ID: 999676769

View in Genome Browser
Species Human (GRCh38)
Location 5:154012029-154012051
Sequence TTTTAGAAAGATCACTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 902
Summary {0: 1, 1: 6, 2: 41, 3: 141, 4: 713}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999676767_999676769 17 Left 999676767 5:154011989-154012011 CCACTGAATGGTTTTAAGCAGAA 0: 1
1: 1
2: 25
3: 200
4: 771
Right 999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG 0: 1
1: 6
2: 41
3: 141
4: 713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999676769 Original CRISPR TTTTAGAAAGATCACTTTGG TGG Intronic
901148149 1:7082124-7082146 TTTTAGAAACATCACTCTGGTGG - Intronic
903022718 1:20405229-20405251 TCTTACTGAGATCACTTTGGAGG - Intergenic
904275197 1:29378670-29378692 TATTTGAAAGATAACTTTGCTGG + Intergenic
904490953 1:30858661-30858683 TTCCAGGAAGATCACTCTGGTGG - Intergenic
904970885 1:34418604-34418626 TTATAGAAACATCACTCTTGTGG - Intergenic
905203024 1:36326609-36326631 TTTTGGAAAGATCCCTGTGGTGG + Intronic
905466697 1:38159797-38159819 TTTTAAAAAGATCACCTTGGTGG + Intergenic
905744275 1:40400802-40400824 TTTTAGAAAGATTATTCTGGTGG + Intronic
906047573 1:42843681-42843703 TTTTAGAGAGCTGACTTTGGGGG - Exonic
906114895 1:43349769-43349791 TTTTAGAAAGATTATTCTGGTGG - Intronic
906344680 1:45007748-45007770 TTTTAGAAAGCTCTCCCTGGTGG - Intronic
906459491 1:46026540-46026562 GTTTAGAAAGCTCACTCTGCCGG + Intronic
906598452 1:47102566-47102588 TTTATGAAAGATAACTTTGCTGG + Intronic
906798279 1:48714620-48714642 TTTCAGAAGGACCACTCTGGTGG - Intronic
907035891 1:51215854-51215876 TTTTAGAAACAGCAATCTGGTGG - Intergenic
907325811 1:53638069-53638091 GTTTAGAGGGATCACTCTGGTGG + Intronic
907539000 1:55194992-55195014 TTTAAGGAAGATCATTCTGGTGG - Intronic
907695579 1:56724578-56724600 TTTTAGAAAAATGACTCTGCAGG - Intronic
907766796 1:57421135-57421157 TTTAAGAAAAATTACTTTGGAGG + Intronic
907992893 1:59600012-59600034 TATTAGAAAGATCATTGTGGTGG + Intronic
908066834 1:60415168-60415190 TTTTTGAAAGATAATATTGGTGG - Intergenic
908071732 1:60467895-60467917 TTTTAGAAAGATTATTCTGATGG + Intergenic
908095134 1:60729740-60729762 TTTTAAAAAGATAATTCTGGAGG - Intergenic
908171233 1:61506716-61506738 TTTTATATAGATAGCTTTGGGGG - Intergenic
908238574 1:62170265-62170287 TTTTAAAAAGCCCACTGTGGTGG - Intergenic
908732005 1:67235842-67235864 TTTTAAAAAAATTACTTTTGGGG - Intronic
908881712 1:68740132-68740154 ATTAAGAAAGAACACTTTGGGGG - Intergenic
908889549 1:68828826-68828848 TTTTACAAAGATAACTTTGGAGG + Intergenic
909319415 1:74264467-74264489 TTTTAGAAAAGTAATTTTGGAGG - Intronic
909323607 1:74321289-74321311 TCTTACAAATATCTCTTTGGTGG + Intronic
909475662 1:76078134-76078156 TTTTAGAAAGATAAGTTTTGAGG + Intronic
909498424 1:76305519-76305541 TTTTGGAAAGCTCAGTCTGGAGG + Intronic
909575365 1:77170096-77170118 TTTAAGGAAGATCACTCTGGGGG - Intronic
909761769 1:79297028-79297050 TTTCAGAAAAATCACCTTGCTGG + Intergenic
910099004 1:83556612-83556634 CTTTAGAAAGATTATTTTGGTGG - Intergenic
911489538 1:98546340-98546362 TTTAAGAAAATTCACTCTGGAGG - Intergenic
911625864 1:100123873-100123895 TTTCATAAAGATCACTTTCCAGG + Intronic
911677476 1:100675738-100675760 TTTTAAAAACATCAGTTTGCAGG + Intergenic
911721908 1:101200258-101200280 TTTTTAAAAGACCACTCTGGTGG - Intergenic
912359135 1:109080256-109080278 TTTTAAAAAGATCACTTTTGCGG + Intergenic
912823571 1:112886084-112886106 TTTCAGAAATATCACTTTGATGG - Intergenic
913203945 1:116518408-116518430 CTTTAGTAAGATCACTCTGCTGG - Intronic
913284551 1:117214563-117214585 TTTTAGAAAGATCATTCTAGTGG - Intergenic
914425098 1:147568675-147568697 TTTTAGAAAGATCTGTAGGGAGG - Intronic
914833374 1:151187406-151187428 TTTTACAAACATCAGTTAGGAGG - Intronic
914978445 1:152389577-152389599 TTTTAGAAAGTTCGTTCTGGAGG - Intergenic
915017845 1:152752809-152752831 TTTTAGGATGATCACTCTTGTGG + Intronic
915112163 1:153570883-153570905 TTTTAGAAAGGTTATTCTGGTGG - Intergenic
915560364 1:156683572-156683594 TCTTAGAAAGATCATCTTGGAGG + Intergenic
915842458 1:159225625-159225647 TCATACATAGATCACTTTGGAGG + Intergenic
916207607 1:162330688-162330710 TTTTAAAAATAACACTTTGCTGG + Intronic
916564691 1:165963850-165963872 TCTTAAAAAGATCATTTTGCTGG + Intergenic
916628290 1:166583440-166583462 TTTTAGAAAGTCAACTCTGGTGG - Intergenic
916826307 1:168445179-168445201 TTCTAGAAAGATGACCCTGGTGG + Intergenic
916860776 1:168802678-168802700 TTTTGGAAAGAGCATTCTGGTGG - Intergenic
917529453 1:175821694-175821716 TTTGAACAAGATCACTTAGGAGG - Intergenic
918257873 1:182766315-182766337 TGTTTGAAAGATCACAATGGCGG - Intergenic
918555307 1:185792132-185792154 TTTTAGAAGGATAACTCTGAAGG + Intronic
918743367 1:188165858-188165880 TTTTAGAAACATCACTTAGGTGG - Intergenic
918847081 1:189630328-189630350 TTTATGAAAGAATACTTTGGTGG + Intergenic
919088236 1:192947130-192947152 TTTTAGAAAGATTAGGTTAGTGG - Intergenic
919116905 1:193291414-193291436 TTTTAGAAAGATCACGTCATAGG + Intergenic
919166151 1:193896060-193896082 TTTTAGAAAGATTTCTCTGCCGG + Intergenic
919799486 1:201344800-201344822 ATTTAGAAAGATGACTCTAGTGG - Intergenic
919937858 1:202266478-202266500 GTTGAGAAAGACCACTCTGGTGG - Intronic
919939749 1:202278133-202278155 TTTTAGGAAGATTAATTTGAAGG + Intronic
920857055 1:209671564-209671586 TTTTAGGAAGATTCATTTGGTGG + Intergenic
920988598 1:210914343-210914365 TTTTAGAAAAATCAGTATGTTGG + Intronic
921602488 1:217121407-217121429 TTTTAGAAAAATCACTCTCCTGG + Intronic
921927433 1:220723153-220723175 ATTTAGAAAGTTTACTTTGCCGG + Intergenic
922957047 1:229611767-229611789 TTTTAGAAAACTCAGTCTGGTGG - Intronic
923955458 1:239013368-239013390 TCTTATAAAGTTCACTCTGGTGG + Intergenic
924062813 1:240193815-240193837 TTTTAGAAAGATAACTCTGGAGG - Intronic
924195169 1:241599618-241599640 TTTTCAAAACATCATTTTGGGGG + Intronic
924271324 1:242335824-242335846 TATTAGAAATATCAATTTGTGGG - Intronic
924715389 1:246567998-246568020 TTTTAAAAAAAACACTGTGGTGG + Intronic
1063252050 10:4284341-4284363 TTTTAGAAAGACAACTTTACAGG - Intergenic
1063292632 10:4765286-4765308 CATTAGAAAGATAAATTTGGGGG + Intergenic
1063462186 10:6221882-6221904 TGTTAGAAGGTTCAGTTTGGGGG - Intronic
1064040902 10:11962631-11962653 TTTTAGAAAGATTAGTATGGAGG - Intronic
1064664855 10:17640306-17640328 TATTAGAAAAATCATTCTGGCGG + Intergenic
1065555623 10:26912713-26912735 TTTAAGAAACATCCCTTTAGAGG + Intergenic
1065739487 10:28784308-28784330 CTTTGGAAAGATCATTCTGGTGG + Intergenic
1066506190 10:36046956-36046978 TTTTTGAAAGATAGCTTTGCTGG + Intergenic
1066713344 10:38260295-38260317 TATTAGAAATATCAATTTGTAGG + Intergenic
1067363549 10:45603810-45603832 TTATAAAAAGTTCACTTTGGAGG - Intergenic
1067422272 10:46163375-46163397 TTTTATAAGGCTCACATTGGAGG + Intergenic
1067484479 10:46634968-46634990 TTTTCGAAGGATGATTTTGGAGG - Intergenic
1067507578 10:46869273-46869295 TTTTATAAGGCTCACATTGGAGG + Intergenic
1067610280 10:47706679-47706701 TTTTCGAAGGATGATTTTGGAGG + Intergenic
1067840145 10:49669233-49669255 TTTTAGAAAGGTCCTTTCGGGGG - Intergenic
1067857970 10:49813492-49813514 TGTTAGGAAGATATCTTTGGGGG - Intergenic
1068003549 10:51365735-51365757 TTTGAGAAACATCATTTTTGGGG + Intronic
1068059480 10:52049541-52049563 TATTTGAAAGGTCACTTTGATGG + Intronic
1068626691 10:59256736-59256758 CTTTATGAAGATCACTTTGCAGG - Intronic
1068711530 10:60140593-60140615 TTTTAAAAAGATTTTTTTGGGGG - Intronic
1068716304 10:60192828-60192850 TTTTTAAAAAATCAATTTGGGGG - Intronic
1069393643 10:67964595-67964617 TTTTTGAATGATCACTTTGTTGG - Intronic
1070693076 10:78542152-78542174 TTCTAGAAAGATCACTCTGTGGG - Intergenic
1071038398 10:81276275-81276297 TTGTAGAAAGAAAACTTTGAAGG - Intergenic
1071325323 10:84509996-84510018 TTTTAGAATGATCACTCCAGTGG - Intronic
1071362034 10:84857803-84857825 TTTTAAAAAATTCAATTTGGAGG - Intergenic
1071447706 10:85764250-85764272 TTTGAGAACCATCACTTTGCAGG - Intronic
1071546129 10:86531223-86531245 TTTTAGAAATATCATTCTGGGGG - Intergenic
1071851144 10:89571791-89571813 TTTTTCAAAGATAATTTTGGAGG + Intergenic
1072838522 10:98743508-98743530 TTTTAGAAGGATCATCTTGTAGG + Intronic
1072931436 10:99666520-99666542 TTAAAGAAAGCTCACTTTGGTGG + Intronic
1073739955 10:106394995-106395017 TTTTAGAGAGATCATTGAGGTGG + Intergenic
1073776615 10:106793516-106793538 ATTCAGAATGATCACTTTGGAGG + Intronic
1074116898 10:110462992-110463014 GCCTAGAAAGATCACTCTGGCGG + Intergenic
1074350859 10:112735356-112735378 TTAAAGAAAGATGAATTTGGAGG - Intronic
1074808249 10:117075880-117075902 TTTTAGAAAGATAACTTTAGAGG + Intronic
1075432243 10:122396270-122396292 TTTTGAAAAAATCACTTTGGTGG + Intronic
1075652532 10:124138384-124138406 TTTGAGAAAGTCCACTGTGGAGG + Intergenic
1077097877 11:806877-806899 TTTTAAAAAGATCTCTTGGCCGG - Intronic
1077663266 11:4087644-4087666 TTTTAGAAATAACATTTTAGTGG + Intronic
1078462723 11:11527121-11527143 TTTTGGAAGGATCACTATGCAGG - Intronic
1078908446 11:15708978-15709000 GTATAGAAAGATCAATATGGTGG - Intergenic
1078963062 11:16302194-16302216 TTTAAGAAAAGTAACTTTGGTGG - Intronic
1079151982 11:17908117-17908139 TTTTAGAAAGATCACTGTGATGG - Intronic
1079170732 11:18092867-18092889 TCTTAGGAAGATTACTCTGGTGG + Intronic
1079287121 11:19145393-19145415 TTTAAGAAAGATCGCATTGGAGG - Intronic
1079291248 11:19189855-19189877 TTTTATGAAGATGAATTTGGGGG + Intronic
1079293407 11:19209542-19209564 GTTTTGAAAGATGACTCTGGTGG - Intronic
1079809329 11:24976175-24976197 TTGGAGACAGAGCACTTTGGGGG - Intronic
1080056916 11:27916135-27916157 TTTCAGAAGCATCACTTTTGTGG + Intergenic
1080068504 11:28049024-28049046 TATTAGGAAGATCACTTTGTTGG + Intronic
1080320500 11:31003813-31003835 TTTTAGAAAGAGCACAATGTAGG + Intronic
1080398423 11:31911486-31911508 TTTTTAAAAGTTAACTTTGGAGG - Intronic
1080779249 11:35415840-35415862 TTTTAGAAATATCTTCTTGGAGG - Intronic
1081037040 11:38161558-38161580 TTCTAGAAAGATGACCATGGAGG - Intergenic
1081394820 11:42574359-42574381 TGTTAGAAAGAACACTTTCCTGG + Intergenic
1082225014 11:49694773-49694795 ATTTAAAAAAATCATTTTGGGGG - Intergenic
1083400155 11:62418027-62418049 TTTTAGGAAGATCATTCTGATGG + Intronic
1083597462 11:63925151-63925173 TTTTAGAAAGATCACCCTGGAGG - Intergenic
1083807270 11:65082184-65082206 TTTAAGAAAGACCCCTCTGGGGG - Intronic
1084851427 11:71944378-71944400 TTATAGAAAGATCATTCTTGGGG + Intronic
1085136935 11:74099479-74099501 TTTTACAAAGAGCACCTTTGTGG - Intronic
1085141377 11:74145810-74145832 TATTAGAAAGAAAAATTTGGGGG - Intronic
1085439509 11:76545829-76545851 TGTTACAAAGATAACTTTTGAGG + Exonic
1085614456 11:77985225-77985247 TTTTAGAAATGTCACTCTGAGGG - Intronic
1085893032 11:80603579-80603601 TTTCAGAAAGATTATTTGGGTGG + Intergenic
1086008814 11:82073346-82073368 TTTTAGAAAAGTCACTCTGCTGG - Intergenic
1086429045 11:86717533-86717555 TTTTAAAATGAACAGTTTGGTGG - Intergenic
1086624094 11:88924953-88924975 ATTTAAAAAAATCATTTTGGGGG + Intronic
1086849201 11:91789139-91789161 TTTTAAAAATATCTCTATGGTGG - Intergenic
1087517637 11:99184134-99184156 TTTTAAAAACTTCACTATGGTGG - Intronic
1087666700 11:101057513-101057535 TTTTAGAAAAATGATTCTGGGGG + Intronic
1087676210 11:101164963-101164985 TATTAGAAAGATAACTTTGCTGG + Intergenic
1087808897 11:102588836-102588858 TTTTTGAAAGATAACTCTAGTGG + Intronic
1088041677 11:105392450-105392472 TTATAGTAAGCTCACTTTTGAGG + Intergenic
1088425643 11:109698384-109698406 TCTTAGAAAGCTTAGTTTGGTGG - Intergenic
1088721949 11:112600275-112600297 GTTTAGAAAAATTATTTTGGAGG + Intergenic
1088946587 11:114519405-114519427 TTTAATAAAGTTCTCTTTGGGGG + Intergenic
1089009620 11:115121907-115121929 TTTTAGAAAGGCCACTTTGATGG + Intergenic
1089034069 11:115366848-115366870 ATGTAGAAAGATGACTTTAGGGG - Intronic
1089204631 11:116749755-116749777 TTTCAAAGAGATCACTCTGGAGG + Intronic
1089680925 11:120118481-120118503 TTTTAGAAAGATAGCTTTGGTGG - Intronic
1089901233 11:121987956-121987978 TTTTTGAAAGATAAGTATGGAGG + Intergenic
1090484043 11:127096114-127096136 CTTTAGGAAGATCACTTTGTAGG + Intergenic
1091114366 11:132999485-132999507 TGTCAGAAAAATCACTTTAGAGG + Intronic
1091363255 11:134995034-134995056 TTTTAGACAGAGGACTTTTGGGG - Intergenic
1091998320 12:5013122-5013144 TTTTAGGAAGATTACTGTGGTGG + Intergenic
1092055026 12:5501634-5501656 TTTTAAGAAGATAATTTTGGTGG + Intronic
1092185011 12:6472393-6472415 ATTTGGATAGATAACTTTGGTGG - Intergenic
1092442139 12:8514572-8514594 TTTTAGAAGGATCAATTTAGTGG - Intronic
1093233670 12:16579594-16579616 GTAAAGAAAGATCACGTTGGTGG + Intronic
1093434503 12:19121076-19121098 TTTTGAAAAGATCATTTGGGTGG + Intergenic
1093717389 12:22399287-22399309 TTTTAGGCAAATCACTTAGGAGG + Intronic
1093886726 12:24469696-24469718 TTTTGTAAAGCTCACTTTGTGGG + Intergenic
1094177463 12:27555743-27555765 TTTAAGAAATATTATTTTGGGGG + Intronic
1095536502 12:43254589-43254611 TTTTTGAAAAAGCACTTTAGTGG - Intergenic
1095932886 12:47646832-47646854 TTTTAGAAAGATGAAGGTGGAGG - Intergenic
1096715698 12:53489989-53490011 TTTTAGAAAGATCCTTCTGAAGG - Intronic
1097079579 12:56420324-56420346 TTTTAAAAAGATAAATCTGGAGG + Intronic
1097652348 12:62316301-62316323 TTTTAGAAAGATGACTCTATGGG - Intronic
1098012212 12:66065607-66065629 TTTGAAAAAGATGACTATGGTGG + Intergenic
1098318071 12:69212915-69212937 TTTTAAAAAGAATACTTTGGTGG - Intergenic
1098430286 12:70411904-70411926 TTTTAGAAAGATGAGTCTAGTGG + Intronic
1098437309 12:70481649-70481671 TTTTAGATAAATCATTCTGGTGG + Intergenic
1098463463 12:70759950-70759972 GTTGAGAAAGATTACTTTGGTGG + Intronic
1099473926 12:83084869-83084891 TTTTAGAAATCTGACTATGGTGG + Intronic
1099788881 12:87304474-87304496 TTTTAGAAAGATCGATCTGTAGG - Intergenic
1099866415 12:88287945-88287967 TTTTAGAAATATCTTTCTGGTGG - Intergenic
1100220155 12:92496281-92496303 CATCAGAAAAATCACTTTGGTGG + Intergenic
1100908693 12:99333048-99333070 TTTTAGAAACATCACTCTGGAGG + Intronic
1100951943 12:99860539-99860561 TTTTAGAAAGATCCCTCTGGAGG + Intronic
1101221549 12:102646621-102646643 TTTTAGAGAGACCACTCTGGAGG + Intergenic
1101255854 12:102975830-102975852 GTTTTAAAAGATCACTTTGGTGG - Intergenic
1101546367 12:105717077-105717099 TTTTGGAGAGATCACTCTGGTGG + Intergenic
1101956414 12:109216180-109216202 TTTTAGAAAGGACACTGAGGTGG - Intronic
1102226923 12:111235351-111235373 TTCCAGAAAGATCTCTCTGGAGG + Intronic
1102643076 12:114383561-114383583 TTTTACAAAGATCTCTTTGGTGG + Intronic
1102975314 12:117202726-117202748 TTTTAGGAAGGGCACTCTGGGGG + Intergenic
1103123363 12:118399558-118399580 TCTCAGGAAGATCACTTTGAGGG + Intronic
1103849308 12:123921415-123921437 TTTTCCAAAGTTCACTTGGGTGG + Intronic
1103930250 12:124446312-124446334 GTTTTAAAAGTTCACTTTGGTGG - Intronic
1104081108 12:125431181-125431203 TTTTTGAAAGATCTGCTTGGAGG + Intronic
1104286548 12:127429862-127429884 TTTTACACTGAGCACTTTGGTGG - Intergenic
1104678912 12:130735429-130735451 TTTTTGAAGGATAATTTTGGTGG + Intergenic
1105445204 13:20447974-20447996 CTTTTGAAAGATCACTTTCTCGG - Intronic
1105470828 13:20693235-20693257 TTTTAGTAAGATAGATTTGGGGG + Intergenic
1105796630 13:23860642-23860664 TTTTAGACAAATCCCTCTGGTGG + Intronic
1105808805 13:23975599-23975621 TTTTAGAAAGAGAAGGTTGGAGG - Intergenic
1106353202 13:28954838-28954860 TTTTGGAAAGGTCACTTCGAGGG + Intronic
1106618195 13:31349892-31349914 CTTTAGAAAGATTACTCTGGGGG - Intergenic
1106672645 13:31923059-31923081 TTTTAGAAAGATAATTTTAATGG - Intergenic
1107054711 13:36090549-36090571 TCTTAGAAAGAGCTCTCTGGAGG + Intronic
1107113083 13:36718694-36718716 TTTTAGAAAGTTCAGGCTGGAGG - Intergenic
1107305048 13:39009204-39009226 CTTTAGAAAAATCACTTAGGTGG - Intergenic
1107505914 13:41033011-41033033 TTTTTAAAAAATCATTTTGGGGG - Intronic
1107621744 13:42239700-42239722 TTTTAGAGAGACCACTCTGGTGG - Intronic
1107635792 13:42390920-42390942 TTTTAGAAAGTGCACGTTGTTGG - Intergenic
1107809724 13:44188723-44188745 TTCCAGAAAGATCACTCAGGTGG - Intergenic
1108391062 13:49948041-49948063 TTTTAGAAAGTTTATTTTGCAGG - Intergenic
1108470028 13:50758413-50758435 TTTTACACTGCTCACTTTGGGGG - Intronic
1108495651 13:51022267-51022289 GTTTAGAATGATCACTCTGGAGG - Intergenic
1109387018 13:61643642-61643664 TTTTTGAAAGATAATTTTGCTGG + Intergenic
1109415883 13:62039460-62039482 TTTTAGAAAGACCATTTTACAGG + Intergenic
1109755889 13:66760088-66760110 TTTCAGAAAGATAGCTTTGCAGG + Intronic
1110036463 13:70692095-70692117 TTTTTGAAAGATAATTTTGTTGG + Intergenic
1111151793 13:84263013-84263035 TTTTAGAAAAATCACTGTAATGG + Intergenic
1111572872 13:90109433-90109455 TTTTAGAAAGATAAATGTGTGGG - Intergenic
1112128659 13:96497610-96497632 TTTTCAAAGGATCACTTTGAGGG - Intronic
1112240392 13:97675781-97675803 TTCAAGAGAGATCACTTTGCTGG - Intergenic
1112745116 13:102519089-102519111 TTTTAAAAAAATCAATTTGTAGG - Intergenic
1113055559 13:106263279-106263301 TTTTTGAAAGATCACTGGAGCGG - Intergenic
1113194981 13:107792426-107792448 TTTTATAAAGATCTGTTTGTGGG - Intronic
1113216835 13:108051330-108051352 TTTTACAATGATCTCTTTGCTGG + Intergenic
1113552116 13:111200617-111200639 TTTTGGAAAGGTCATTTTGAAGG - Intronic
1114310840 14:21465594-21465616 ATTTTAAAAGATCACTCTGGAGG - Intronic
1114546418 14:23505653-23505675 CTTCAGATAGATTACTTTGGTGG - Intronic
1114986398 14:28234754-28234776 TTTTTGAAAGATCATTTTGCTGG + Intergenic
1115153848 14:30315654-30315676 TTTTAAAAGTATCACTTTGCTGG - Intergenic
1115286963 14:31725114-31725136 TTTTAAAAGGATTACTTTGGTGG + Intronic
1115394757 14:32895669-32895691 TTGTAAAAAGATCACTCTGATGG - Intergenic
1115678687 14:35711770-35711792 TTTTAAAAAGAGGACTTGGGTGG - Intronic
1115879917 14:37904206-37904228 TTTTAAACAGATAACATTGGAGG - Intronic
1115883172 14:37943424-37943446 TTTTTTAAAAATCACTTAGGAGG - Intronic
1115945391 14:38654081-38654103 TTTTAAAAGCATCACTTTGGTGG - Intergenic
1116163304 14:41298961-41298983 TTTTAAAAAAATCATATTGGTGG + Intergenic
1116549520 14:46218129-46218151 TCTTAGCAAGATCACCTTGCTGG + Intergenic
1116763819 14:49046958-49046980 TTTTAGAAAGTTCATGTTGGTGG + Intergenic
1116914167 14:50506240-50506262 TTTTAAAAGGATCTCTTTGAAGG - Intronic
1117746093 14:58870715-58870737 TCTTATAAATAACACTTTGGAGG - Intergenic
1117873680 14:60227046-60227068 TTTTAGAAAGATTACACTGATGG - Intergenic
1117965461 14:61203030-61203052 TTTTAAAAAAATCAATTAGGGGG - Intronic
1118058699 14:62111515-62111537 TTTTATAAATTTCACTTTTGTGG + Exonic
1118528798 14:66677840-66677862 TTTTTGAAGGATAACTTTGTTGG + Intronic
1118673024 14:68151153-68151175 TTTTTGAAAGATATCTTTGTTGG + Intronic
1118799698 14:69178316-69178338 TTTTAGAAAGATAAGTCTGGAGG + Intergenic
1119136772 14:72228509-72228531 TTTGAGAAAGATAATTCTGGTGG + Intronic
1119409345 14:74420006-74420028 TTTTAGACAGAGCACTCTGATGG + Intronic
1119783447 14:77295006-77295028 GTTTAGAAAGGTAACTTTAGTGG - Intronic
1119919990 14:78437949-78437971 TTTTAGAAAGATCTTTCTGGTGG + Intronic
1120017341 14:79488822-79488844 TTTTAGAATGATCTCTTTGGGGG + Intronic
1120067027 14:80054511-80054533 TTTTAGGAAGAGGACTTTGTGGG + Intergenic
1120860151 14:89247719-89247741 TTTTATAAAGATGACTCTGCAGG - Intronic
1121147659 14:91599258-91599280 ATTTAGAAAGTTTACTTTGCCGG + Intronic
1121326982 14:93026278-93026300 TTTTAAAAAAATCAGTTTGTAGG - Intronic
1121923641 14:97907109-97907131 TTTTAGTAACTTCATTTTGGGGG - Intergenic
1121948408 14:98145916-98145938 TTTTAAATAGGTCACTTCGGGGG - Intergenic
1122245708 14:100401885-100401907 TTTTAGCATGGACACTTTGGAGG + Intronic
1124147872 15:27146004-27146026 TTTTTGAAGGATCACTTTGTTGG - Intronic
1124859436 15:33424371-33424393 TTTTAGAAAAATAACTCTGCAGG - Intronic
1124944285 15:34249097-34249119 TTTTAGAAAAGTCATTCTGGTGG + Intronic
1125019273 15:34969061-34969083 TTTTAGATAGGTCTATTTGGAGG + Intronic
1125217415 15:37291101-37291123 TTTTAGTATGATCACCTTGGGGG + Intergenic
1125270746 15:37936075-37936097 TGTTAGATTGAGCACTTTGGAGG + Intronic
1126266274 15:46757073-46757095 TTTAAAAAAGCTCTCTTTGGAGG - Intergenic
1126351439 15:47748832-47748854 TTTTAGAAAGATCATTCTGGTGG + Intronic
1126354954 15:47785550-47785572 TTTTAGAAAGATTATTCTGATGG - Intergenic
1126453030 15:48830800-48830822 TTTCAGAAATATGACCTTGGCGG - Intronic
1126456610 15:48869365-48869387 TTGTAGAAAGATTACTATGTTGG + Intronic
1126634521 15:50767778-50767800 TTTTAGAAAGCTCTCTATGGTGG + Intergenic
1127550018 15:60027990-60028012 TTTAAAAAGGATCACTCTGGTGG - Intronic
1128101104 15:65000569-65000591 TTTTGGAAATTTAACTTTGGTGG - Intergenic
1129068489 15:72931283-72931305 TTTTAAAAAAATCACTTTGTGGG - Intergenic
1129991261 15:79965434-79965456 TTTTAAAAATATCGCTGTGGGGG + Intronic
1130236209 15:82136120-82136142 CTTTATAAAAATCACTTTTGAGG + Intronic
1130436594 15:83905633-83905655 TTTTTGAAAGATCCCTCTGGTGG + Intronic
1130441018 15:83954722-83954744 TCATAGAGATATCACTTTGGTGG + Intronic
1131197136 15:90364621-90364643 TATCAGGAAGATCAGTTTGGAGG - Intronic
1131578019 15:93611667-93611689 TTTTAAAAAGACAACATTGGTGG + Intergenic
1131824545 15:96307910-96307932 TTTTATAAATATCATTTTTGAGG + Intergenic
1131843869 15:96468379-96468401 TTTTAGAAAGATTAACCTGGAGG + Intergenic
1131974572 15:97931391-97931413 TTTTAAAATGACTACTTTGGTGG - Intergenic
1132163005 15:99560998-99561020 TTATAGAAAGTTAAATTTGGAGG + Intergenic
1132476140 16:138906-138928 TTTTACAAATAACACTTGGGCGG + Intergenic
1134324938 16:13198879-13198901 TTTGAGAGGGATCGCTTTGGTGG + Intronic
1134797556 16:17055615-17055637 TTTTGGAATGATGACTTTGCTGG + Intergenic
1135636479 16:24080088-24080110 CTTTTGAAAGATCACTTTGGTGG + Intronic
1135711180 16:24718699-24718721 AGTTAGAAAGACCTCTTTGGTGG + Intergenic
1135828980 16:25756307-25756329 GTTTAGTAAAATCACTCTGGTGG + Intronic
1137542353 16:49373570-49373592 TTTTATTAAGATCTCTGTGGAGG + Intergenic
1137947371 16:52746950-52746972 TTTTAGAAAGATTACTCTGATGG - Intergenic
1138171062 16:54850021-54850043 GTTTAGAAAGATCAGTGTTGAGG - Intergenic
1138177319 16:54912552-54912574 TTTTAAATATATCACTTTGGTGG - Intergenic
1138308453 16:56001748-56001770 ATCTAGAAAGAACAGTTTGGTGG + Intergenic
1139064353 16:63293463-63293485 GTTTAGAAAGATCTCCCTGGTGG - Intergenic
1139551742 16:67677201-67677223 TTTTAAAAAGAAAATTTTGGAGG - Intronic
1139877638 16:70158877-70158899 CTTTACAAAGATGGCTTTGGAGG - Exonic
1140242503 16:73216215-73216237 TTTTGGAAAGATAACTTAGGTGG - Intergenic
1141118256 16:81330223-81330245 TTCTAGAAACATCACTCTGGCGG - Intronic
1143283744 17:5773919-5773941 TTTTAGAAAGATGTCTCTGCTGG + Intronic
1143287684 17:5802376-5802398 TTTTAGAAAGATCCCTTGGGGGG - Intronic
1143360862 17:6369626-6369648 TGATTGATAGATCACTTTGGGGG - Intergenic
1143374637 17:6459996-6460018 TTATAGAAAGATCCCATTGGTGG - Intronic
1144531982 17:16048361-16048383 TTTTAGACAAATCACTCAGGTGG + Intronic
1145113736 17:20188859-20188881 TTCTATTAATATCACTTTGGGGG - Intronic
1146458035 17:33022247-33022269 TTTTAGAAAGATCCTTCAGGCGG - Intronic
1146585623 17:34079119-34079141 TTTTAGAAGTATCACTCTGGTGG - Intronic
1146783562 17:35698137-35698159 TATTAGAAAGTTTACTTTGGTGG + Intronic
1146974074 17:37096176-37096198 TTTTAGAAAGACCACTAAGGGGG - Intronic
1147023759 17:37562203-37562225 TTTTACAAAGATCACATCAGCGG + Intronic
1147558336 17:41493898-41493920 TTTTGGAAAAATTACATTGGTGG - Intergenic
1149059930 17:52409862-52409884 TTTAAGAAATAACAGTTTGGGGG - Intergenic
1149462032 17:56836605-56836627 TTTTAGAAAGATCATTTGGGTGG - Intronic
1150151437 17:62812075-62812097 TTTCAGAAATAACACTTTTGAGG + Intergenic
1150492988 17:65587173-65587195 TTTTAGAAAGCTCCCTGTTGTGG + Intronic
1150610024 17:66726484-66726506 TTTCAGGAAGACCACTGTGGAGG + Intronic
1150903638 17:69312960-69312982 TTTTATAAAACTGACTTTGGTGG + Intronic
1151245736 17:72793136-72793158 TTTTAGGAAGATAATTCTGGGGG + Intronic
1152916779 17:83041857-83041879 TTTTTGAAAGATGACTTTGCTGG - Intronic
1153232888 18:2956989-2957011 TTTTAAAATAATCACGTTGGTGG - Intronic
1153527856 18:6014819-6014841 TTTCAAAAATGTCACTTTGGTGG + Intronic
1153602865 18:6798811-6798833 TTTTATTTAAATCACTTTGGTGG - Intronic
1153856013 18:9147788-9147810 TTTTAGGAAGATCAGTTGTGTGG + Intronic
1153896935 18:9571900-9571922 TTTTAGAAAGACCATTCTGGAGG + Intronic
1153998479 18:10462925-10462947 TTTTGGAAAAATCACTTTTCTGG - Intronic
1154240117 18:12645708-12645730 TTTTAGAAAGATAAATGTAGGGG - Intronic
1155025746 18:21939197-21939219 TATTAGAAATATCACTCTGCTGG - Intergenic
1155348939 18:24886772-24886794 TTTTAGAAAGACTAATTCGGTGG - Intergenic
1155535151 18:26809300-26809322 TTTTAGAAAGACAATTCTGGGGG + Intergenic
1155569200 18:27171652-27171674 GTTTAGAAAAAACACTTTCGTGG - Intronic
1155820773 18:30372627-30372649 TTTTAAAAAGATCATTTTATTGG + Intergenic
1155865982 18:30965290-30965312 TTTAAGAAAGATCACTCTATTGG - Intergenic
1155876261 18:31093067-31093089 TTTTAGAATGATAACTCTGTTGG - Intronic
1156064477 18:33123123-33123145 TAGTAGAAAGCTCACTTTTGAGG + Intronic
1156088264 18:33435174-33435196 TTTTAAAAAGAGCAATTTTGGGG + Intronic
1156284665 18:35679983-35680005 TTTAAAAAAGCTCACTCTGGAGG - Intronic
1156285721 18:35693739-35693761 TTTAAGAATATTCACTTTGGGGG + Intronic
1156320212 18:36013868-36013890 TTCTAGATAGATCATTTTGTTGG - Intronic
1156432887 18:37094394-37094416 TTTTTGAAGGATAACTTTGCTGG - Intronic
1156521014 18:37722321-37722343 ATTTAGAAAACTCACTTAGGAGG + Intergenic
1156926055 18:42581083-42581105 TTTTAGAAAGGCCACTTTATTGG + Intergenic
1157807799 18:50671178-50671200 TTTAAGCATGATGACTTTGGAGG + Intronic
1157841367 18:50962087-50962109 TTTTTGAAAGATAGCTTTGCTGG + Intergenic
1157912093 18:51625775-51625797 TTTTAGGAAGAACACTATGAAGG - Intergenic
1158017064 18:52796563-52796585 TTTTTGAAAGATACCTTTGCTGG + Intronic
1158148172 18:54339621-54339643 TTTTTGAAAGATAACTTAGCTGG - Intronic
1158337716 18:56432090-56432112 TTGCAGAAGGCTCACTTTGGAGG + Intergenic
1158555226 18:58469523-58469545 ATTTAGAAAGATTGATTTGGTGG + Intergenic
1158653116 18:59305414-59305436 TTTTAGAAACCTCAGTATGGAGG + Intronic
1159881742 18:73864831-73864853 TTTTAGAAAAATTACTTTGGTGG - Intergenic
1160927734 19:1555230-1555252 TTTTTTAAAGATCACCCTGGAGG + Exonic
1160972096 19:1774083-1774105 TCTAAGAAAGAAGACTTTGGAGG - Intronic
1161741127 19:6021823-6021845 TTTTAGCAGGATCACTCTGGTGG + Intronic
1162200750 19:9018343-9018365 TTTTTGAAAGGTCACTCTGTTGG - Intergenic
1162425731 19:10594273-10594295 TTTCAGAGAGATCTCTTTAGTGG - Intergenic
1164891271 19:31825740-31825762 TTTCAGCAAGATTACTCTGGGGG - Intergenic
1165242501 19:34480118-34480140 TTTTGGGAAGAGCAGTTTGGCGG - Intergenic
1165408925 19:35646564-35646586 TTTTAGGAAGATCTCATTGCAGG + Intergenic
1166342488 19:42147049-42147071 TTTTAGAAAGACCCCCTTTGGGG - Intronic
1166585026 19:43938054-43938076 TTTTTAAAAGATAAGTTTGGTGG + Intergenic
1167058220 19:47126707-47126729 TTGTAAAATGATCACTTTGTTGG - Intronic
926093806 2:10067316-10067338 TTTTAAAAAGATAACATTGCTGG - Intronic
926733216 2:16053067-16053089 TTTTGGAAAGATCACTTTGGTGG + Intergenic
926741651 2:16116238-16116260 TTTTAGAAAGCTCACCCTGGAGG + Intergenic
926765995 2:16323132-16323154 TCTCTGAAAGATCCCTTTGGTGG - Intergenic
926931180 2:18042654-18042676 TTTTAGAAAAGTCACTCTTGGGG - Intronic
926983242 2:18593846-18593868 TTTTAGAAAGATCTCTTTAGTGG - Intergenic
927464154 2:23324503-23324525 TTTATGGAAGATCACTCTGGAGG - Intergenic
928373035 2:30754903-30754925 TTTTAGAAAGATCATTTCAATGG - Intronic
929177437 2:38994939-38994961 TTTTAGAAATTTCAAGTTGGTGG + Intronic
929311654 2:40432781-40432803 TTTTAGAAGGATCTCTCTGCTGG + Intronic
929341829 2:40828728-40828750 TTTTACAAATATAACTTTGGGGG - Intergenic
929399542 2:41564056-41564078 TTTTTGATAGATAATTTTGGAGG - Intergenic
929711783 2:44273635-44273657 TATAAGAAAAATGACTTTGGGGG - Intergenic
930166629 2:48209757-48209779 TTTTAGAAAAAGCACTCTGAGGG + Intergenic
930426351 2:51217503-51217525 TTTTAAAAACATCATTTTGTGGG - Intergenic
930504120 2:52260725-52260747 TTTTAGATATATCGCTTTGCTGG + Intergenic
931514695 2:63041780-63041802 TTTTGTAAAGAGCACATTGGGGG - Intronic
931819823 2:65940554-65940576 TTTTAGGAACATCACATTGAAGG - Intergenic
932132136 2:69197283-69197305 TTTTACAAGGAGCACTGTGGTGG - Intronic
932300054 2:70660488-70660510 TTTTAGGAAAATCCCTTTGGTGG - Exonic
933238535 2:79893239-79893261 TTTTAGAAAGTTAACTTTAGTGG - Intronic
933261085 2:80132187-80132209 TGTTAGCTAGAGCACTTTGGAGG + Intronic
933273663 2:80260876-80260898 TTTTACAATGATTGCTTTGGTGG - Intronic
933557953 2:83854290-83854312 TTTTTGAAACATAGCTTTGGTGG - Intergenic
933781685 2:85807017-85807039 TTTTGGAAAGATCACTTTGGTGG + Intergenic
934667708 2:96184578-96184600 TTAAAAAAAGATCACTTTGGAGG - Intergenic
935243410 2:101197516-101197538 TTTTAAAAATGTCAGTTTGGAGG - Intronic
935713001 2:105915932-105915954 TTTTCCAAAGATGATTTTGGGGG + Intergenic
936021517 2:108998609-108998631 TTTTAGATAAATCACTGTAGAGG - Intergenic
936022450 2:109005249-109005271 TTTTAGAAAGATTAGTCTGGAGG - Intergenic
936432251 2:112474737-112474759 CTTTAGAAAGATTAATTTGGTGG + Intergenic
936469196 2:112783490-112783512 TTTTAGAAAAATTATTTTTGAGG - Intronic
936507974 2:113123234-113123256 TTTCCAAAAGATCTCTTTGGAGG + Intronic
936647037 2:114384100-114384122 TTTCAGAAAAATCACCCTGGGGG + Intergenic
936702879 2:115034925-115034947 TTTTAGCAAGATAACTCTGTAGG - Intronic
937478930 2:122239552-122239574 AAGTAGAAAGATCACTTTGGTGG + Intergenic
937614217 2:123901414-123901436 TTTTTGAATGATAACTTTGCTGG + Intergenic
937662014 2:124441614-124441636 TTTTATAAATATCATTTTGATGG + Intronic
937703811 2:124894873-124894895 TTATATAAAAATCACTTTGTTGG - Intronic
937803206 2:126104679-126104701 TTTTTGAAAGATTATTTTGCAGG + Intergenic
938571061 2:132562253-132562275 TTTTAAGAAAACCACTTTGGTGG - Intronic
939221967 2:139313860-139313882 TTTTGGAAAGAACACTCTTGTGG - Intergenic
939792975 2:146602947-146602969 TTTTAGAAAGCTAACTCTGAAGG + Intergenic
939894911 2:147779837-147779859 TTTCAGAAAGAGCAATCTGGTGG - Intergenic
939907089 2:147930421-147930443 TTTTTGAAAGATTACTTTTTAGG + Exonic
940212602 2:151271036-151271058 TTTTAGAAAGAGAACTCTGGTGG + Intronic
940980308 2:159994127-159994149 TTTTTGAAAGATCACTTCCTAGG - Intronic
941492761 2:166163079-166163101 ATTTAGAAAGGTCTCTCTGGGGG - Intergenic
941735560 2:168971612-168971634 TTTTGAAAAGCTCACTTTGTTGG - Intronic
942157399 2:173144795-173144817 TTGTAGAAAAATCAAATTGGAGG + Intronic
942263828 2:174200254-174200276 TTTGAGAACCATTACTTTGGAGG + Intronic
942356874 2:175125227-175125249 TTTTAGAAGCATCATTTTGATGG - Intronic
942423284 2:175831008-175831030 TTTTTGAAAGATATCTTTGCTGG - Intergenic
942587237 2:177494773-177494795 TTTCAAAAGGATCACTTTGGTGG - Intronic
942618656 2:177823627-177823649 TTTTTGGAAGATAACTTTGATGG - Intronic
943216943 2:185049494-185049516 TTTTGAAAAGATCAATTTGTGGG + Intergenic
943918835 2:193675944-193675966 TTATAGATAAATCAGTTTGGGGG - Intergenic
943947114 2:194081110-194081132 TTTTTGAATGATCATTTAGGTGG - Intergenic
944469856 2:200041476-200041498 TTTTAGACAAATCACTGTGGTGG - Intergenic
945363776 2:208926167-208926189 TTTTAGTAAAATCACTTTGTGGG - Intergenic
945616177 2:212070400-212070422 CTTTATAAAGAACAATTTGGAGG + Intronic
945696071 2:213106221-213106243 TTTTAAAAAAATCTCTTTTGTGG + Intronic
945728139 2:213498975-213498997 TTTTAGAAAGACTACTATGATGG - Intronic
946037787 2:216757542-216757564 GTTGAGAAAGATGACTGTGGTGG + Intergenic
946728242 2:222683370-222683392 TTTTAAAGAGAACACTCTGGTGG - Intronic
946781455 2:223196034-223196056 TTTTTAAAAACTCACTTTGGGGG + Intronic
947003497 2:225485461-225485483 TTTTAGAAAGGTTACTTGAGAGG + Intronic
947120868 2:226813387-226813409 TGTTAGATAGATCACTCTTGTGG + Intergenic
947315915 2:228858045-228858067 TTTTTGAAAGGTCACTCTTGTGG + Intronic
948162752 2:235838340-235838362 TTTTAGCAAAATCACTTTGGAGG - Intronic
948433236 2:237934109-237934131 TTTTAAAAAGATTACTCTGAGGG - Intergenic
1168814865 20:729299-729321 TTTTAAAAAGGTCATTTTGGAGG - Intergenic
1169458494 20:5774256-5774278 TTTTAGAAAGAACTCATTGTGGG + Intronic
1169540904 20:6598617-6598639 TTTTCAAAAGATTTCTTTGGGGG + Intergenic
1169602825 20:7281349-7281371 TTTTAGAAAGATAATGTTGGTGG - Intergenic
1169755939 20:9043349-9043371 TTTTCCAAAGATGACTTTGAGGG + Intergenic
1169869410 20:10235318-10235340 TTTTAGAAAAACCACATTTGTGG + Intronic
1169901295 20:10554785-10554807 TTTTAAAAATATCAGTTTGTAGG + Intronic
1170083203 20:12499593-12499615 TTTTCCAAATATCACTTTAGGGG + Intergenic
1170387753 20:15838507-15838529 TATTGGAAAGATAGCTTTGGGGG + Intronic
1170985221 20:21251662-21251684 TTTCAGAAAGAACACTATAGAGG - Intergenic
1171944230 20:31361750-31361772 TTTTAGTAAGATGAATTTGGGGG + Intergenic
1172013005 20:31857284-31857306 ATTTAGAAAGATCCCCCTGGAGG - Intronic
1172875204 20:38160011-38160033 TGTTAGCAAGAGAACTTTGGGGG + Intronic
1173050912 20:39560886-39560908 GTTTAGAAAGATGATTCTGGTGG + Intergenic
1173065235 20:39704241-39704263 TTTTAGAAAGATAATTTGAGAGG + Intergenic
1173434338 20:43019160-43019182 TTGTAGAAAGATCATTGTGATGG + Intronic
1173874108 20:46358946-46358968 GTTTTAAAAGGTCACTTTGGTGG - Intronic
1174163851 20:48570824-48570846 TGTAATAAAGATCACTTGGGGGG - Intergenic
1174464555 20:50707234-50707256 TTTTAGAAGGATCACTGTGGAGG + Intergenic
1175240155 20:57541254-57541276 TTTTTGAAAGATGAATTTAGAGG + Intergenic
1175336299 20:58198518-58198540 TTTTGGAAAGATCACCCTGGTGG + Intergenic
1175868849 20:62197693-62197715 TTTTTAAAAAATCACTTTGCTGG + Intronic
1177073636 21:16544180-16544202 AATTAGAAATATCACTTTTGGGG + Intergenic
1177666171 21:24162521-24162543 GTTTAGATAGGTCACTCTGGTGG - Intergenic
1177763482 21:25429993-25430015 TTTTAGAAATATCACTTTGGAGG - Intergenic
1177768082 21:25481637-25481659 TTTTTGAAAGATAGCTTTGCTGG - Intergenic
1177881236 21:26697244-26697266 TTTTAGAAACATTAATTTGGTGG - Intergenic
1178043168 21:28663777-28663799 ATTTAAAATGAACACTTTGGAGG + Intergenic
1178679589 21:34661678-34661700 TTTAAGAAGGATAACTTTGCTGG - Intergenic
1179530780 21:42017816-42017838 TTTTATAAAGCACAATTTGGGGG - Intergenic
1179606266 21:42517495-42517517 TTTTTGGAAGCTCACTTTCGAGG + Intronic
1181841027 22:25661100-25661122 TTTTTGAAAAATCTCTTTGCAGG + Intronic
1181844324 22:25694449-25694471 GTTGAGAAAAATCACTTAGGAGG - Intronic
1182200149 22:28560347-28560369 TTTTGGAAAGGTCATTCTGGTGG - Intronic
1182980039 22:34661127-34661149 TTTTAGAAATATATCTATGGTGG + Intergenic
1182995615 22:34809286-34809308 TTTTAGAAATATCACCCCGGTGG - Intergenic
1183593657 22:38796592-38796614 TTGTGGAAAGATCACTCTGGTGG + Intergenic
1183789227 22:40051546-40051568 TTTCAGGAAGATCAGTGTGGGGG - Intronic
949182212 3:1145925-1145947 TTTTAGGAAGAAAATTTTGGTGG + Intronic
949449693 3:4171991-4172013 TTTTAGAAAGATCACATTGAAGG + Intronic
949980050 3:9496775-9496797 TTTTAGAAAGAGCACTCTGGTGG - Intergenic
949985609 3:9538237-9538259 GTTTAGAAAGATGACTTGGGAGG - Intronic
950855957 3:16105444-16105466 CTTTAAAAAGGTCACATTGGAGG - Intergenic
951053817 3:18124473-18124495 TTTAAGAAAGGTCAGTGTGGAGG + Intronic
951159439 3:19399245-19399267 TTTCAGAAGGATCTCTTTGCAGG + Intronic
951241651 3:20293548-20293570 TTTTTGAATGATGACTTTGTTGG + Intergenic
951568863 3:24041034-24041056 TTTTAGAAAGATCACCAGGATGG - Intergenic
952046353 3:29326133-29326155 TTGTAGAAAGATAAATTTGGTGG - Intronic
952699837 3:36315494-36315516 TTTATGAAAGATAACTTTGCTGG + Intergenic
952725865 3:36583352-36583374 TTGTAGAGATACCACTTTGGTGG - Intergenic
953112083 3:39952772-39952794 TTTTTGAAAGATAATTTTGCTGG + Intronic
954500036 3:51004218-51004240 TTTTGGATAAATCACTCTGGGGG + Intronic
955072786 3:55585629-55585651 TGTTAGAGAGAGCTCTTTGGGGG + Intronic
955930775 3:64054644-64054666 TTTTAGAAAGATCTTTCTGGTGG - Intergenic
955954831 3:64278069-64278091 TTTTAGGCACATTACTTTGGAGG + Intronic
956202574 3:66721568-66721590 TTTTAAAAAAATAATTTTGGGGG - Intergenic
956309937 3:67867717-67867739 TTTAATAAAGACCACTATGGTGG - Intergenic
956324623 3:68037722-68037744 TTTTAGAGAGATCACTCCAGAGG + Intronic
956432441 3:69200675-69200697 TTTTAGAAAGGTCTCTTTTCTGG - Intronic
956491575 3:69777942-69777964 TTACTGAAAGATCACTCTGGCGG + Intronic
956496468 3:69831791-69831813 CTTTAGAAAGATTAATCTGGGGG + Intronic
956616083 3:71174221-71174243 TTGTAGAAAGATTACTGTGGAGG + Intronic
957181006 3:76877441-76877463 TTTTAGAACGATGAGTTTGGGGG + Intronic
958654788 3:96986680-96986702 CTTTATAAAGCTTACTTTGGAGG - Intronic
958900991 3:99886652-99886674 TTTTAAAAATATCAGTTAGGTGG + Intronic
958929502 3:100193808-100193830 TTTTAAAAAAATCAATTTTGGGG - Intronic
959134361 3:102398534-102398556 TTTTAGGAAGATGTCTCTGGAGG - Intronic
959143401 3:102513988-102514010 TTGTAGAAAGCTCATTTTGGAGG - Intergenic
959243479 3:103830703-103830725 TTTTAGAATGATCACTGTGTTGG - Intergenic
959427254 3:106206225-106206247 TTTTAGACAGGTTCCTTTGGGGG - Intergenic
959615486 3:108342593-108342615 TTTTAGAAAGATCACACCAGTGG - Intronic
960132049 3:114067577-114067599 TATTAGTGAGATCACTTTGTGGG + Intronic
960423567 3:117478542-117478564 TTTTAGAAACATAACTCTGATGG - Intergenic
960556509 3:119035787-119035809 ATTTAGAAGGCTCAGTTTGGAGG - Intronic
961207978 3:125102496-125102518 TTTTAGAAAGATCATTCAGTGGG + Intronic
961319848 3:126064875-126064897 TTTCAGAAAGATTAACTTGGAGG + Intronic
962447599 3:135481110-135481132 ATTTAGACACATCATTTTGGAGG + Intergenic
962916710 3:139911142-139911164 TTTTAGAAACATCAATCTGCAGG + Intergenic
962943381 3:140145819-140145841 TGTTGGAAAGATCACTCTGCTGG - Intronic
962996351 3:140632802-140632824 CTTGAGAAAGGTCACTTTGGTGG - Intergenic
963184858 3:142403029-142403051 TTTCATAAAGATTAATTTGGTGG - Intronic
963428370 3:145162423-145162445 CTTTAGAAAGATAAAATTGGAGG + Intergenic
963733757 3:148995793-148995815 TTTTAGAAAGCTCTTTATGGTGG - Intronic
963965310 3:151362228-151362250 TATTAAAAGGATCACTTTAGTGG - Intronic
963970667 3:151426138-151426160 TTTTGGAATCATCACTGTGGTGG - Intronic
964541968 3:157789665-157789687 TTTTAGAAAGATGACCTTGGCGG - Intergenic
965666918 3:171105069-171105091 TTTTATAAAAATTAATTTGGGGG - Intronic
965866146 3:173206198-173206220 ATTTAGAAAGATGACATAGGAGG + Intergenic
966124035 3:176554646-176554668 TTTTTGACAGATCACTTACGGGG + Intergenic
966566256 3:181384806-181384828 TTTTAGAAAGATCACTTAAGCGG - Intergenic
966605946 3:181821881-181821903 TTTTAGAAAGATCTCTCTGCCGG + Intergenic
966697189 3:182802310-182802332 GTTTAATAAGATCACTCTGGTGG - Intronic
967591108 3:191274818-191274840 TTTTAGAAAGATTACTTTTTTGG - Intronic
969066752 4:4489152-4489174 TAGTTGAAAGATGACTTTGGAGG - Intronic
969069494 4:4523765-4523787 TTTGAGAAAGATCATTCTGCTGG - Intronic
969652370 4:8475310-8475332 TTTTAGAAGGATCACTTGAGTGG - Intronic
970622537 4:17838832-17838854 TATTGGAAAGATTAATTTGGTGG + Intronic
971071434 4:23097204-23097226 TTTAAGAATCATGACTTTGGAGG - Intergenic
971324307 4:25631623-25631645 CTTTAGAAGCATCATTTTGGCGG + Intergenic
971391848 4:26193421-26193443 TTTTACAAAGTTGACTTTGGTGG + Intronic
971798886 4:31262523-31262545 TTTTAGAAAGACCACTTTTGGGG + Intergenic
972294426 4:37723057-37723079 TTTTAATCAGATCACTCTGGTGG - Intergenic
972768323 4:42172220-42172242 TTTAAAAAGGATCACTCTGGTGG - Intergenic
973096660 4:46210463-46210485 ATTTAGAAAGACCACTCTGCTGG + Intergenic
973793201 4:54396974-54396996 ATCGAGAAAGATCACTCTGGTGG + Intergenic
973949083 4:55992582-55992604 TTTTAGGAAGCTAACTTTGGTGG + Intronic
974004966 4:56546611-56546633 TTTTAGAAAACACACTTTTGAGG - Intronic
974122128 4:57651806-57651828 TTTTAGAATGGTAACCTTGGGGG + Intergenic
974889879 4:67868767-67868789 TTTTAGAAAGGTTAATCTGGTGG + Intronic
974918814 4:68210879-68210901 TTTTAAAAAAATCACTTTCTTGG - Intergenic
975415981 4:74105010-74105032 TTTTAGCAAAATAACTTTTGTGG + Intergenic
976056644 4:81077081-81077103 GTTTTGAATGATCACTCTGGTGG - Intergenic
976774105 4:88688355-88688377 TTTTAGAAAGATTACTTTGGGGG + Intronic
976839552 4:89415361-89415383 TTTTAGAAAGATTACTCTAGTGG + Intergenic
977074085 4:92431992-92432014 TTGTAGAGATACCACTTTGGTGG + Intronic
977123716 4:93137815-93137837 TTTTGGAAACATCACTCTTGAGG - Intronic
977135482 4:93298514-93298536 TTTTAGCACAATCACATTGGTGG + Intronic
977230754 4:94449691-94449713 TTTTCAAAAGATGGCTTTGGGGG - Intergenic
977282108 4:95053254-95053276 TTTTAAAAAGCTCCCTTTGCAGG + Intronic
977326652 4:95582323-95582345 TTTCTGAAAGATAACTTTGTTGG + Intergenic
977409500 4:96643751-96643773 TTTGTGAAATATCACTTTGTTGG + Intergenic
977627428 4:99202752-99202774 TGTTAGTAAGGTCAATTTGGGGG + Exonic
977653993 4:99501058-99501080 TTTTAACATGATCACCTTGGGGG + Intergenic
978037529 4:104014075-104014097 TTTTAGGAAGATAACTCTGGTGG + Intergenic
978493862 4:109338301-109338323 TTTTATAAACATCAATTAGGTGG + Intergenic
978779075 4:112531058-112531080 TGTTAGAAAAATCATTCTGGTGG + Intergenic
978992213 4:115098356-115098378 TTTTAGAAAGTTATCTTTTGAGG + Intronic
979311628 4:119210713-119210735 CTTTAGAAAGATTAATGTGGAGG + Intronic
979551526 4:121996548-121996570 TTTTAGAAAGAAACCCTTGGTGG - Intergenic
979784125 4:124693852-124693874 TTTTAGAAAGTTCAGTTTCTAGG - Intronic
979869246 4:125796589-125796611 TTTTAGTAAGATCAGATTGTAGG - Intergenic
980066842 4:128198736-128198758 TTTTAGGAAGATAACTTTGGTGG + Intronic
980534916 4:134105850-134105872 TTTTGAAAAGTTAACTTTGGAGG + Intergenic
980712853 4:136592232-136592254 TTGTAGAAATACCACCTTGGAGG - Intergenic
980907073 4:138958658-138958680 CTTTAGGAAGATCAGTTTGAGGG + Intergenic
981363026 4:143869636-143869658 TATTAGAAATACCACTTTGTAGG + Intergenic
981373753 4:143990431-143990453 TCTTAGAAATACCACTTTGTAGG + Intergenic
981563250 4:146070077-146070099 TTTTAATACTATCACTTTGGGGG - Intergenic
981987200 4:150872182-150872204 TTTTAAAAAGAAAATTTTGGGGG - Intronic
982030990 4:151300722-151300744 TTTTATAAAAATTGCTTTGGTGG + Intronic
982149866 4:152441751-152441773 TTTTAAAAAGCTCTCTTTGGAGG + Intronic
982170633 4:152657873-152657895 TTTTTGAAGGATAACTTTGCTGG - Intronic
982672092 4:158333259-158333281 TTTAAAGAAGATCACATTGGTGG - Intronic
982743180 4:159079218-159079240 TCTAAAAAACATCACTTTGGAGG - Intergenic
983032147 4:162816021-162816043 TTTTAAAAAGATTACTTTGATGG + Intergenic
983593886 4:169443943-169443965 TTTTTGAAGGATAGCTTTGGTGG - Intronic
983839859 4:172443956-172443978 TTTTAGATAAATCACCTTGGTGG + Intronic
983870556 4:172820551-172820573 GCTTAGAAGGATAACTTTGGGGG + Intronic
983910949 4:173238240-173238262 TTTTAGACAGATCATTTTGTAGG + Intronic
984104762 4:175531587-175531609 TTATAGAAAGGTCACTCTTGTGG + Intergenic
984199838 4:176704687-176704709 TTATAGAAAGAACAGCTTGGTGG - Intronic
984226914 4:177046135-177046157 TTTTAGAAAGATCATTCTAGAGG + Intergenic
984556847 4:181224800-181224822 TTTGAGAAAGATCATTTGGAGGG - Intergenic
984587381 4:181579348-181579370 TTTTTAAAAGATCGCTCTGGTGG - Intergenic
984671765 4:182497513-182497535 TTTTACACATATCACTTTAGTGG + Intronic
984833813 4:184000459-184000481 TTTCAGAAAGATGACTGTGGTGG - Intronic
984960650 4:185094166-185094188 GTTTAGAAACATCTCCTTGGGGG - Intergenic
986250342 5:6051235-6051257 TTTTTGAAGGATCATTTTGCTGG + Intergenic
986981812 5:13456865-13456887 TTTTAGAGAGATAACTCTGATGG - Intergenic
987173383 5:15282094-15282116 TTTTGGAAAGATAATTCTGGTGG + Intergenic
987285956 5:16456786-16456808 TTTTAGAAAGAATGTTTTGGTGG + Intronic
987796999 5:22640867-22640889 TTTTCCAAAGATGATTTTGGTGG - Intronic
987825111 5:23021023-23021045 TTTTGGATAGATGAATTTGGGGG - Intergenic
988227802 5:28435301-28435323 TTTTACAAAGATTGCTTTGATGG + Intergenic
988315422 5:29620475-29620497 TTTTATATAGAGAACTTTGGTGG + Intergenic
988382645 5:30517808-30517830 CTTTATAAAGATCAACTTGGTGG + Intergenic
988458892 5:31414222-31414244 TTTTAGAAAGATTGTTTTGGCGG + Intronic
988526037 5:31988099-31988121 GTTTAGAAAGGTCCCTCTGGTGG - Intronic
988868375 5:35360617-35360639 TGTTTGATAGTTCACTTTGGAGG - Intergenic
988937784 5:36106413-36106435 GTTTAGAAAGATGAATTTGATGG - Intronic
989005294 5:36804186-36804208 TTTTTGAAAGATTATTTTGCTGG - Intergenic
989082763 5:37641892-37641914 TTTTAGAAAGGTCAATTCTGTGG + Intronic
989424035 5:41274977-41274999 TTTTATAAAAATGACTTTGGTGG - Intergenic
989551869 5:42745030-42745052 TTTTAGAAAGAAACTTTTGGTGG - Intergenic
990359426 5:55003457-55003479 TTTTAGAAATAACTTTTTGGGGG - Intronic
990396292 5:55383416-55383438 TTTTTGAAAGGTAACTTTGCTGG + Intronic
990528830 5:56654129-56654151 TTGTAGAAAGATCACTCTCATGG - Intergenic
990528917 5:56654826-56654848 TTGTAGAAGGATCACTTTCATGG - Intergenic
990641449 5:57789666-57789688 TTTTAGAAAGAAAAAATTGGGGG - Intergenic
991244794 5:64499009-64499031 TTCCAGAAAGATTATTTTGGGGG + Intergenic
991301959 5:65137259-65137281 TTTTAGAAAGGTAACTTTTATGG + Intergenic
992411829 5:76512754-76512776 TTTTAGAAATGTTACTTTTGGGG + Intronic
993059849 5:83026056-83026078 TTTTAGAACGATCATTCTGGGGG + Intergenic
993189303 5:84660993-84661015 TTTTATTAAGATCACTCTTGTGG - Intergenic
993300667 5:86205527-86205549 TTTTAGAAACAGCACTTTCCTGG + Intergenic
993535757 5:89084233-89084255 GTTTAGATATCTCACTTTGGAGG - Intergenic
993611560 5:90060629-90060651 GTTTTGAAAGATCACTCTGGTGG - Intergenic
993809637 5:92459337-92459359 TTTCATAAAGGTCACTCTGGGGG + Intergenic
993867262 5:93210450-93210472 CTTTAATAAAATCACTTTGGGGG - Intergenic
994056033 5:95416782-95416804 ATGTCGAAATATCACTTTGGGGG + Intronic
994196948 5:96932349-96932371 AATTAGAAAGATCACTTAGCAGG + Intronic
994548498 5:101202497-101202519 TTTTAGCAGACTCACTTTGGTGG + Intergenic
995226429 5:109706330-109706352 CTTTTGAAAAATCACTTTGAAGG - Intronic
995401218 5:111744141-111744163 TTTTGGAATGAGCACTTCGGGGG - Intronic
995837692 5:116414691-116414713 GTTCACAAAGATCCCTTTGGTGG + Intergenic
996029520 5:118689440-118689462 TTTTGGAAAGATCACTCTGCTGG + Intergenic
996066830 5:119089112-119089134 TATTAGAAGGATAACTTTGCTGG + Intronic
996106656 5:119512605-119512627 TTTTAGAAAGCTCATTTTGCTGG - Intronic
996178291 5:120387212-120387234 TCTTAATAACATCACTTTGGGGG + Intergenic
996198666 5:120642183-120642205 ATTTAAAAAGATCTTTTTGGTGG - Intronic
996264575 5:121522547-121522569 TTCCAGAATGATCACTTGGGTGG + Intergenic
996279216 5:121707368-121707390 TTTTAAAATGATGACTTTGCTGG - Intergenic
996907790 5:128621354-128621376 TTTTAGAAAGAACACCTGGTTGG - Intronic
998078098 5:139252753-139252775 TTTTAAAAAGATCACTTGGCCGG - Intronic
998309619 5:141114551-141114573 TTTTTGAAAGATACTTTTGGTGG - Intronic
998679161 5:144446251-144446273 TTTTAAAAAGATCACCATGTAGG - Intronic
998706179 5:144764093-144764115 TTTCAGAGAGATTGCTTTGGAGG - Intergenic
999266142 5:150268165-150268187 TTTTAAAAAGAGCTCCTTGGTGG - Intronic
999336064 5:150717982-150718004 TTTTAGAAGTATCACCCTGGTGG + Intronic
999614414 5:153406850-153406872 TTTGAGGAAGATTACTCTGGTGG + Intergenic
999622175 5:153484852-153484874 TTTTAAAAATTTCACTCTGGTGG + Intergenic
999676769 5:154012029-154012051 TTTTAGAAAGATCACTTTGGTGG + Intronic
999803688 5:155062025-155062047 GTTTAGAAAGATAATTCTGGGGG - Intergenic
1001122112 5:168989337-168989359 TTGTAGAAGAATCACTTGGGTGG - Intronic
1002179777 5:177425208-177425230 TTTTAAAAATATCACTCTGGTGG - Intronic
1003127217 6:3364865-3364887 GTTTGGAAAGCTCACTCTGGCGG + Intronic
1003340378 6:5214516-5214538 TTTGAAAAAGATCACTGTGGTGG + Intronic
1003428551 6:6017426-6017448 TTTTGGAAAGAAGACTGTGGAGG + Intergenic
1003477730 6:6499616-6499638 TTTTAAAAACAGCACTGTGGAGG + Intergenic
1003807659 6:9743915-9743937 TATTAGATAGATCACTGAGGTGG - Intronic
1004032030 6:11879996-11880018 TTTTAGAAAAATCACCATAGTGG + Intergenic
1004596547 6:17104680-17104702 TTTGAGAAAGATCCTTCTGGAGG - Intronic
1005049233 6:21667788-21667810 TTGTAGAAAAAGCATTTTGGGGG + Intergenic
1005822234 6:29607438-29607460 TTTTAGCAAGATCACCCTGGTGG - Intronic
1006252372 6:32798549-32798571 TTTTAGAAAGACTACTCTGATGG + Intergenic
1006267263 6:32935789-32935811 TTTGAGAAAGATCATTTTCTTGG - Intronic
1006453827 6:34120892-34120914 TTTAAGAAAGAAAACTTTGCAGG - Intronic
1007151072 6:39691755-39691777 TTTAAAACATATCACTTTGGCGG + Intronic
1007192195 6:40028939-40028961 AGTTAGAAAAAGCACTTTGGGGG + Intergenic
1007423125 6:41731534-41731556 TTGTAGAAGGTTCGCTTTGGAGG + Intronic
1007912210 6:45527359-45527381 TTTTTCAAAGCTCACTCTGGCGG + Intronic
1008263622 6:49397022-49397044 TTTGAAATGGATCACTTTGGTGG + Intergenic
1008331313 6:50247769-50247791 TTATAGAAAGATTACAATGGAGG + Intergenic
1008600776 6:53091858-53091880 ATTTTAAAAGATCACTCTGGTGG - Intronic
1008791306 6:55238422-55238444 TTTTTCAAAGATTACTTAGGCGG - Intronic
1010255241 6:73749895-73749917 TTTTAGGAAGATCACTTTGGTGG + Intronic
1011168099 6:84473355-84473377 TTTTGGAAAGATATCTTTGAGGG - Intergenic
1011183983 6:84653749-84653771 TTTTAGCACTATCACCTTGGGGG + Intergenic
1011560357 6:88607687-88607709 GTTTTGAAAGATCACTCTGGTGG + Intergenic
1011793586 6:90927455-90927477 TTTTAGAAGGATCACTCTGGTGG + Intergenic
1012213130 6:96548887-96548909 TTTTAGAAATATAACTTCTGTGG + Intronic
1012265832 6:97141328-97141350 CATTATAAAGATCACTTAGGAGG - Intergenic
1012267781 6:97167487-97167509 TTTTAGAAAGATGATTCTGGTGG - Intronic
1012479677 6:99652630-99652652 TTTTAGAAAGATCTCTCTGATGG - Intergenic
1012745807 6:103087240-103087262 TTTTAAAAAGTTTATTTTGGGGG - Intergenic
1012985147 6:105867654-105867676 GTTTAGAAAAATCACTTTCAAGG + Intergenic
1012990414 6:105920320-105920342 TCTTAGAAAGAACACCTTGTTGG + Intergenic
1013150704 6:107443240-107443262 TTTTTGAAAGCTGACTTTGGCGG - Intronic
1013332540 6:109119258-109119280 TTTTAGGTAGATCACTCTAGGGG + Intronic
1013350069 6:109297574-109297596 TTTTAAAAAGATTATCTTGGAGG - Intergenic
1013784689 6:113766238-113766260 TTTTAGAGGGATTTCTTTGGTGG + Intergenic
1013829978 6:114259601-114259623 TTATAGAGATAACACTTTGGTGG + Intronic
1014151319 6:118059330-118059352 TTTAAGAAAGATTGATTTGGTGG + Intronic
1014378467 6:120708004-120708026 TAGTAGAATGATGACTTTGGTGG + Intergenic
1014399890 6:120975329-120975351 ATTTAGAAATAGCACTCTGGTGG - Intergenic
1014993727 6:128115009-128115031 TTTTAGGAATATCACCCTGGGGG - Intronic
1015199503 6:130563484-130563506 TTTTAGAAAGATTTCTCTGTTGG + Intergenic
1015466463 6:133553657-133553679 TTTTTGAAATTTAACTTTGGAGG - Intergenic
1015525653 6:134173787-134173809 TTTTAAAATAACCACTTTGGAGG + Intronic
1015633303 6:135252416-135252438 TTTGAGAATGCTCACTTTGGTGG - Intergenic
1015760772 6:136658038-136658060 CTTTAGAAAGATCCCTGGGGAGG + Intronic
1016005123 6:139081518-139081540 TTTTAAAGAGTTCATTTTGGAGG + Intergenic
1016142402 6:140628416-140628438 TTTTATCATGATTACTTTGGAGG + Intergenic
1016463512 6:144303048-144303070 TTTCAGAAAGATAACTTGGCTGG + Intronic
1016488113 6:144565749-144565771 TTTTGGAAAGAGCAATTTGGAGG + Intronic
1017030206 6:150214384-150214406 TTTTTGAAAGATTACTTTTATGG + Intronic
1017358542 6:153539387-153539409 TTTTAGAAAGGTCAATTTCATGG - Intergenic
1018167798 6:161115964-161115986 TTTTAGAAAGATCACTCTAGAGG + Intronic
1018263219 6:161991139-161991161 TTTTTGAAAGATAGCTTTGTTGG - Intronic
1019003346 6:168775050-168775072 GTTTTGAAAGATCATTTTGTTGG - Intergenic
1019089633 6:169517711-169517733 TTTTTGAAGGATCATTTTGCTGG + Intronic
1020544874 7:9514670-9514692 ATTTAGTAAGAACACTTAGGAGG + Intergenic
1021848250 7:24783612-24783634 TTTTAGAAAAATCACTCTGGTGG + Intergenic
1021892369 7:25198339-25198361 TTTTAGAAAAATCTCCCTGGTGG - Intergenic
1022085125 7:27059676-27059698 TTTTAGAAATTTCACTCTGCAGG + Intergenic
1022223462 7:28339381-28339403 TTTTAGAGATACCAGTTTGGTGG + Intronic
1022783891 7:33615942-33615964 TTTTTGAAGGATCATTTTGCAGG - Intergenic
1022870200 7:34470184-34470206 TTTATGAAAGATAACTTTGCTGG + Intergenic
1023351420 7:39323697-39323719 TTTTACAAAGATAATTCTGGTGG + Intronic
1023517581 7:41017468-41017490 TTTTAGAAAGATTTCACTGGAGG + Intergenic
1023573466 7:41597286-41597308 TTTTTGAAAGATAATTTTGTTGG - Intergenic
1023623524 7:42095410-42095432 TTTTGGAAGTATTACTTTGGTGG + Intronic
1023710176 7:42984083-42984105 TTTCAGAAGAATCATTTTGGTGG + Intergenic
1024092401 7:45955214-45955236 TTTTAGAAAGAACTCTTTGTAGG + Intergenic
1024104939 7:46073747-46073769 TTTGAGAAAAATCGCTTAGGTGG + Intergenic
1024352167 7:48377330-48377352 TTTTAGAGATAACACTTTGATGG + Intronic
1026199046 7:68198208-68198230 TTTTAGGAAGATCACTTGCATGG - Intergenic
1026216900 7:68357702-68357724 TTTTAGAAAGATCATTTTGTTGG + Intergenic
1026483690 7:70799860-70799882 TTTTAGGGAGATAAATTTGGTGG + Intergenic
1026514367 7:71055490-71055512 TCTTAGAAAGAATATTTTGGAGG - Intergenic
1026994032 7:74604400-74604422 TCTCAGAAAGACCACTTTAGGGG + Intergenic
1027406244 7:77864343-77864365 TTTAAGATAAATCACTCTGGTGG - Intronic
1027503495 7:78984955-78984977 TTTAAGAAAAATCCATTTGGAGG - Intronic
1027743186 7:82038774-82038796 TTTTAGAAATATCACTTTAGAGG + Intronic
1027903071 7:84143173-84143195 TTGTAGAAAGTTTACTCTGGGGG - Intronic
1027993371 7:85393548-85393570 CTTTTGAATGATCATTTTGGTGG + Intergenic
1028184279 7:87763503-87763525 TTTTAGGAAGATAATTTTGCTGG + Intronic
1028317814 7:89425698-89425720 TTTTAGAAAGATCATATTGATGG + Intergenic
1028357467 7:89926541-89926563 TTTTAGAAAGATCACGGCTGGGG - Intergenic
1029571743 7:101374336-101374358 CTTTACATAGATCACTCTGGAGG - Intronic
1029882919 7:103835879-103835901 TTTTAGAAAGATCACTCTGGTGG - Intronic
1029883066 7:103837219-103837241 TTTTAGAGAAATCATTTTGATGG - Intronic
1030564353 7:111134523-111134545 TTTTTGAAAGCTCAGTTTTGAGG + Intronic
1030584246 7:111397523-111397545 TTGGAGAAAGAACAGTTTGGTGG - Intronic
1030700779 7:112637959-112637981 TTTTTAAAAGATAACTTTTGGGG - Intergenic
1030789725 7:113708880-113708902 TTTGAGAAAGTCCACTTTTGTGG - Intergenic
1030895168 7:115050766-115050788 TTTTAGAAAGATCATTCTAGTGG + Intergenic
1031063978 7:117084239-117084261 TGTTAGAAAGATGACTCAGGTGG + Intronic
1031169559 7:118275401-118275423 TTTTAGAAAGCCCTTTTTGGGGG + Intergenic
1031192283 7:118568446-118568468 TTATAAAAAGATCACTTTAGGGG + Intergenic
1031319354 7:120303510-120303532 TTTTCTAAATATTACTTTGGAGG - Intronic
1031773542 7:125877332-125877354 TTTTAGAAAGATTTATTGGGTGG + Intergenic
1031848784 7:126838230-126838252 TTTTAGAAATAGCATCTTGGGGG + Intronic
1032345574 7:131113523-131113545 TTTTAGAAAGATCTCTCAGCTGG + Intronic
1032354234 7:131195007-131195029 TTTTTGCGAGATAACTTTGGAGG - Intronic
1032436420 7:131904718-131904740 TTTTAGACAGATCACCCTGTTGG + Intergenic
1032448013 7:132001267-132001289 TTTTAGAAAGATAATTCTGGTGG + Intergenic
1032621055 7:133532788-133532810 TTTTAGAAAATTTACTTTTGAGG + Intronic
1032809746 7:135400314-135400336 TTTTAGAAAGATTAATTTGGTGG + Intronic
1033002079 7:137517063-137517085 TTTTAGAAAGAATACTGTAGAGG - Intronic
1033032128 7:137837520-137837542 TTCTAGAACCATCACATTGGGGG - Intronic
1033258605 7:139822884-139822906 TTCTAGAAATATCACTCAGGAGG - Intronic
1033561626 7:142537459-142537481 TTTTAGAAATTTTATTTTGGAGG - Intergenic
1033643153 7:143281851-143281873 TTTTTTAAAGATGATTTTGGTGG - Intronic
1033773686 7:144582531-144582553 TTTTAGAAAGTTTAATTTGGTGG - Intronic
1033867661 7:145712879-145712901 TTGTAGAGATATCACCTTGGTGG + Intergenic
1034166898 7:149032197-149032219 TTTTATAAAGATCACTCTGGGGG + Intergenic
1034322101 7:150195573-150195595 TTTCAAAAAGATCACTTCAGGGG + Intergenic
1034503431 7:151467175-151467197 TTTTCGAAGGATAATTTTGGAGG - Exonic
1034770645 7:153771640-153771662 TTTCAAAAAGATCACTTCAGGGG - Intergenic
1035005910 7:155660513-155660535 TTTATGAAAGATCATGTTGGTGG + Intronic
1035149437 7:156855915-156855937 TTTTTGAAAGATAATTTTGCTGG - Intronic
1035961147 8:4139686-4139708 TGTTAGAATGATGATTTTGGTGG + Intronic
1035995976 8:4547338-4547360 TTTTAGAAAGTTCACTGCTGTGG - Intronic
1036279453 8:7387317-7387339 TTTTAAGAATAGCACTTTGGAGG + Intergenic
1036342066 8:7924560-7924582 TTTTAAGAATAGCACTTTGGAGG - Intergenic
1036967227 8:13313815-13313837 TTTTATAAAGCTCAGTGTGGAGG + Intronic
1037252379 8:16911645-16911667 CTTTAGGCAGATCACTTTGGTGG - Intergenic
1037282677 8:17260698-17260720 TATTTGAAAGATAACTTTGCTGG + Intronic
1037437665 8:18880399-18880421 TGTTAGAAAGCTCGCCTTGGTGG + Intronic
1038508666 8:28109179-28109201 TTTTTGAAAGATCATTTTGATGG + Intronic
1039310169 8:36309274-36309296 TTGTTGAAAGATTATTTTGGAGG + Intergenic
1039310267 8:36310442-36310464 TTGTTGAAAGATTATTTTGGAGG - Intergenic
1039701067 8:39962389-39962411 TTTTAGGAAGATAAATTTGTAGG - Intronic
1040739064 8:50549513-50549535 TTTTAGAAATATCTCTCTGTGGG - Intronic
1040811255 8:51456140-51456162 TTTTAGAAAAATGTCTCTGGTGG - Intronic
1041334238 8:56761872-56761894 TTTTACAAAGCTCAATCTGGAGG - Intergenic
1041434164 8:57819178-57819200 TTTACGAAAGATAACTTTGATGG - Intergenic
1042026971 8:64434108-64434130 TTTTAGAAATATCACTCTCATGG + Intergenic
1042604057 8:70528491-70528513 TGTTAGAAAGGTCACTCTGGTGG + Intergenic
1042753044 8:72179266-72179288 TTTTATAATGACCACTGTGGTGG + Intergenic
1042828525 8:73002510-73002532 TTTAAGAAAAAACAATTTGGGGG - Intergenic
1043252101 8:78087793-78087815 TTTTAGGAGGATCACTTTGATGG + Intergenic
1043956078 8:86361111-86361133 CTTTAGAAGGATCACTGTGCTGG + Intronic
1044107448 8:88228406-88228428 GTTTATAAAAATCACTTTGATGG - Intronic
1044342258 8:91059998-91060020 TTTTAGAAAGATGATTTTGAGGG + Intergenic
1044468974 8:92542861-92542883 TTTTAGAAATAGTACTTTGAAGG - Intergenic
1044880945 8:96721616-96721638 TTTCAAAAAGTTCACTCTGGAGG - Intronic
1045030178 8:98127679-98127701 TTTTCTAAACATCCCTTTGGAGG - Exonic
1045042327 8:98237497-98237519 TTTTAGAGCGATTACTCTGGTGG - Intronic
1045215849 8:100147591-100147613 TTTTAGAAAGTCCACTCTGGTGG + Intergenic
1045256792 8:100531849-100531871 TTTCAGAAAGATGACTTGGATGG + Intronic
1045427158 8:102078377-102078399 TTTTTAAAAGATCACTGTGGTGG - Intronic
1045456527 8:102385431-102385453 TTTTTGATAGGTCACTTGGGTGG - Intronic
1045918192 8:107498735-107498757 TTTTACAAGGATCTCTTTGGTGG + Intergenic
1046156646 8:110299318-110299340 TTTGACAGAGATAACTTTGGAGG + Intergenic
1046182145 8:110664548-110664570 TTTTAAAAAAATCAATTTGCTGG + Intergenic
1046252300 8:111648176-111648198 GGTTAGACAGATGACTTTGGAGG - Intergenic
1046502147 8:115092465-115092487 TTTTTGAAAGATTATTTTGCAGG + Intergenic
1046583702 8:116124710-116124732 TTTTATAAAAATCACTATGAGGG - Intergenic
1046639432 8:116710529-116710551 TTTTAGAAAGTTAAGTTTGTGGG - Intronic
1046844708 8:118902944-118902966 TTTTAGAAAAATCATTCTAGAGG - Intergenic
1047225918 8:122955342-122955364 TTTTGTAAAGATAACTTGGGAGG - Intronic
1047304547 8:123642345-123642367 TTTTAAAAAGATCACTCTGGCGG + Intergenic
1047558151 8:125955854-125955876 TTTTAGAAAGATGACTATTAAGG + Intergenic
1048193799 8:132315101-132315123 TTTTAGGAAGATCACTTAGCTGG + Intronic
1048288489 8:133161741-133161763 TTTTTGAAAGATCACCATGGTGG + Intergenic
1048533314 8:135270525-135270547 TTTTTGAAAAATCCCTTTGATGG + Intergenic
1049046174 8:140153700-140153722 CTTTAGAAAAATCACTGTGCTGG - Intronic
1050360796 9:4829224-4829246 TTTTAGGAAGATAATTCTGGAGG + Intronic
1050950600 9:11586771-11586793 TTTTTGAAAGATAGCTTTGCTGG - Intergenic
1051359854 9:16272414-16272436 TATTTGGAAGATGACTTTGGGGG + Intronic
1051470802 9:17439702-17439724 TTTTGAAATGATCACATTGGGGG - Intronic
1051798039 9:20897984-20898006 TTTTTGAAGGATCATTTTGTGGG + Intronic
1053240860 9:36493851-36493873 TTTTTGAAAAATCTCTTTGTTGG - Intergenic
1053391459 9:37739390-37739412 TTTGAGAAAGATCACTCTGGAGG + Intronic
1054842482 9:69758690-69758712 TTTTACAATCATCACCTTGGAGG + Intronic
1055567475 9:77583706-77583728 TTTTAGAAACATTAGTTTAGGGG - Intronic
1055704380 9:78981650-78981672 TATTAGAAAGAGCACTTGGATGG - Intergenic
1056101425 9:83303739-83303761 TTTTAGATTGTACACTTTGGTGG + Intronic
1056112634 9:83410823-83410845 TTTTAGAAAGAGAATTTAGGAGG - Intronic
1056240041 9:84636104-84636126 TTTTAAACAGATCTCCTTGGGGG - Intergenic
1057799063 9:98178780-98178802 TCTTGCATAGATCACTTTGGAGG + Intronic
1057855960 9:98600893-98600915 TTTTAGGGAGATCACTCTGAAGG - Intronic
1057887496 9:98841316-98841338 TTTTGGCAAGAACACTTTGTGGG + Intronic
1058113107 9:101053441-101053463 TTTTTGGAAGATAACTCTGGAGG - Intronic
1058117218 9:101098105-101098127 GTTCAGAAATATCACTCTGGAGG + Intronic
1058466834 9:105237336-105237358 CTTTAAAATGATCACTATGGTGG - Intergenic
1058473229 9:105302882-105302904 TTTCAGGCAGATCACTCTGGAGG + Intronic
1058601055 9:106670729-106670751 TTTTAGTAAACTCACTCTGGTGG - Intergenic
1058679800 9:107430934-107430956 GTTCTGCAAGATCACTTTGGAGG + Intergenic
1058827454 9:108787740-108787762 TTTTAGAAAGATGACTCAAGTGG + Intergenic
1059019612 9:110560928-110560950 TTTCAGAAAGATAACTTTGATGG - Intronic
1059041901 9:110823511-110823533 TTGTAGAGGTATCACTTTGGTGG - Intergenic
1059226468 9:112677671-112677693 TTTTTAAAAGATCACTCTGGAGG + Intergenic
1059944183 9:119390850-119390872 TTTTAAAAAGAACAAGTTGGAGG + Intergenic
1060141737 9:121216276-121216298 TTGTAGAATGATCACTCTGATGG - Intronic
1060292236 9:122314688-122314710 TTTATGAAAGATGACTATGGTGG + Intronic
1060404170 9:123364948-123364970 TTTTAGAAGGTCCACTCTGGTGG - Intronic
1060580638 9:124742968-124742990 TTCTAGAAACTTCCCTTTGGGGG + Intronic
1060684290 9:125594221-125594243 TTTGAGAAAAATCACATTGGTGG - Intronic
1060807461 9:126586647-126586669 TTTTAGAAAGACCTCGCTGGAGG + Intergenic
1186335498 X:8582608-8582630 TTTTAGAAGGATCACTCAGGTGG + Intronic
1186592893 X:10950221-10950243 ATTTAGAGAGATCACTGAGGGGG + Intergenic
1186860138 X:13664883-13664905 TTTTAAAAAGTTTACTTTGGCGG + Intronic
1187136644 X:16554012-16554034 TTTTCTAAAGATCACTTGTGTGG - Intergenic
1187335032 X:18374490-18374512 TTGTAGTAAGAACACTTTGTCGG + Intergenic
1187558968 X:20382016-20382038 TTTTAGGAAAATCAGTCTGGAGG - Intergenic
1187828155 X:23353760-23353782 TTTTAGAAAAATAAGTCTGGTGG + Intronic
1188242093 X:27805613-27805635 ATTTGGAAAGATCACTTTACAGG - Intergenic
1188308471 X:28587351-28587373 TTTTTGAAAAATCATTTTTGGGG + Intergenic
1188922557 X:35995398-35995420 TTTTTTAGAGATCACTTTGGTGG + Intergenic
1188970609 X:36611119-36611141 TTTTTTAAATAGCACTTTGGAGG + Intergenic
1189075188 X:37906935-37906957 TTTTAGAAAAATCATTTTGGTGG + Intronic
1189338408 X:40185774-40185796 TTTTAGGAAGCTCACCCTGGGGG - Intergenic
1189397491 X:40635912-40635934 TTTTAGAAAGTTAACTCTTGTGG - Intronic
1189745718 X:44166974-44166996 TTTTAGAAAGAGCACTGTGGTGG - Intronic
1189887569 X:45563888-45563910 TTTTAGATACACCACTTTAGAGG - Intergenic
1190112146 X:47597927-47597949 TTTTTGAAAGATAATTTTGCTGG - Intronic
1190242379 X:48667549-48667571 CATGAGAATGATCACTTTGGTGG - Intergenic
1190578429 X:51866267-51866289 TTTATGAATGATCACTTTGTGGG + Intronic
1190937707 X:55011485-55011507 TTTTAGAAAAATCCCTCTAGTGG + Intronic
1191166888 X:57401144-57401166 TTATAAAAAGACCACTTGGGTGG + Intronic
1191731310 X:64338657-64338679 TCTTTGAAAGATCACTGTGGTGG + Intronic
1192040007 X:67609733-67609755 TTTTAGAAAGATTATATTTGTGG - Intronic
1192218641 X:69181390-69181412 TTTTAGAACCTTCACTCTGGGGG + Intergenic
1192852040 X:74967209-74967231 TTTTAGGAAGATAACTCTGATGG + Intergenic
1192890737 X:75388086-75388108 TTTTTGAAGGATAACTTTGCTGG - Intronic
1192959401 X:76111163-76111185 TTGTAGAGGTATCACTTTGGTGG - Intergenic
1193223445 X:78954171-78954193 TTTTAGAAAGATCAGGCTGCTGG - Intronic
1193729615 X:85086993-85087015 TTTTAAAAAGATCACTCGGCCGG - Intronic
1194653505 X:96543976-96543998 TTTTAGAAACAGTACTTTGTGGG + Intergenic
1194985118 X:100481774-100481796 TGTTAGATATATGACTTTGGAGG - Intergenic
1195541993 X:106072977-106072999 TTTTTGAAAGATCTCTTTCGAGG - Intergenic
1196052976 X:111324983-111325005 TTTTAGAAGAATCAGATTGGAGG + Intronic
1196059517 X:111392222-111392244 TTTTAGAAACATGAGTTTGGTGG + Intronic
1196112224 X:111958952-111958974 TTTTAGAAGAATCATTTTGCAGG - Intronic
1196342766 X:114614955-114614977 TTTTAGAATGATAGTTTTGGAGG + Intronic
1196480754 X:116144760-116144782 TTTTTGAAAGATAATTTTGAAGG + Intergenic
1196615910 X:117767080-117767102 TTTTAGAAATATCATTCTGGTGG + Intergenic
1196637277 X:118017077-118017099 TGCTAGAAAGATCACTTTGGTGG - Intronic
1196766337 X:119248394-119248416 TTTAATAAAGTTCAGTTTGGGGG + Intergenic
1197119909 X:122878875-122878897 ATTTAGTAAGATCACTCTGTTGG + Intergenic
1197786864 X:130207206-130207228 CTGAAGGAAGATCACTTTGGAGG - Intronic
1198654234 X:138896481-138896503 TTTTATGAAGATTAATTTGGCGG - Intronic
1199441943 X:147878367-147878389 TATTTGAAAGATAACTTCGGGGG + Intergenic
1199562368 X:149177731-149177753 TTTTAAAAAGCTAACTTTTGGGG + Intergenic
1200085187 X:153600686-153600708 TTTTAGAAAGCTCGCTCTGGCGG - Intergenic
1200385902 X:155890677-155890699 CTTTAGAAAGATCACTCTGGTGG + Intronic
1200837426 Y:7746544-7746566 TTTTAGAAATAACATTTTAGGGG - Intergenic
1201178061 Y:11321894-11321916 TTTGAGAAAGATCGCTTTCCAGG + Intergenic
1201360261 Y:13139067-13139089 TTTTATAAAGAACACTTTCTGGG - Intergenic
1201428055 Y:13875690-13875712 TTTTAGTAGGATCACTCAGGTGG - Intergenic
1202305696 Y:23468007-23468029 TTTTAGGAAAATAAATTTGGTGG - Intergenic
1202565113 Y:26202582-26202604 TTTTAGGAAAATAAATTTGGTGG + Intergenic