1133688037 16:8185620-8185642 AACTCATATGATGTGTGGCCGGG + Intergenic
1137886548 16:52110740-52110762 TTCTCACATGTGGTGTGTTCAGG - Intergenic
1141031723 16:80594965-80594987 GAACCACATGTGGTGTGGCATGG + Intergenic
1147742140 17:42675649-42675671 GACTCCCGTGTGCTGTGGCCCGG - Intronic
1148707493 17:49648605-49648627 TAATCACATGTGGTCCTGCCGGG + Intronic
1152527820 17:80899477-80899499 TATTCACAGGAGCTGTGGCCGGG - Intronic
1152532153 17:80924944-80924966 GACTCCCATGTGAAGTGGCCTGG - Intronic
1152879005 17:82804776-82804798 CTCTCACACGGGGTGTGGCCTGG - Intronic
1156747351 18:40408141-40408163 TTCTCAAATGTGGTGTGATCAGG + Intergenic
1160090392 18:75821360-75821382 TGTTCACATGTGGTGTGGTCTGG - Intergenic
1161837952 19:6660457-6660479 TCCTCACAAGGGGAGTGGCCAGG - Intergenic
1163131192 19:15274286-15274308 CACTCACATGTGGAGTAGGCTGG + Intronic
930489815 2:52054892-52054914 AATTCACATGAGGTGTGGCCTGG + Intergenic
933986494 2:87596192-87596214 GACTCAGATGTGGAGTGGGCTGG + Intergenic
934919685 2:98332696-98332718 GAGTCACATGTAGTATGGCCTGG + Intronic
936307344 2:111354609-111354631 GACTCAGATGTGGAGTGGGCTGG - Intergenic
942810044 2:179988141-179988163 TGCTCACCTGCTGTGTGGCCTGG + Intronic
948309516 2:236974559-236974581 ATCTCCCATGTGGGGTGGCCGGG + Intergenic
1170684422 20:18556192-18556214 CACTCACCTGGTGTGTGGCCTGG + Intronic
1174625834 20:51913539-51913561 TGCTCACATGGGGTGGGGGCTGG - Intergenic
1178795576 21:35741390-35741412 GTATAACATGTGGTGTGGCCTGG - Intronic
1181332289 22:22102569-22102591 TGCTGAGAGGTGGTGTGGCCAGG - Intergenic
1181741466 22:24924846-24924868 TACTGGCATCTGGTGAGGCCCGG - Exonic
1182428086 22:30285421-30285443 CACTCACAGGTGGAGTGGGCAGG - Exonic
1183738603 22:39657587-39657609 AGCTAACAAGTGGTGTGGCCAGG - Intronic
1184728600 22:46360248-46360270 CACTCACAGGTGGGGTGGGCAGG - Intergenic
952933451 3:38377113-38377135 TACACACTTGTGGTGTGCCAGGG + Intronic
957150945 3:76485457-76485479 CACTCACCTGCTGTGTGGCCCGG + Intronic
958792730 3:98670559-98670581 TAATCACAGCTGGTGTGGCTGGG - Intergenic
961141534 3:124560540-124560562 TATTCACATGTAGTGTTCCCTGG + Intronic
962369025 3:134805442-134805464 TTCACACCTGTGGTGTGACCAGG - Intronic
967933686 3:194709355-194709377 ACCTCACATCTGGGGTGGCCTGG - Intergenic
969569886 4:8002091-8002113 TACTCACAGTTGGAGTGGCTGGG + Intronic
970337835 4:15070258-15070280 TACTGAAATGTAGTTTGGCCTGG - Intergenic
974931132 4:68362553-68362575 TACTCTCATCAGCTGTGGCCAGG - Intergenic
975363000 4:73493680-73493702 GTCACACATGTGGTGTGGCCAGG + Intronic
977163046 4:93660570-93660592 TACTCACATGTTGTGGGGGAGGG - Intronic
978536229 4:109766173-109766195 TACTCACATGTAGTCTAGTCAGG - Intronic
987833347 5:23127196-23127218 TAAACACAAGTGGTGTAGCCAGG - Intergenic
994923601 5:106084417-106084439 TACTTACAAGTGGTGTGGAGAGG - Intergenic
999676381 5:154007370-154007392 TACTCACATGTGGTGTGGCCTGG - Intronic
1000105257 5:158053199-158053221 TGCTCACATCTTGTATGGCCTGG + Intergenic
1000216605 5:159163556-159163578 TCCTCACATCTGTTGTGGTCAGG + Intronic
1006676915 6:35771246-35771268 TACGCACAGGTGGTGTGGGCAGG + Intergenic
1007491643 6:42227775-42227797 TCCTCACATGTCGTGTGAGCTGG + Exonic
1017409113 6:154150338-154150360 TACTCCCAGGTGTTGTGTCCTGG + Intronic
1020024527 7:4889538-4889560 TAATCTCATGTGGTTTGGCTTGG - Intergenic
1022629897 7:32075399-32075421 GCCTCACATCTGGTGTGGGCGGG - Intronic
1037632680 8:20672436-20672458 TACTGACATCTGGTGTGGGTGGG - Intergenic
1038797918 8:30726017-30726039 TACTCTCATGAGGTGTGGGAGGG + Intronic
1039553984 8:38463852-38463874 TACTCACATGTTGAGAGGGCAGG + Intronic
1041527792 8:58827213-58827235 TACTCACATGTGGTTTCCCTGGG - Intronic
1044606282 8:94050929-94050951 TACTCACAAGTTGTGGGGCCAGG + Intergenic
1044875867 8:96665891-96665913 TATTCAGATATGGTGAGGCCAGG + Intronic
1047448912 8:124944963-124944985 AACTCATATGTGATGTGGTCAGG - Intergenic
1048048215 8:130792975-130792997 TTCTTGCATGTTGTGTGGCCAGG + Intronic
1048786065 8:138051674-138051696 CACTTACTTGTGGTGTGACCTGG + Intergenic
1049429217 8:142551399-142551421 CACTAAGATGTGATGTGGCCAGG + Intergenic
1054884308 9:70179215-70179237 TACTAAAATGAGGTGGGGCCGGG + Intronic
1055420603 9:76137100-76137122 TACCCACATGTGTTATGGACTGG + Intronic
1057226937 9:93297339-93297361 GGCTCACATATGGTGTGGCATGG + Intronic
1058918502 9:109590699-109590721 AACTCACATGAGATGTGCCCTGG - Intergenic
1062680698 9:137778390-137778412 TGCACAGATGGGGTGTGGCCTGG - Intronic
1192252399 X:69423413-69423435 TGCTCACAAGTGGTCTGGCATGG - Intergenic
1192372916 X:70529888-70529910 TGCTGAAAAGTGGTGTGGCCTGG - Exonic
1194720801 X:97337776-97337798 TACTCACCTGTGTCCTGGCCTGG + Intronic
1194958393 X:100207802-100207824 GACTCTCAAGTGGTGTGGCTTGG - Intergenic
1197509155 X:127349945-127349967 TAATCACTTGTGGGGTGGCTTGG - Intergenic
1200506686 Y:4019326-4019348 TACTCATTTCTGGTGTGGCAGGG - Intergenic