ID: 999676636

View in Genome Browser
Species Human (GRCh38)
Location 5:154010679-154010701
Sequence ATCAAAGCTCAGAGTGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 6, 3: 19, 4: 230}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999676636 Original CRISPR ATCAAAGCTCAGAGTGGGTA GGG (reversed) Intronic
902251529 1:15156737-15156759 AACAAAACTCAGAGAGGGGATGG + Intronic
903654701 1:24942150-24942172 ATCTAAGCTCAGAGCTGCTAAGG - Intronic
903771468 1:25767035-25767057 ACCAAGGCCCAGAGTGGGCAGGG + Intronic
904465769 1:30706800-30706822 AACAGAGCTCAGAGAGGGTCAGG + Intergenic
904550149 1:31309600-31309622 CTCAAAACTCAGGCTGGGTATGG - Intronic
905025260 1:34845316-34845338 ATAAAAGCTGAGGGCGGGTAGGG - Intronic
905441249 1:37997650-37997672 GTCAAAGAACGGAGTGGGTAGGG - Intronic
906043255 1:42805820-42805842 ACAAAACCTCAGATTGGGTATGG - Intergenic
906061224 1:42949987-42950009 GTCTCAGCTCAGAGTGGGCAAGG - Intronic
906711740 1:47935267-47935289 ACAAAAGCTCAGAGAGGTTAAGG + Intronic
908587230 1:65583214-65583236 ATAAGAGTTCAGAGAGGGTAAGG + Intronic
908712266 1:67029677-67029699 AGCAAAGTTCAGAGGGGGTCAGG - Intronic
908953352 1:69589657-69589679 TTAAAAGTTCAGGGTGGGTATGG - Intronic
909376086 1:74943799-74943821 ATAAAGGCTTTGAGTGGGTAAGG - Intergenic
910470704 1:87549292-87549314 ATAAAATCTCAGAGTTGGGAAGG + Intergenic
912312177 1:108633852-108633874 ATCAAAGCTCAGAGGGGCTAGGG - Intronic
912701581 1:111882128-111882150 ACCAGAGCTCAGAGAGGGAAGGG - Intronic
913572073 1:120130697-120130719 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
914292997 1:146292333-146292355 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
914554041 1:148743116-148743138 ATTAAAGCTCAGAGAGTTTAAGG - Intergenic
915209960 1:154301142-154301164 ATCAAAAGTCAGACTGGGTGTGG + Intergenic
915552942 1:156645796-156645818 ATAAAGGCTCAGAGAAGGTAAGG + Intronic
916368047 1:164056138-164056160 ATTAAGGCTCAGAGAGGCTAAGG - Intergenic
917310273 1:173671106-173671128 ATCAAAACTTAAAGTGGGGAAGG - Intergenic
918816341 1:189190497-189190519 AAAAAAGCTCAGAGTGGACAAGG - Intergenic
919569203 1:199224470-199224492 TTCACAGCTCAGAGTGGGAAAGG + Intergenic
920213147 1:204343421-204343443 ACCAAGGCTCAGAGAGGTTAAGG + Intronic
920785863 1:209040463-209040485 ATCAAAGCTCAGAGTGGTGAAGG - Intergenic
922180590 1:223230020-223230042 ATCAAGGCTCAAAGAGGTTAAGG - Intronic
922675344 1:227546055-227546077 ATCACAGCTGTGAGTGGGGAAGG - Intergenic
924838543 1:247681401-247681423 ATCCAAGATCTGAGTGCGTAGGG - Intergenic
1063834063 10:9991762-9991784 ATGAAAGCTCCATGTGGGTAGGG + Intergenic
1065686419 10:28289684-28289706 CCCAAAGCCCAGAGTGGGTTCGG - Intronic
1065934200 10:30506105-30506127 ATCAAAGCACAGAGAGGGTAAGG - Intergenic
1068632734 10:59314404-59314426 ATCAAAGCCCAGAGAGGTTAGGG + Intronic
1068836368 10:61558879-61558901 AGAAAAGGTCAGAGTAGGTATGG + Intergenic
1070248504 10:74753497-74753519 ATCAAAGCACAGGATGGGTGGGG - Intergenic
1070807784 10:79280631-79280653 AAAAAAGAACAGAGTGGGTAGGG - Intronic
1073164451 10:101432634-101432656 ATCAAACCTAAGAGTGGTTGTGG - Intronic
1074659001 10:115629309-115629331 ATAAATGCTCAGATTGAGTACGG + Intronic
1075387124 10:122062946-122062968 ATCAGGGCTCAGAGAGGTTAAGG + Intronic
1076201115 10:128559136-128559158 ATCAAACCTGAGAGAGGATAAGG - Intergenic
1077896724 11:6458313-6458335 GTCAAAGAACAGAGTGGGTGGGG + Intronic
1078745388 11:14108960-14108982 ATCAAAGCTGGGAGAAGGTAAGG + Intronic
1079097987 11:17523147-17523169 ATCAAAGGTCAGAGGGGCTGGGG + Intronic
1079962286 11:26939670-26939692 ATAAGAGATCACAGTGGGTAGGG + Intergenic
1080000482 11:27343108-27343130 ATCAAAGCTCAGGATGGGCATGG + Intronic
1080568259 11:33532136-33532158 ACCAGAGCTCAGAGAGGGCAAGG - Intergenic
1080689616 11:34545442-34545464 ATCAATTATCAGAGTGGGCAAGG - Intergenic
1081869196 11:46375674-46375696 ATCAAGGCCCAGAGAGGGCAGGG - Intronic
1081914397 11:46721391-46721413 ATCAAAGCTCTGACTAGGTGGGG - Intronic
1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG + Intronic
1083017798 11:59474561-59474583 ATCAAAGCTTAGAGGGTGGAGGG - Intergenic
1083397777 11:62402976-62402998 ATCAAAGCTCCCAGAGGGTGTGG - Intergenic
1084042619 11:66551057-66551079 ACGAAAGCTCAGAGAGGGAAAGG + Intronic
1084361095 11:68669237-68669259 ACCACAGATCAGAGTGGGTTGGG + Intergenic
1085198334 11:74685533-74685555 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1085255111 11:75168229-75168251 ACCAAGGCCCAGAGTGGGTAAGG + Intronic
1085958418 11:81429452-81429474 ACCAAGGCTCAGAGTGGTTGTGG - Intergenic
1088270853 11:108032999-108033021 ATCAAACCTGAGAGTGGTTTTGG - Intronic
1088693974 11:112350488-112350510 ACTGAAGCTCAGAGTGGTTAAGG - Intergenic
1089582147 11:119488222-119488244 ATCAAAGCTCAGGGAGGCCATGG - Intergenic
1091247670 11:134112598-134112620 ATAAAAGTTCAGTGTTGGTAAGG - Intronic
1093669817 12:21860360-21860382 ATCAAGGCTGAGAGAGGTTAAGG - Intronic
1095488061 12:42704905-42704927 GTCAAAGATAAGAGTGGGGATGG - Intergenic
1095556763 12:43516002-43516024 CTGACAGGTCAGAGTGGGTAGGG + Intronic
1096153063 12:49326502-49326524 ACCAAAGCTCAGAGAGGTGAAGG - Intronic
1096517672 12:52166071-52166093 ATCAAACCTAAGAGTTGGTGAGG - Intergenic
1097290494 12:57910405-57910427 TTCCAAGCACAGAGTGGGTGAGG - Intergenic
1099114972 12:78612557-78612579 CTGAAATCTAAGAGTGGGTATGG - Intergenic
1101132902 12:101707624-101707646 ATTAAAGCACAGAGAGGGCAAGG - Intronic
1101943605 12:109119245-109119267 AGCAAGGGTCAGAGTGGCTAAGG - Intronic
1102514905 12:113439887-113439909 AGCAAAGCTCAGAGAGTGCAGGG + Intergenic
1102629811 12:114268128-114268150 ATTAAAGCTCAGAGAGGGGAAGG + Intergenic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102775246 12:115512995-115513017 ATCAAAGCTGAGAGAGAGCATGG - Intergenic
1103206271 12:119131440-119131462 ATCAAGGCTCAGAGAGGTTAAGG + Intronic
1103440164 12:120957148-120957170 ATCAAAGCTGAGAGCAGGTGGGG - Intergenic
1104034877 12:125091326-125091348 AGCCAAGGTCAGAGTGGGAAGGG - Intronic
1108186968 13:47897672-47897694 ATCAAAGATCAGACAGGATAAGG - Intergenic
1109178705 13:59187303-59187325 ATCAAAGCTAAGAATTGGTGAGG - Intergenic
1111345313 13:86945734-86945756 ATGAAAGCTGAGACTGTGTATGG - Intergenic
1112702868 13:102032158-102032180 ATATAAGCTCCCAGTGGGTAAGG - Intronic
1112967839 13:105220120-105220142 ATCAAAGTTCAAAGTGGATCAGG + Intergenic
1114525166 14:23363590-23363612 ACCCTAGCTCAGAGTGGGGAAGG - Intronic
1116806546 14:49499560-49499582 ATCACAGCTCAATGTGGGGAAGG + Intergenic
1118971894 14:70643778-70643800 ATCAAAGATGAGACTGGGCATGG - Intronic
1122010126 14:98739577-98739599 ATGAAATCTCAGAGTGTGTACGG + Intergenic
1122145830 14:99688378-99688400 ATAAAAGCTGAGAGTGCGGATGG - Intronic
1124081953 15:26507418-26507440 ATCAAAGCACAGTGTGGTAATGG + Intergenic
1124594607 15:31082412-31082434 ATCACAGCTCAGAGGGGTTGGGG - Intronic
1125595784 15:40885233-40885255 AGCGTAGCTCAGAGGGGGTAGGG + Intergenic
1126616466 15:50586726-50586748 ATAAAAACTCAGACTGGGCATGG + Intronic
1127658563 15:61078590-61078612 ACCAATGCTCAGAGAGGATAAGG + Intronic
1127701346 15:61504520-61504542 ATCTCAGCTCAGTGTGGGGAGGG - Intergenic
1128322795 15:66704485-66704507 AGAAAAGCACAGTGTGGGTAAGG - Intronic
1130908353 15:88255185-88255207 ATCAAAGCCCAAACTGGGAAGGG + Intronic
1133267134 16:4591987-4592009 ACCAAGGCTCAGAGAGGGAAGGG + Intronic
1137983522 16:53089547-53089569 ATCAAAGCACAGAGCAGGTGAGG + Intronic
1138096497 16:54215824-54215846 AAAAAAGCACAGAGTGGGGAGGG - Intergenic
1139152440 16:64398906-64398928 ATCAAAGAGCAGAGTGTATAGGG - Intergenic
1140259018 16:73361230-73361252 AGCCAAGGTCAGAGTTGGTATGG - Intergenic
1140771744 16:78211899-78211921 AACTCAGCTCAGAGAGGGTAGGG - Intronic
1141560335 16:84863592-84863614 AAGAAGGCTCAGAGAGGGTAAGG - Intronic
1143028263 17:3953473-3953495 ATCCCAGCTCTGAGTGGGCAGGG - Intronic
1143698728 17:8641016-8641038 ATGGAAGCTCAGAGAGGTTAAGG - Intergenic
1143781293 17:9230955-9230977 ACCAAAGCTCAGAGTAGGGGTGG + Intronic
1144115216 17:12082379-12082401 TTTTAAGCTCAGAGAGGGTATGG - Intronic
1144134556 17:12281048-12281070 ATCAAAACTCAGAGTTTGGAGGG + Intergenic
1145961942 17:28891983-28892005 ATCAAAGAGCAGTGTGGGCAGGG + Intronic
1147118066 17:38317369-38317391 CTCTAAGCCCAGAATGGGTAAGG - Intronic
1147547744 17:41416027-41416049 AACAAAGCTCAGAGCAGTTAGGG + Intergenic
1148217199 17:45839757-45839779 ATCAAAGCTCTCAGTGGCTTGGG + Intergenic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151439310 17:74118027-74118049 AACAAAGCTCTGAGTGGTTTAGG + Intergenic
1155426649 18:25714310-25714332 ACTGAAGCTCAGAGTGGGAAAGG - Intergenic
1161606668 19:5218898-5218920 ACCAAAGCTCACAGAGGTTAAGG - Intronic
1165745246 19:38226734-38226756 GTCACAGCTCACCGTGGGTAAGG - Intronic
1166841818 19:45702015-45702037 ATCAAAGCACAAAGAGGTTAAGG - Intronic
925284398 2:2706325-2706347 ATCAAAGCTCAGAGGCTGTGTGG - Intergenic
926055953 2:9774140-9774162 GTCATAGGTCATAGTGGGTAAGG + Intergenic
926329043 2:11809917-11809939 AACAAAGCTCAGAGTGGGGAAGG - Intronic
926434875 2:12827595-12827617 ATCATAGCTCCCAGTGGGTGTGG + Intergenic
926493729 2:13558067-13558089 ATCAAAACTGAGAGTGGTTTTGG - Intergenic
931962641 2:67499325-67499347 ATCAAAAATCAGAGGAGGTAGGG - Intergenic
932730748 2:74220378-74220400 AGCAAAGGTCAGAAAGGGTATGG - Intronic
933609579 2:84420244-84420266 ACCAAATCTCAGAGAAGGTAGGG + Intergenic
934607213 2:95705382-95705404 ATCAAAACTTAGAGATGGTAAGG - Intergenic
934973716 2:98785614-98785636 ACAAAGGCTCAGAGTTGGTAGGG + Intergenic
936540606 2:113347565-113347587 ATCAAAACTTAGAGATGGTAAGG - Intergenic
937341369 2:121092973-121092995 ATCAAAACTGAGAGTGGTTGGGG + Intergenic
937750799 2:125474480-125474502 ACCAAATCTCAGAGAGGTTAAGG - Intergenic
938292338 2:130156828-130156850 ATCAAGGTTCAGAGAGGTTAGGG + Intronic
938588630 2:132716064-132716086 GTCACAGCTCAGAGAGGGAAGGG - Intronic
939540001 2:143482239-143482261 ATAAAAACTCAAAGTGGGAATGG + Intronic
941056134 2:160790967-160790989 CTGAGAGCTCAGTGTGGGTAGGG - Intergenic
944283017 2:197919959-197919981 ATCAAAGCACAAAGAGGTTAGGG - Intronic
945979799 2:216300141-216300163 GTTAAAGCTCAGAGAGGCTAAGG - Intronic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
946703032 2:222431673-222431695 ATCTAAGCTCTCAGTGGGTCTGG - Intronic
1172958820 20:38782498-38782520 TTCAAAGGTCAGAGTGGAGAAGG + Intergenic
1174458710 20:50667862-50667884 ATGGAAGCTCAGAGAGGCTACGG - Intronic
1177881911 21:26704307-26704329 AGCAGAGGTCAGAGTGTGTAAGG - Intergenic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178984522 21:37291373-37291395 ATCAAAACTGAGAGTGGTTTTGG - Intergenic
1179193286 21:39141692-39141714 ATCAAAGCACTGAGCGTGTAGGG - Intergenic
1179484653 21:41702143-41702165 CTCACAGTTCAGAATGGGTAAGG + Intergenic
1181961179 22:26622742-26622764 ATCAAGGCTCAGAGTTGAGAAGG + Intronic
1183387061 22:37520855-37520877 AGCAGAGCTCAGAGAGGGCAAGG + Intergenic
1184231811 22:43162486-43162508 CTCTAAGCTCAGAGAGGGGAAGG + Intronic
1184658591 22:45954901-45954923 ATTAGAGCTCAGAGAGGCTAGGG + Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
949708948 3:6852486-6852508 ATCAGAGTTCAGAGAGGTTAAGG - Intronic
950425660 3:12923616-12923638 ACCAAGGCTCAGAGTGGGAGGGG - Intronic
953579511 3:44141155-44141177 ATCAAAACTGAGAGTGGTTTTGG - Intergenic
954464583 3:50647001-50647023 ACCAAGGCTCAGGGTGGGGAAGG - Intronic
955968485 3:64413260-64413282 ATGAAAGATTAGAGAGGGTAGGG - Intronic
956635755 3:71362839-71362861 ATCAAAGATCAAAGTTTGTAAGG - Intronic
958734668 3:97994750-97994772 ATAGAAGCTCAGAGTGGCTAAGG + Intronic
959145208 3:102535687-102535709 CTCAGAGCTCAGAGAGAGTAGGG - Intergenic
960299501 3:115984939-115984961 ATCAAAGCTTAGATTATGTATGG + Intronic
960699595 3:120427251-120427273 ATCAAAGTTCAGAGAAGGAAGGG - Intronic
962605025 3:137025850-137025872 ATCAAAGCTCAGAGAGGCCAAGG - Intergenic
966951841 3:184827144-184827166 ACCAAAGCTCCGAGTGAGTTGGG + Intronic
970864952 4:20747641-20747663 ATAAAAGCTGAGAGTGGAGAAGG - Intronic
972730371 4:41788687-41788709 TTTAAAGCTCAGAGAGCGTAAGG - Intergenic
973571323 4:52242655-52242677 AGAACAGTTCAGAGTGGGTAGGG - Intergenic
973874640 4:55205176-55205198 ATCAAAGCAGAGAGTGGTTGAGG - Intergenic
973925906 4:55737058-55737080 ATGAGTCCTCAGAGTGGGTAAGG + Intergenic
974486083 4:62507983-62508005 ATCAAAGCTGAGTGTGGGAATGG + Intergenic
975094833 4:70445662-70445684 GACAAAGCTCAGACTGGGTTGGG - Intronic
975731831 4:77345034-77345056 ATGAAAGCTCTGAGTGGGTCAGG + Intronic
976546612 4:86343085-86343107 ATCAAGGAGCAGAGTGGGTTTGG - Intronic
978017300 4:103760656-103760678 ATCACAGCTCAGCATGGCTAGGG - Intergenic
978996489 4:115161643-115161665 AACAGAGTGCAGAGTGGGTAGGG + Intergenic
979267566 4:118721051-118721073 ATGAAGGCTCAGAGTGGAGAGGG - Intergenic
982488253 4:155995455-155995477 ATAAAAGCTGAAAGTGGGTGTGG - Intergenic
983564465 4:169134679-169134701 ATCATAGATCAGAGTAGGAAGGG - Intronic
983921789 4:173353958-173353980 TTCAAAGTTCAGTGTGAGTATGG + Intergenic
984278371 4:177637451-177637473 AACCAAGCTGAGAGTGGGGAAGG - Intergenic
986000458 5:3627097-3627119 ATCAAATCTCAGAGATGGAAGGG - Intergenic
988093664 5:26573685-26573707 TGCAAAGTTCAGAGTGAGTAAGG + Intergenic
988896448 5:35679373-35679395 ATCAAAACTGAGATTGGGTGAGG + Intronic
989411488 5:41124488-41124510 ATGAAAGTGCAGAGTGGGGATGG - Intergenic
990458382 5:56010928-56010950 ATCAAAGCTCAGAGACACTAGGG + Intergenic
991271828 5:64792822-64792844 ATCAAAGCTCACAGGGTGTCAGG - Intronic
991453401 5:66777082-66777104 ATCGAAGCTCAGAGAGGTCAAGG + Intronic
996487816 5:124057399-124057421 ACCAAAGCTGGGAGCGGGTAGGG + Intergenic
999372840 5:151066556-151066578 ATGAAAGATCAGAGTGAGAAAGG + Intronic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
1000204496 5:159045938-159045960 AACAAAGCTCAGATAGGCTATGG - Intronic
1000976111 5:167766169-167766191 ATTTAAGCTCAGAGAGGGTGAGG + Intronic
1001173294 5:169442099-169442121 ATGAAAGCTCACAGTGGCCAAGG + Intergenic
1001953345 5:175831309-175831331 ATCGTAGCTCAGAGAGGGGAAGG + Intronic
1001954291 5:175837755-175837777 ACCAAGGCTCAGAGGGGGTGGGG - Intronic
1002322608 5:178384623-178384645 ACCAAGGCTCAGAGGGGGCAGGG + Intronic
1004988563 6:21110996-21111018 TTCAAAGAGCAGAGTGGATAGGG + Intronic
1007183991 6:39951856-39951878 AAGAAAACTCAGAGTGGGTAAGG - Intergenic
1007387338 6:41528697-41528719 ATCACAGCTCAGAGTGGGTTTGG + Intergenic
1007810264 6:44480641-44480663 CTCAAAGCCCAGTGTGGGTTGGG + Intergenic
1008449026 6:51627940-51627962 ATAAAAGCTCAGTGAGGGTAGGG - Intronic
1009918006 6:70020392-70020414 ATAAAAGCTCATGGTGAGTAAGG - Intronic
1012163620 6:95920934-95920956 AGCAAAGCTCAGAGAAGGCAAGG - Intergenic
1013605330 6:111742183-111742205 ATCTAACCTCAGAGAGGTTAAGG + Intronic
1014126052 6:117778209-117778231 ATAAAAGATGAGAGTGGGAAGGG - Intergenic
1014159746 6:118154234-118154256 ACCAAAACTTAGAGTGGTTAAGG - Intronic
1015734925 6:136388934-136388956 ATTTAGACTCAGAGTGGGTAAGG - Intronic
1015787321 6:136931240-136931262 ACCTGAGCTCAGAGTGGGAAGGG - Intergenic
1017856743 6:158356503-158356525 ATGAGAGCCCAGAGAGGGTAGGG + Intronic
1019703998 7:2488836-2488858 ACCAAAGCTCAGAGGGGGTTGGG + Intergenic
1022255083 7:28648052-28648074 ATCATAGCGCAGAGTTGGAAGGG + Intronic
1022406202 7:30092679-30092701 ACCAGAGCTCAGAGTGGAGAAGG - Intronic
1022816065 7:33915587-33915609 ATGAAGGCTCAGAGAGGGTAAGG - Intronic
1024022730 7:45386532-45386554 ATCAGGGCTCAGAGTAGGTGGGG - Intergenic
1024426285 7:49230045-49230067 ATCGAAGCTCAGATTGTGTCAGG - Intergenic
1025020001 7:55473228-55473250 ATCAAAGCCCCGAGAGGGCAGGG - Intronic
1027221392 7:76216485-76216507 ATCAAGGCTCAGAGAAGGAAGGG - Intronic
1027535983 7:79402505-79402527 ATAGAAGCTCAGAGAGGGTAAGG + Intronic
1028138648 7:87247858-87247880 ATGAAAGCGCAGAGAGGTTAAGG - Intergenic
1030532869 7:110732054-110732076 GTCAAAGCTGAGACTGGGTGGGG + Intronic
1030567285 7:111174512-111174534 TTCAAGGTTCAGAGTGGTTACGG + Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032081918 7:128863413-128863435 ACTAAAGCTCGGAGAGGGTAAGG + Intronic
1032146593 7:129388056-129388078 GTGAAAGCTCAGAGTGCCTACGG - Intronic
1045449946 8:102312630-102312652 AGCAAAGCTCAGAGTCTGTCTGG - Intronic
1045507422 8:102788630-102788652 ATCGAAGCTCAGAGAGGTTATGG - Intergenic
1045818905 8:106311804-106311826 TTCAATGCTAAGAATGGGTAGGG - Intronic
1047284715 8:123477807-123477829 ATGAAAGCACAGAGAAGGTAAGG + Intergenic
1048722550 8:137342866-137342888 ATCAAAGCCCAGATAGGTTAAGG - Intergenic
1049207127 8:141368741-141368763 AGCAAAGCTGGGAGTGGGCAGGG + Intergenic
1049262647 8:141647906-141647928 GCCAAAGCACAGAGAGGGTAAGG + Intergenic
1049428224 8:142546986-142547008 ATCAGGGCTCAGAGTGGCCAAGG + Intergenic
1051289392 9:15529801-15529823 ATCAAACCTGAGAGTGGTTGTGG - Intergenic
1051340079 9:16102912-16102934 TTAAAAGCTGAGGGTGGGTATGG - Intergenic
1051587910 9:18746614-18746636 ATAATAGCTCAGGGTGGGAAGGG + Intronic
1052341360 9:27367187-27367209 ATCAAAGCTCAAAGAGGTGAAGG + Intronic
1055510723 9:76993396-76993418 ATAAAAGATGAGAGTGGGGATGG - Intergenic
1056300223 9:85232637-85232659 ACGAAAGCTCAGAGAGGGCAGGG - Intergenic
1057276810 9:93680566-93680588 AACAAAGCTCAGAGCGAGAAAGG - Intergenic
1058575080 9:106392391-106392413 GTCACAGCTCAGAGAGGTTAAGG - Intergenic
1058679839 9:107431208-107431230 ATCAAAGCTCAGAGAAGTTCAGG + Intergenic
1058823637 9:108755345-108755367 AACAAAGCTCAGAGTAGTTAGGG + Intergenic
1058970411 9:110077180-110077202 ACCAAGGCTCAGAGAGGTTAAGG - Intronic
1060003532 9:119980085-119980107 ATGAAAGCACAGAGGGGTTAAGG + Intergenic
1060023200 9:120149934-120149956 CTCAAAGTCCAGAGTGAGTATGG + Intergenic
1060155313 9:121315871-121315893 ACCAAGGCACAGAGTGGTTAAGG - Intronic
1185525344 X:774076-774098 AGCTAAGATCAGGGTGGGTATGG + Intergenic
1186330474 X:8527031-8527053 ATCAAAGATCAGAGAGGCTGGGG - Intergenic
1186649093 X:11539963-11539985 AACAAACCTCAGGCTGGGTACGG + Intronic
1186732550 X:12425618-12425640 GTCACAGCTGAGGGTGGGTAGGG + Intronic
1190023199 X:46897867-46897889 ATCAAAGCTCAAACAGGATAAGG - Intronic
1192338113 X:70238772-70238794 ACCAAGGCTCAGAATGGTTAAGG - Intronic
1193724642 X:85024905-85024927 AACAGAGCTCTGAATGGGTATGG + Intronic
1195614514 X:106901925-106901947 ACCAAAGCTCAGAGTGGGCAAGG - Intronic
1196742058 X:119033784-119033806 ACCAAGGCTCAGAGAGGTTAAGG + Intergenic
1196891665 X:120297230-120297252 ACCAAAGCACAGAGTGGTTAAGG - Intronic