ID: 999677138

View in Genome Browser
Species Human (GRCh38)
Location 5:154015379-154015401
Sequence CCTGTTTTGCTGGAGGTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 3, 3: 91, 4: 331}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
999677138_999677149 30 Left 999677138 5:154015379-154015401 CCCGACACCTCCAGCAAAACAGG 0: 1
1: 0
2: 3
3: 91
4: 331
Right 999677149 5:154015432-154015454 AGACAGTTCACAGGACTCTGTGG 0: 1
1: 0
2: 1
3: 20
4: 199
999677138_999677146 21 Left 999677138 5:154015379-154015401 CCCGACACCTCCAGCAAAACAGG 0: 1
1: 0
2: 3
3: 91
4: 331
Right 999677146 5:154015423-154015445 GACCCACACAGACAGTTCACAGG 0: 1
1: 0
2: 1
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
999677138 Original CRISPR CCTGTTTTGCTGGAGGTGTC GGG (reversed) Intronic
903763189 1:25713570-25713592 ACTATTTTGCTAGAGGTGTTTGG + Intronic
905619251 1:39428035-39428057 CCTGTTCTGCAGGAGATGTCAGG - Exonic
905881689 1:41468178-41468200 ACTGCTTTCCTGCAGGTGTCAGG + Intergenic
906112529 1:43333747-43333769 CCTGCTTTGGTGAAGGAGTCCGG - Intergenic
907892084 1:58646315-58646337 CCTGTCTTTCTGGAGCTCTCTGG - Intergenic
910142123 1:84037800-84037822 CCTGTTCTGGTGGAAGTGACAGG + Intergenic
912121173 1:106473720-106473742 CCAGCTCTGCTGGAGGTGTCAGG - Intergenic
912616095 1:111101803-111101825 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
913151419 1:116047486-116047508 CCTGTTCTGGTGGAGGTGCCAGG - Intronic
917183976 1:172331585-172331607 CTTGTTTCACTGGAGGTGTCTGG - Intronic
918750713 1:188266144-188266166 CCTGTTCCAGTGGAGGTGTCAGG + Intergenic
919115473 1:193275863-193275885 CCTGTTCTGGTGGAGGTGGTGGG + Intergenic
919281552 1:195495936-195495958 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
919646160 1:200096604-200096626 GCTGTTTTGCTGGAGTGGGCTGG - Intronic
920416351 1:205801325-205801347 TCTGTTTTCCTGGAGGTGGGTGG + Intronic
920934459 1:210418219-210418241 CCTTCTTTGCTGGTGGTGGCTGG + Exonic
921788515 1:219262720-219262742 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
922657960 1:227402263-227402285 CCTGTTCTGGTGGAGGTGGAGGG - Intergenic
922927322 1:229360819-229360841 CCTGTTCCGGTGGAGGTGGCGGG + Intergenic
923169206 1:231397625-231397647 CATGTTTTGATGCAGGGGTCAGG - Intronic
923631281 1:235650357-235650379 CCGGGGTTGCTGGAGGGGTCTGG + Intronic
924321362 1:242854537-242854559 CCTGTTTCAGTGGAGGTGGCAGG + Intergenic
1066200354 10:33138042-33138064 CCTGTTATGATGGAGGTGATGGG + Intergenic
1067688089 10:48479754-48479776 CCTGTCTTGCAGGTGGTGCCGGG - Exonic
1068556486 10:58464712-58464734 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1068925007 10:62527128-62527150 CCTGTTTTGGTGGAGTTGGCAGG + Intronic
1070755387 10:78988873-78988895 CCTGTTTGTTTGGAGTTGTCTGG - Intergenic
1072294439 10:93995360-93995382 TGTGTTTTGCTGGTGGTGTGAGG + Intronic
1072885234 10:99266754-99266776 CCTGCTTTGTTAGAGGTGGCAGG - Intergenic
1073700914 10:105925684-105925706 CCTGTGCTGGTGGAGGTGGCAGG - Intergenic
1076666252 10:132094632-132094654 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
1076784720 10:132744095-132744117 CCTGTTTCCCTGGTGGTGTCTGG - Intronic
1077625989 11:3771816-3771838 CCTGTTGCGCTGGAAGTGGCTGG + Exonic
1078449885 11:11432867-11432889 CCAGCTTTGCTGGAGGGCTCGGG + Intronic
1078588044 11:12610957-12610979 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1079464117 11:20712862-20712884 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1079952115 11:26818902-26818924 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1080672492 11:34394461-34394483 CCTGTTCCGGTGGAGGTGGCGGG + Intergenic
1084013874 11:66367579-66367601 CCTGGCTTGCCTGAGGTGTCTGG + Intronic
1086322170 11:85663044-85663066 GTTATTTTGCTGGAGGTGACAGG - Exonic
1087212656 11:95459417-95459439 CATGTTTTTCAGGAGGTGGCAGG - Intergenic
1087619530 11:100525927-100525949 CCTCTTTTGGTGGAGGTAGCAGG - Intergenic
1088179523 11:107092985-107093007 CCTGTTCTGGTGGAGGAGTGGGG - Intergenic
1089401847 11:118168874-118168896 CCTGATTAACTGGAGCTGTCAGG - Intronic
1090643695 11:128750248-128750270 CCAGCTTGGCTGGAGGTGTCTGG - Intronic
1092677803 12:10942106-10942128 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1092934468 12:13347704-13347726 CCTGTACTGCTGAAGGTATCTGG + Intergenic
1093104935 12:15075000-15075022 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1093469129 12:19482293-19482315 CCTGCTCTGCTGGAGGTGGCAGG + Intronic
1093488681 12:19681063-19681085 CCTCTTCTGGTGGAGGTGGCAGG + Intronic
1093991469 12:25593315-25593337 CCTGTTCTGGTGGAGGTGGCAGG - Intronic
1094014343 12:25846650-25846672 CCTGACTTTCTGGAGCTGTCAGG - Intergenic
1095115338 12:38345167-38345189 CCTGTTCCGGTGGAGGTGGCAGG - Intergenic
1096253575 12:50049688-50049710 TCTGGTTGGCTGGAGGTGGCAGG - Intergenic
1096888548 12:54743378-54743400 CCTTTTCTGGTGGAGGTGGCAGG + Intergenic
1099477110 12:83121539-83121561 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1099664097 12:85604324-85604346 TCTGTTTTGTGGGAGGTGGCGGG + Intergenic
1099862936 12:88242296-88242318 CATGTGTTTCTGGAGGTGTGGGG + Intergenic
1100203547 12:92325136-92325158 CCTGTTATGGTGGAGGTGGCAGG + Intergenic
1100918601 12:99456026-99456048 CCTGCTCTGGTGGAGGTATCAGG - Intronic
1101635216 12:106535190-106535212 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1102214992 12:111154594-111154616 CCTGCATTTCTGGATGTGTCTGG + Intronic
1102529671 12:113536907-113536929 TCTGTTTTGATGGATGTTTCTGG - Intergenic
1107361224 13:39619412-39619434 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1107755947 13:43622631-43622653 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1108469737 13:50756099-50756121 CCTGTTCTGGTGGAGGTTGCAGG + Intronic
1109508362 13:63336649-63336671 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1112087048 13:96042128-96042150 CCTGCTCTGCTGGAGGTGGCAGG - Intronic
1112093097 13:96103563-96103585 CCTGTTTTTTTGGAGTTGTGGGG + Intronic
1113240304 13:108329228-108329250 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1113330264 13:109319705-109319727 CCTGTTCTGGTGGAAGTGGCAGG - Intergenic
1115996972 14:39204462-39204484 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1116082901 14:40199124-40199146 CCTGCATTGCTGGAGGTCTAGGG - Intergenic
1116088950 14:40279102-40279124 CCTGTTCTGGTGGATGTGGCAGG + Intergenic
1116346761 14:43803548-43803570 CTTGTTCTGATGGAGGTGACAGG - Intergenic
1117410590 14:55447517-55447539 CCTGTTTTGCTGTGCGTGGCAGG - Intronic
1117995067 14:61470539-61470561 CCTTTTTTGCTGGAGGGCTTTGG + Intronic
1118649925 14:67880254-67880276 CTTGTTTTTCTTGAAGTGTCGGG + Intronic
1119053684 14:71396068-71396090 CCTATCTTGCTTAAGGTGTCAGG + Intronic
1119198147 14:72732620-72732642 CCTTTTTTTCTGAAGGTATCAGG + Intronic
1119329534 14:73783861-73783883 CCTCTTTAGCTGGGGGTGTTCGG + Intronic
1120489652 14:85161263-85161285 CCTGTTCCGGTGGAGGTGGCAGG - Intergenic
1121503421 14:94458396-94458418 CCTGTTCTGGTGGAGATGGCAGG + Intergenic
1121511831 14:94518305-94518327 CCTGATTAGCTGGATGTGTCTGG + Intergenic
1121516553 14:94556118-94556140 CCCGTTTTGGTGGAGGCGGCAGG + Intergenic
1121573206 14:94962836-94962858 CATTTTTTGCTGGTGGTGGCGGG - Intergenic
1124240096 15:28021405-28021427 CCTGTTTTGCTCTAGGTTTCAGG - Intronic
1125055884 15:35358769-35358791 CCTGTTCTGGTGGAGGTGGCGGG + Intronic
1125899056 15:43328831-43328853 CCCTTATTGCTGGAGGTCTCGGG - Exonic
1125968348 15:43892059-43892081 TCTGTGTTGCAGGACGTGTCAGG - Exonic
1127194517 15:56569148-56569170 CCTGTTTCGGTGGAGGTGGCAGG - Intergenic
1128415073 15:67437156-67437178 CCTGTTCTGATGGAGGTGGCGGG - Intronic
1128705959 15:69837617-69837639 CCTGGGATGCTGGAGGGGTCAGG + Intergenic
1128940656 15:71785122-71785144 CCTGGTCTGCTGGAGGAGTCCGG - Intergenic
1130881468 15:88059574-88059596 CCTGTGTTGATTGAGGTGCCTGG - Intronic
1132613164 16:827707-827729 CGGGTTGTGCTGGAGGTCTCAGG + Intergenic
1133842914 16:9426429-9426451 ACTATTTTGCTGGAGGTGGAGGG + Intergenic
1134466906 16:14486949-14486971 CCTGTTTCCCTGGAGGTGAGTGG + Intronic
1136506795 16:30709639-30709661 CCTGCTTTGCTGGAGGTTAATGG - Exonic
1137759005 16:50925491-50925513 ACTGTTTTGATGGTGGTGTGGGG + Intergenic
1138355369 16:56373473-56373495 CCTGTCGTGATGTAGGTGTCGGG - Intronic
1138391303 16:56671752-56671774 CCTGTGCTGCTGAAGGTGTGTGG - Intronic
1141768545 16:86074710-86074732 CCTGGGGTGCTGGAGGTGACTGG + Intergenic
1141832939 16:86519822-86519844 CCTGTTTGGGGGGAAGTGTCCGG - Intergenic
1142270178 16:89084878-89084900 GCTGTTTTTCTGGAACTGTCAGG + Intergenic
1142714124 17:1738747-1738769 CTTATCTTGCTGGTGGTGTCAGG + Intergenic
1146056774 17:29585263-29585285 CCTGGGCTGCTGGAGGTGGCTGG - Intronic
1147463143 17:40588823-40588845 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
1148194767 17:45705458-45705480 CCTGTGTTGCTGCAGGTGGAGGG - Intergenic
1150893709 17:69184485-69184507 CCTGTTCTGGTGGAGGTAGCAGG - Intronic
1152213724 17:79019962-79019984 CCTGGTTTTCTGCAGGTGTGAGG + Intergenic
1152451758 17:80385990-80386012 TCTCTTTTGATGGTGGTGTCTGG + Intronic
1153168927 18:2293203-2293225 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
1153361803 18:4206147-4206169 CCTGTTGGGTTGGAGGTGCCTGG + Intronic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153582534 18:6589039-6589061 CCTGGTATGCTGGAGTTGGCTGG - Intronic
1154133979 18:11760286-11760308 GCTGTTTTGCTGTATGTGTGGGG - Intronic
1154297931 18:13166281-13166303 CCTGCTGTGGTGGAGGTGGCAGG - Intergenic
1154973471 18:21433857-21433879 GCTGTTCTGCTGGAGTAGTCAGG + Intronic
1155529833 18:26755659-26755681 TCTGTTTTGCTGGATGACTCTGG + Intergenic
1156020967 18:32598561-32598583 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1157218650 18:45807484-45807506 CCTGTTCTAGTGGAGGTGGCAGG - Intergenic
1157624987 18:49044013-49044035 GCTGCTTGGCTGGAGGGGTCCGG + Exonic
1158002663 18:52636924-52636946 CCTGTTCCGGTGGAGGTGGCGGG - Intronic
1158679551 18:59554782-59554804 CCTGTCTGGCTGGAGGAGGCTGG - Intronic
1159453994 18:68638293-68638315 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1159787135 18:72727464-72727486 CCTGTTTCTGTGGAGGTGGCAGG - Intergenic
1160162320 18:76483164-76483186 CCTGCTTTGCTGGAGAAGGCAGG + Intronic
1160989940 19:1856392-1856414 CTTGTTTTGCTGAGGGTGTCGGG - Intronic
1161608220 19:5226336-5226358 ACTGGTGTGCTGGAGGTGCCCGG + Intronic
1163088778 19:15003429-15003451 GCTTTTCTGGTGGAGGTGTCAGG - Intronic
1164244179 19:23416148-23416170 CCTGTTTTCCTGGGGGTGGAGGG - Intergenic
1164623470 19:29711627-29711649 CCTGTTTTGGGAGTGGTGTCTGG - Intronic
1166347561 19:42176050-42176072 TCTCTTTTCCTGGAGGTGTGGGG - Intronic
1167859316 19:52270123-52270145 CCTGTGTTGGGGGAGGTGGCCGG + Intronic
1168312413 19:55467627-55467649 CCTGTTCTGCTCCAGGTCTCAGG + Intergenic
925343369 2:3151763-3151785 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
925720690 2:6823662-6823684 GCTGCTTTGCTGGAGATGTTTGG - Intergenic
926806921 2:16719621-16719643 CCTTCTTAGCTGCAGGTGTCTGG - Intergenic
927328290 2:21832220-21832242 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
927363448 2:22264507-22264529 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
928472993 2:31592456-31592478 TCTGCTCTGGTGGAGGTGTCAGG - Intergenic
929115211 2:38438163-38438185 CTTGTTTTGCTGGATGGGGCTGG - Intergenic
929722858 2:44388888-44388910 CCTGTTCTGGTGGAGGTGGCGGG + Intronic
930159968 2:48144790-48144812 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
930469641 2:51795779-51795801 CCTGCTCTGCTGGAGGTAGCAGG - Intergenic
930486454 2:52017520-52017542 CCTGTTTCAGTGGAGGTGGCAGG + Intergenic
930574246 2:53126959-53126981 CCTGTTCTGGTGGAGGTAGCAGG + Intergenic
931451349 2:62370006-62370028 CCTGTTCTTCTGGAGGCGGCAGG + Intergenic
931993074 2:67810077-67810099 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
933474430 2:82771244-82771266 CCTGCTTTCATGTAGGTGTCAGG - Intergenic
933760305 2:85667886-85667908 CCAGTTTTGCTGGGAGTGTGAGG + Intronic
934111348 2:88746643-88746665 CCTGCTTCGGTGGAGGTGGCAGG + Intronic
935007179 2:99090018-99090040 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
935555162 2:104502058-104502080 CCTGTACTGCATGAGGTGTCAGG + Intergenic
937475118 2:122208439-122208461 CCTCTGTTGCTGGTGGTCTCTGG + Intergenic
937521847 2:122721248-122721270 CCTGTTCCACTGGAGGTGCCAGG - Intergenic
937767573 2:125679871-125679893 CCTGTTCTGGTGGAGGTGGCTGG + Intergenic
938159349 2:128971793-128971815 CCTTTTCTTCTGGAGGTGCCGGG + Intergenic
938564189 2:132503456-132503478 CCTGCTTTGATGGAGGTAGCAGG + Intronic
938996441 2:136683568-136683590 CCTGCTTTGGTGGAGGTAGCAGG - Intergenic
939219398 2:139282025-139282047 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
940172316 2:150842749-150842771 CCTGTTCTGGAGGAGGTGGCAGG + Intergenic
940217580 2:151316110-151316132 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
940739292 2:157488924-157488946 CCTGTAGTGCTGGAGCTGGCTGG + Intronic
940784928 2:157971373-157971395 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
941060676 2:160843191-160843213 CCTGCTTTGGTGGAGGTAGCAGG - Intergenic
941627487 2:167845349-167845371 CCTGTTCTGGTGGAGGTGGTTGG - Intergenic
941939684 2:171021046-171021068 CCTGTTTTTCTGGGGGTGTGTGG + Intronic
942154683 2:173115799-173115821 CCTGTTCTGGTGGAGGTGGCGGG + Intronic
943257224 2:185611292-185611314 GCTGTTTTGCTGCTGCTGTCGGG - Intergenic
944432025 2:199644426-199644448 CCTGTTCTGATGGAAGTGGCAGG + Intergenic
945482534 2:210360578-210360600 CTTGTTTTGGTGGAGTTGGCAGG + Intergenic
946653243 2:221916886-221916908 TCTGTTTTGGTGGAAGTCTCTGG - Intergenic
947457023 2:230264859-230264881 CCTGTTCTGCTGGAGGTGAAGGG + Intronic
1169263618 20:4154815-4154837 CCTGTGTTGCGGGATGTGTAGGG + Intronic
1169397856 20:5250701-5250723 CCTGTTCTGGTGAAGGTGGCAGG + Intergenic
1169401371 20:5283244-5283266 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1169706034 20:8505625-8505647 TCTGTTTTGCTAGACGTGTTTGG + Intronic
1170245709 20:14219911-14219933 CCTGTTCCGGTGGAGGTGGCGGG + Intronic
1170794073 20:19531464-19531486 ACTGTTTGGCAAGAGGTGTCTGG + Intronic
1170865377 20:20150660-20150682 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
1171388224 20:24784630-24784652 CTGGTTATGCTGGAGGTCTCAGG + Intergenic
1172335916 20:34115253-34115275 CCTGTTTTGCTGGCTGTATATGG - Intergenic
1173353091 20:42262776-42262798 CATGTTTTGTTGGAGCTGTTTGG - Intronic
1173759449 20:45546933-45546955 CCTGTTTTGCTTGTGGGGTAAGG + Intronic
1174116755 20:48231515-48231537 GATGTTTTCCTGGAGGTGGCAGG + Intergenic
1176658631 21:9613104-9613126 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1177080630 21:16634611-16634633 CCTGTTTTGGAGGTGGTGTTTGG + Intergenic
1178732024 21:35112864-35112886 ACTGCTTTTCTGGAGGTCTCTGG + Intronic
1178967320 21:37133657-37133679 CCTGCTCTGCTGGAGCTTTCAGG + Intronic
1179982837 21:44905483-44905505 TCTGTGGTGCTGGAGGTGTCAGG - Intronic
1180039917 21:45270655-45270677 CCTGCTCTGCTGGAGGTGGCGGG - Intronic
1181291707 22:21799462-21799484 CCTGTCCTGCTGGAGCTCTCAGG + Intronic
1185017302 22:48352260-48352282 CCTGCTTGGCTGGAGTTGGCTGG - Intergenic
950581822 3:13867311-13867333 CTTGTCTTGCTGCAGGTGTGGGG - Intronic
950599156 3:14016829-14016851 CCTGCTGTGGTGGAGGTTTCAGG + Intronic
950603500 3:14057509-14057531 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
951027292 3:17843595-17843617 CCTGTTTGGCTGGAGGGGAGTGG + Intronic
951183846 3:19689060-19689082 CCTGTTCTGGTAGAGGTGGCAGG - Intergenic
951269668 3:20608609-20608631 CCTGTTCTGGTGGAGGTGGTGGG - Intergenic
951851949 3:27151260-27151282 CCTGTTCTGGTGGAGGTGGTGGG - Intronic
952067907 3:29594212-29594234 CCTTTTTTGTGGGAGTTGTCTGG + Intronic
952082928 3:29782286-29782308 CCTGCTTTGGTGGAGGTAGCAGG - Intronic
952748922 3:36808343-36808365 TCTGTTTTGCAGGATTTGTCTGG - Intergenic
953417995 3:42734017-42734039 CCTCTCTGGCTGCAGGTGTCTGG - Intronic
953723904 3:45381276-45381298 CCTGTTCTGGTGGAGGTGGTGGG + Intergenic
953960647 3:47263434-47263456 GCTGTTTTCCTGCAGGTGGCTGG - Intronic
954296453 3:49677021-49677043 CCTGGTGAGCTGGAGGTGGCAGG + Exonic
954363292 3:50133684-50133706 CCTGCTTTGCTGGTGGGGTGGGG - Intergenic
955961647 3:64346774-64346796 CCTGTTAAGCTTGAGATGTCTGG + Intronic
956907148 3:73778094-73778116 CCTATAGTTCTGGAGGTGTCTGG + Intergenic
957392764 3:79599013-79599035 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
957681416 3:83440513-83440535 CCTGCTCTGGTGGAAGTGTCAGG - Intergenic
958013862 3:87914949-87914971 CCTGTTTTAGTGGAGGTGGTAGG - Intergenic
958448684 3:94246308-94246330 CCAGTTTTTCTAGAGGTGCCCGG + Intergenic
958969891 3:100600355-100600377 CCTGTTCTGGTGGAAGTGGCAGG + Intergenic
960153014 3:114270530-114270552 CCTGCTTTGGTGGAGGTAGCTGG + Intergenic
960512797 3:118571355-118571377 CCTGTTCTGGTGGAGGTGGCGGG + Intergenic
960578017 3:119246164-119246186 CTTGTTCTGATGGAGGTGGCAGG - Intergenic
960634480 3:119769361-119769383 CCTTTCTTGCTGGAGGGGTTAGG - Intergenic
961451570 3:127004589-127004611 CCTGGTGTGGGGGAGGTGTCAGG - Exonic
962191917 3:133319633-133319655 CCTGCTCTGGTGGAGGTGGCAGG - Intronic
962401795 3:135067075-135067097 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
963050999 3:141143503-141143525 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
963920064 3:150896764-150896786 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
964189040 3:153980665-153980687 CCTGTTCTGATGGAAGTGGCAGG - Intergenic
964297035 3:155245268-155245290 CCTCTTTGGATGGATGTGTCAGG + Intergenic
964325035 3:155535934-155535956 CCTGTTCTGGTGGAGGTAGCAGG - Intronic
965345202 3:167540294-167540316 CCTGCTCTGGTGGAGGTGTCAGG - Intronic
965874330 3:173299172-173299194 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
967257470 3:187608718-187608740 CCTGTTCTGGTGCAGGTGGCAGG + Intergenic
967465768 3:189804499-189804521 ATTGTTTTGCTGGACCTGTCTGG + Intronic
968419588 4:472947-472969 CCTGTTTTCCAGGAGGTCACAGG - Intronic
969547919 4:7844085-7844107 GAGGGTTTGCTGGAGGTGTCAGG - Intronic
969918717 4:10515586-10515608 CTTGTTTTCCATGAGGTGTCAGG - Intronic
970856216 4:20651712-20651734 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
971202606 4:24525240-24525262 ACTGTTTTGCTTGATGTATCTGG + Intronic
971682431 4:29717634-29717656 CCTGTTTTGTCGGAGGAGACGGG + Intergenic
972097274 4:35364131-35364153 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
972189022 4:36568327-36568349 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
972806516 4:42533777-42533799 CCTGCTTTGGTGGAGGTAGCAGG - Intronic
972899720 4:43668623-43668645 CCTGTTCTGGTGGAGGTAGCAGG + Intergenic
973037447 4:45423821-45423843 CCTGCTGTGGTGGAGGTGGCAGG + Intergenic
973069106 4:45835373-45835395 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
973746229 4:53965941-53965963 CCTGTGTAGGTGGAGATGTCTGG + Intronic
973831509 4:54764543-54764565 ACTGTTCTGGTGGAGGTGGCAGG + Intergenic
974801770 4:66827851-66827873 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
975614091 4:76229721-76229743 CCTGCTCTGATGGAGGTATCAGG + Intronic
975944961 4:79695380-79695402 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
976963059 4:91003133-91003155 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
978322568 4:107514637-107514659 TCTGCTTTTCTGGAGGTCTCAGG - Intergenic
978999374 4:115199123-115199145 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
979833090 4:125325428-125325450 GTTGTTTTCCTGGAAGTGTCAGG + Intronic
981077069 4:140602632-140602654 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
981400928 4:144313288-144313310 CCTGTTCTGGTGGAGATGTCAGG + Intergenic
982218720 4:153106799-153106821 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
982312105 4:153997062-153997084 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
982630611 4:157824706-157824728 CCTGTTCTGGTGGAGGTAGCAGG - Intergenic
983894498 4:173067846-173067868 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
984190558 4:176600880-176600902 CCTGCTTTGGTGGAGGTAGCAGG + Intergenic
984825851 4:183924166-183924188 GCTGGTTTGCTGAAGGTGTGAGG - Intronic
985142513 4:186856880-186856902 GGGGTTTTGCTTGAGGTGTCAGG - Intergenic
985416775 4:189742963-189742985 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
985561854 5:591962-591984 CCTGCTCTGGTGGAGGTGTCAGG + Intergenic
986069586 5:4269122-4269144 CCAGGTTTTCTGGAGGTGGCTGG - Intergenic
987525632 5:19045710-19045732 CATGTTCTGATGGAAGTGTCAGG - Intergenic
987577775 5:19752785-19752807 CCTGTTCTGGTGGAGGTGGCAGG - Intronic
988344662 5:30021379-30021401 CCTGTTTTGGTGGAGGTGATGGG - Intergenic
988723503 5:33903053-33903075 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
988875830 5:35444642-35444664 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
989525956 5:42454182-42454204 CCTGCTCTGGTGGAGGTGACAGG + Intronic
990243555 5:53839171-53839193 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
990445006 5:55886180-55886202 CCTGTTTTCCTGGAGGATGCAGG + Intronic
990990198 5:61676402-61676424 CCTGGTATGCAGGAGGTATCTGG + Intronic
991117430 5:62970315-62970337 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
992231117 5:74664872-74664894 CCTGTTTTCCTGCAGGTGCTAGG - Intronic
993743055 5:91563387-91563409 CCTGCTCTGTTGGAGGTGGCAGG - Intergenic
993796615 5:92275470-92275492 CCTGCTTTGATGGAGGTGGCAGG - Intergenic
994222129 5:97208416-97208438 CCTGTTTCGGTGGAGGTGGCAGG + Intergenic
994589432 5:101755010-101755032 CCAGTTTTGGAGGAGGGGTCTGG + Intergenic
994646109 5:102470848-102470870 CCTGTTCTGGTGGAGGTAGCAGG + Intronic
995145742 5:108785683-108785705 TCTCTCTTGCTGGTGGTGTCTGG + Intronic
995714608 5:115069688-115069710 CCAGTCTTTCTGTAGGTGTCTGG - Intergenic
995722556 5:115151635-115151657 CCTGTTCTGATGGAGGTGGCAGG - Intronic
995955371 5:117770192-117770214 CTTGTTCTGGTGGAGGTGGCAGG - Intergenic
996031857 5:118714377-118714399 CCTGTTCTGCTGGAGGTGGCAGG - Intergenic
996141281 5:119912894-119912916 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
996288896 5:121828738-121828760 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
996431892 5:123389987-123390009 CATCTTTTGTTGGAGGTGACTGG + Exonic
997231883 5:132251454-132251476 CCTGTGTTGCTGGGAGAGTCAGG - Intronic
998741692 5:145210418-145210440 CCTGCTCTGGTGGAGATGTCAGG - Intergenic
998940916 5:147280890-147280912 CCTATTCTGGTGGAGGTGGCAGG - Intronic
999219982 5:149967480-149967502 TTTCTTTTGGTGGAGGTGTCAGG + Intronic
999484763 5:151984715-151984737 CCTGTTCTGGTGGAGGTGATGGG + Intergenic
999677138 5:154015379-154015401 CCTGTTTTGCTGGAGGTGTCGGG - Intronic
1006603802 6:35242704-35242726 CCTCTTTGCCTGGAGGGGTCCGG - Exonic
1007878985 6:45140657-45140679 CCTGCTGTGCTGGAGGTGGCAGG - Intronic
1009798565 6:68503200-68503222 CCTGTTTTAGTGGAAGTGGCAGG - Intergenic
1009968880 6:70605254-70605276 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1011168680 6:84479755-84479777 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1011817776 6:91213206-91213228 CCTGCTCTGCTGAAGGTGGCAGG + Intergenic
1012204429 6:96442872-96442894 CCTGCTGTGATGGAGGTGGCAGG - Intergenic
1012377238 6:98577146-98577168 CCTGTACTGTTTGAGGTGTCTGG - Intergenic
1012793798 6:103734666-103734688 CCTGTTCTGGTGGAGGTGGTGGG - Intergenic
1014420238 6:121235094-121235116 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1014531338 6:122563349-122563371 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1014566615 6:122956681-122956703 CCTGATTTGGTGGAGGTAGCAGG - Intergenic
1014603949 6:123448826-123448848 CCTATTCTGGTGGAGGTGGCAGG - Intronic
1015663258 6:135600125-135600147 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
1016425574 6:143933027-143933049 CCTGTTCTGATGGAGGTGGCAGG + Intronic
1017009041 6:150050236-150050258 CCTGATCTGCTGGAGGCCTCTGG + Intergenic
1018353479 6:162987742-162987764 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1018635220 6:165854608-165854630 CTTGTCTTGCTGGAGGTGAGGGG + Intronic
1018781724 6:167073896-167073918 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1019123410 6:169823612-169823634 CCTGTTCTGGTGGAGGTAGCAGG + Intergenic
1019294129 7:265050-265072 CTTGTTTTGCTGGGCGTGTTTGG - Intergenic
1020332303 7:7032190-7032212 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1021579770 7:22140468-22140490 CATGTTTTGATGAAGGAGTCAGG - Intronic
1021843467 7:24742093-24742115 CCTGCTCTCCTGGAGGTGCCTGG - Intronic
1022105611 7:27194484-27194506 CCTATTTTTCAGGAGGTGGCTGG + Intronic
1022576241 7:31499831-31499853 CATGTTTTGCTGGGGGTGGTGGG + Intergenic
1023227248 7:37983589-37983611 CCTGTTTCTCTGGAGATGTTGGG + Intronic
1023657559 7:42440603-42440625 CCTGCTCTGCTGGAGGTAGCAGG + Intergenic
1023737585 7:43248583-43248605 CCTGATTTTCTGTTGGTGTCAGG - Intronic
1024669239 7:51577207-51577229 CCTGTTCTGGTGGAGGTGGTAGG + Intergenic
1025571951 7:62584995-62585017 CCTCTTTTGCTGGAGCAGTTTGG - Intergenic
1025807502 7:64849327-64849349 CCTGCTTTGGTGGAGGTAGCAGG + Intergenic
1026807164 7:73435770-73435792 CCTGTGTGGCTAGAGGTGTGTGG - Exonic
1027699274 7:81449650-81449672 CCTGTTCTGGTCGAGGTGGCAGG - Intergenic
1027963806 7:84980729-84980751 ACTGTTCTGGTGGAGGTGGCAGG + Intergenic
1028782927 7:94757676-94757698 CCTGTTCTGGTGGAGGTAGCAGG - Intergenic
1029247298 7:99211655-99211677 CCTGTCTTGCTGTGGGTGGCTGG - Intergenic
1030325260 7:108212003-108212025 CCTGTTCTGGTGGAGGTGGCAGG - Intronic
1030390398 7:108920731-108920753 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1031761200 7:125715697-125715719 TCTGTTCTGGTGGAGGTGGCTGG + Intergenic
1031799337 7:126223146-126223168 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1031961101 7:127990852-127990874 CCTGCTTCACTGGAGGTGTCAGG + Intronic
1033152906 7:138931951-138931973 CATGTGTTCCTGGAGGTGTGTGG + Intronic
1033401189 7:141026798-141026820 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1033462702 7:141562047-141562069 CCTGCTGTGGTGGAGGTGGCAGG + Intronic
1033816659 7:145082310-145082332 CCTGTTTTGGTGGAAGTAGCAGG + Intergenic
1034853587 7:154519260-154519282 CATGTTATGCTGGAGGAGGCTGG + Intronic
1035050605 7:155996797-155996819 CCTGTTTCGCTTCAGCTGTCAGG + Intergenic
1036203501 8:6788427-6788449 TGTGTTTTGCAGCAGGTGTCTGG + Intergenic
1038237137 8:25769806-25769828 CCTGTTCTGGTAGAGGTGGCGGG - Intergenic
1038865603 8:31435978-31436000 CCATTGTGGCTGGAGGTGTCTGG - Intergenic
1039000944 8:32979616-32979638 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1040362805 8:46683686-46683708 CCAGTTCTGATGGAGGTGTCAGG + Intergenic
1040588494 8:48766663-48766685 CTTCTTTAGCTTGAGGTGTCTGG + Intergenic
1040867945 8:52069860-52069882 CCTGCTTTGATGGAGGTGGCAGG + Intergenic
1041570492 8:59332800-59332822 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
1042467075 8:69140536-69140558 CCTGTTCCGGTGGAGGTGGCAGG + Intergenic
1043545178 8:81306986-81307008 CCTGTTCTGGTGGAGGTAGCAGG - Intergenic
1043627872 8:82286393-82286415 CCTGTTTCCATGGAGGTTTCAGG + Intergenic
1043986267 8:86696032-86696054 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1044707639 8:95024445-95024467 GCTTTTCTGCTGGAGGTGTTAGG + Intronic
1044804961 8:95996788-95996810 CCTGGTTAGCTGGGGTTGTCTGG - Intergenic
1045306465 8:100960977-100960999 CCTGTTTTGCTGGGGGTTGGAGG - Intergenic
1046394660 8:113625871-113625893 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1046834386 8:118783115-118783137 CCTGTTTTGCTGAATAAGTCTGG + Intergenic
1049635773 8:143688367-143688389 CCTGCTGTGCTGGAGGTGGGAGG + Intronic
1049947351 9:609962-609984 CTTGTTTTACTTGAGGTGTCAGG + Intronic
1051362732 9:16295170-16295192 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1052537190 9:29761890-29761912 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1052894647 9:33735543-33735565 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1054337115 9:63817216-63817238 CCTGGTTTGCGCGAGGTCTCGGG + Intergenic
1056026707 9:82505052-82505074 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1056309505 9:85324768-85324790 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1058342956 9:103920720-103920742 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1058396279 9:104557517-104557539 CCTGCACTGGTGGAGGTGTCAGG - Intergenic
1060152778 9:121299503-121299525 ATTTTTTTGCTGGAGGTGTTAGG + Intronic
1061763232 9:132864901-132864923 CTCGTTTTTCTGGAGGAGTCTGG - Intronic
1203636358 Un_KI270750v1:116683-116705 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1186825694 X:13337927-13337949 CCTGTGTTGCAGGAAGTCTCAGG - Intergenic
1187681470 X:21771313-21771335 CCTGTTCTGGTGGAGGTGGCTGG - Intergenic
1187773552 X:22730227-22730249 CCTGTTCTGGTGGAGGTGGCAGG + Intergenic
1189187351 X:39065678-39065700 CCTGTTTAGCTGGAGCTCCCAGG - Intergenic
1189663327 X:43326843-43326865 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1189668380 X:43381435-43381457 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1190444531 X:50510291-50510313 CCAGTGTTGCTGGAGGTGCCTGG + Intergenic
1191077234 X:56468406-56468428 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1191080410 X:56504589-56504611 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1191080697 X:56506373-56506395 CCTGTTCTGGTGGAGGTGGCAGG - Intergenic
1191880800 X:65842238-65842260 GCTGTTTTGCTGGTGCTGTCTGG + Intergenic
1191903521 X:66064082-66064104 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1191920728 X:66254467-66254489 TCTGTTTTCCTGGTGCTGTCAGG + Intronic
1192021968 X:67403328-67403350 CCTGGTTTGATGGAGGTGGCAGG + Intergenic
1192869393 X:75171967-75171989 CCTGCTCTGGTGGAGGTGACAGG + Intergenic
1192921571 X:75712841-75712863 CCTGCTCTGGTGGAGGTGGCAGG + Intergenic
1192929630 X:75792166-75792188 CCTGTCCTGGTGGAGGTGGCAGG - Intergenic
1193389872 X:80913828-80913850 CTTGTTCTGGTGGAGGTGGCTGG + Intergenic
1193631913 X:83899746-83899768 CTTGTTTTGGTCGAGGTGGCAGG - Intergenic
1193680925 X:84518357-84518379 CCTGTTTTGGTGGAGGTGGCAGG + Intergenic
1193950757 X:87795383-87795405 CCTGCTCTGGTGGAGGTGGCAGG - Intergenic
1193954589 X:87844200-87844222 CCTGCTTTCATGGAGGTGACAGG + Intergenic
1194095269 X:89631929-89631951 CCTGTTCTGGTGGAGGTAGCAGG + Intergenic
1194214378 X:91110499-91110521 CCTGCTCTGATGGAGGTGGCAGG + Intergenic
1194237252 X:91399535-91399557 CCTGCTTGGGTGGAGGTGGCAGG - Intergenic
1194299033 X:92162719-92162741 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1194353810 X:92856006-92856028 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1194439014 X:93906315-93906337 CCTGATCTGGTGGAGGTGGCAGG + Intergenic
1194471370 X:94302125-94302147 CCTGTTCTGATGGAGGTGGTAGG + Intergenic
1194701438 X:97119438-97119460 CCTGTTCTGGTGGAGGTGGCAGG + Intronic
1195051137 X:101098083-101098105 CCTGATTGGCTAGAGGTGGCGGG - Intergenic
1195211026 X:102652251-102652273 CCTGGATTTCTGGAGGTGTGTGG + Exonic
1195217177 X:102713203-102713225 CCTGGATTTCTGGAGGTGTGTGG + Exonic
1196170944 X:112587865-112587887 CCTGTTCTGGTGGAGGTGGCTGG - Intergenic
1196948224 X:120849975-120849997 CCTGTTTTGGTGGAGGTGGCAGG + Intergenic
1197132458 X:123020425-123020447 CCTGTTCCGGTGGAGGTGGCGGG - Intergenic
1197518963 X:127473431-127473453 CCTGTTCTGGTGGAGGTGACAGG - Intergenic
1197533533 X:127661700-127661722 CGTATTCTGCTGGAGGTGTGTGG - Intergenic
1197556699 X:127964362-127964384 CCTGTTCTTGTGGAGGTGGCAGG + Intergenic
1197578476 X:128252545-128252567 CCTGTTTGGATGGTGGTGTGGGG - Intergenic
1197664558 X:129210128-129210150 CCTGTTCTGGTAGAGGTGTCAGG + Intergenic
1197671588 X:129284083-129284105 CCTGTTCTGGTGGAGGTGGCCGG + Intergenic
1198616492 X:138463600-138463622 CCTGCTTTGCTGGAGGTGGTAGG - Intergenic
1198770266 X:140123404-140123426 CCTGCTATGGTGGAGGTGGCAGG + Intergenic
1199057799 X:143318777-143318799 CCTGTTCTGGTGGAGGTGGTGGG + Intergenic
1199282882 X:146022569-146022591 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1199586902 X:149424141-149424163 CCTGTTCTGGTGAAGGTGGCAGG - Intergenic
1200447900 Y:3288107-3288129 CCTGTTCTGGTGGAGGTAGCAGG + Intergenic
1200616636 Y:5387553-5387575 CCTGCTCTGGTGGAGGTGGCAGG + Intronic
1200662170 Y:5973078-5973100 CCTGCTCTGATGGAGGTGGCAGG - Intergenic
1200937272 Y:8749195-8749217 CATGTTTTGCTGGAGGAGGAGGG + Intergenic
1201315848 Y:12644464-12644486 CCTGTTCTGCTGGAGGTTGCAGG - Intergenic